How To Write Good Essay In Ielts Exam. Online assignment writing service.

How To Write Good Essay In Ielts
Exam
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid
email address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete
the 10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing
style, attach a sample of your previous work.
3. Step
When seeking assignment writing help fromHelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for
your request, choose one of them based on qualifications, order history,
and feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing
services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully
met.
How To Write Good Essay In Ielts ExamHow To Write Good Essay In Ielts Exam

Copyright Laws And Its Impact On Intellectual Property...
Introduction Copyright laws were established to provide authors with rights over their creations
and to prevent unauthorized use and distribution of these creations by others. Although the law
grants ownership to one party, usually the author of the work, there is a doctrine for granting
ownership of work made for hire to educational institutions (Crews, 2006). This doctrine supports
that if the employee developed the work under the parameters of their scope of employment or
through the use of resources provided by the employer, then the employer owns the rights to the
work (Crews, 2006). In an effort to clarify the mandates of copyrightlaw and improve understanding
of intellectual propertyownership, educational institutions have developed their own policies
addressing intellectual propertyownership. The policies vary by institution, but share the same
purpose of providing guidelines and conditions for ownership of creations by the educational
institution s faculty. The University of Maryland in College Park (UMCP) promotes the
development of educational materials by faculty to provide and deliver the best education to its
students. In an effort to address the law of copyright and clarify intellectual property ownership,
as well as patents and trademarks, UMCP has developed an extensive intellectual property policy.
This paper will review the policy in reference to the law as it applies to the development of works
by faculty for use in distance education programs.
... Get more on HelpWriting.net ...

Poaching And Robin Hood
INTRODUCTION
We, the people of the world, do many things for the sake of our survival. Things that we are very
proud of and things that we are not. People have needs and they do or invent things based off of
their needs. How far they are willing to go is the million dollar question. Poaching has been
going on since the world began, but it did not become a problem and become illegal until the
Late Middle Ages. In the times where the lower class were peasants and the upper class had
control of pretty much everything. Robin Hood was of the first well known poachers during this
time period. His reasoning, like the reasoning like many other that poach, Hood was in desperate
need of money and food for his family. With the help of his crew, Hood... Show more content on
Helpwriting.net ...
Although, in reality the number of people that actually know why poaching is done is very low.
Poaching, by definition, is the illegal act of killing, capturing, or removing mammals, birds, fish,
reptiles, insects, or plants from their natural habitats. (Greene, 1994, p.11). Yes. poaching is
illegal but there is a reason to why people feel the need to do these types of things. One of the first
reasons to why started poaching in the beginning was the fear of starvation. This reasoning was
often said to cause the most motivation for people to poach. People in countries where poaching is
most common, like Zimbabwe and Kanye, the economy is not doing well enough for people to
have enough money to support their families. By hunting for large game, poachers use the meat to
feed their families and allow them to keeping living. The desperation that people that poach must
have to do this is unimaginable, but just like the average person in any country they will do what
they have to to keep their family ahead.
Another reason why poachers do what they do is for the huge income that they gain from it.
Wanting to make a respectful income is not being greedy. Just like any other job, poachers do
what is necessary to make money. Poachers will sell parts of animals or animals all together. Most
poachers only receive 5 10% of the money that they make selling the animal. Based off of the job
that they do that is very little

Sexualization Of Beauty Pageants
When most people think of beauty pageants, they think of Barbie like little girls with their tiny
bedazzled dresses and swimsuits strutting their stuff on stage while showing off their million
dollar smile. The pageant judges watch their every move looking for a mistake in their routine
while an audience of mostly moms screams, applauds, and cheers for them behind the line of
judges, showing the girls the exact moves they are supposed to be doing. A beauty pageant is an
assembly of girls or womenat which judges select the most beautiful (Cartwright). Beauty pageants
are one of the fastest growing businesses in America grossing over 5 billion dollars (Nussbaum).
They are usually divided into categories; personality, talent, modeling,... Show more content on
Helpwriting.net ...
They promote a materialistic belief that tells young girls that physical beauty is most important.
The number of young girls who are growing up too early is growing rapidly throughout the
United States and the rest of the world. Kids are deprived of their childhood because pageants
take up all their time and they make them eager to grow up because of all the makeup and glitz.
When they want to go outside and play with their friends, they are forced to practice for hours
before an upcoming pageant. They grow up way too fast because parents are allowing them to
wear revealing clothes and act inappropriately for their age. For example, Windy Dickey dressed
her daughter, Paisley, Winner of many Child Beauty Pageants, up in a costume that was exactly the
same as Julia Roberts character wore in the movie Pretty Womanthe fitted, skin baring white
blouse, the tight blue mini skirt and thigh high, shiny black boots (Canning). These young girls
wear tons of makeup, false eyelashes, have their eyebrows done, have fake hair and even
flippers which are fake teeth. Beauty pageant contestants may develop a misconception about life
and beauty while being involved in them. They may grow up to believe that only physical beauty
matters and that it is the primary judge of one s self worth. Pageants can damage the self esteem
of a young girl when things do not go as she would hope (Nussbaum). What will a mother tell her
three year old daughter if the child says that she didn t win because she is not pretty

case num 1 hardley dav Essay
Harley Davidson Motor Company: Enterprise Software Selection (Case analysis)
Case description
This case focuses on a change program and selection of an enterprise software vendor. The decision
of which partner to choose to help the company change the way it purchased raised fundamental
tensions within the company .
Question 1
Consider Exhibit 10 on page 22 of the case; does it include the factors you consider most important
in the selection process? Which factors would you be inclined to weight most heavily?
I think Harley Davidson did a very good job selecting the evaluation criteria. From the functional
criteria, I consider Receiving, Supply Management and Project Tracking the most important
functionalities. The others are mainly ... Show more content on Helpwriting.net ...
%| | 80% 90%| 3| Receiving| 4| 4| 3| 12,50%| | 70% 80%| 2| Supply management| 2| 4| 4| 12,50%| |
50% 70%| 1| Project Tracking| 4| 4| 4| 12,50%| | 0 50%| 0| Miscellaneous| 4| 4| 4| 9,00%| | | |
Interfaces| 4| 4| 4| 9,00%| | | | Training| 4| 4| 4| 9,00%| | | | Others| 4| 4| 4| 8,50%| | | | Total Weigted|
3,66| 4| 3,875| | | | |
Table 2 Qualitative Criteria Criteria| P1| P2| P3| Weight| | | | | | | | | | | | Long Term Relationship
Potential| 4| 4| 3| 10%| | | | Research and Development| 3| 4| 3| 5%| | Evaluation| Score| Training
Approach| 4| 3| 1| 10%| | H| 4| Implementation/Education/Change Managemente| 4| 3| 2| 10%| | MH|
3| Understanding Harley s requirements| 4| 3| 2| 10%| | M| 2| Enabling The SMS| 3| 4| 3| 5%| | ML|
1| Out of the box fit| 3| 4| 3| 5%| | L| 0| Financial Viability| 3| 4| 3| 5%| | | | Cost| 4| 0| 2| 5%| | | |
Technical Support Offerings| 4| 4| 2| 5%| | | | Overall Functionality| 4| 4| 3| 5%| | | | Number of
partner providers| 3| 4| 3| 5%| | | | Architecture compatibility| 4| 3| 4| 5%| | | | Platform portability| 4|
2| 4| 5%| | | | Web functionality| 2| 4| 1| 5%| | | | Manufacturing experience| 4| 3| 2| 5%| | | | Total
Weighted| 3,65| 3,3| 2,45| | | | |
If each set of

Relationship Between Conflict Of Interest And Firm...
Relationship between firm innovativeness and its factors: Relationship between Result
Demonstrability and Firm innovativeness: The degree to which the results or benefits of using the
innovation are apparent i.e. how tangible or apparent these benefits are to the adopter. The
technology should visibly improve the quality or effectiveness of the adopters work or processes
e.g. the decision making process or the job output quality. Result demonstrability also measured in
way that team going to generate results is either trained or not because if team is capable of
working on new assignment then he can generate positive and applicable results. Study revealed
inconsistence of PCI (persistent characteristics of innovation) in influencing the diffusion and
adoption of an innovation which is similar to that of PAI (persistent attributes... Show more content
on Helpwriting.net ...
Relationship between conflict of interest and firm innovativeness: An interest may be defined as
a commitment, goal, or value held by an individual or an institution. Conflict of interests exists
when two or more contra indicatory interests relate to an activity by an individual or an
institution. The conflict lies in the situation, not in any behavior or lack of behavior of the
individuals. That means a conflict of interest is not intrinsically a bad thing. A conflict of interest
is a situation in which a corporation or person with a vested interest in a company becomes
unreliable because of the clash between personal interests and professional interests. An example
of a conflict of interest would be a board member voting on the induction of lower premiums for
companies with fleet vehicles when he is the owner of a truck company outside of the corporation.
In relation to law, representation by a lawyer or party with a vested interest in the outcome of the
trial would be considered a conflict of interest, and the representation would not be

A Comparison Of Dragons In Beowulf And The Faerie Queene
Dragons in Beowulf and in Edmund Spenser s The Faerie Queene
When one usually thinks of a dragon, one thinks of dragon slayers, adventure, damsels in
distress, and cheap fantasy novels. Dragons in literature have not always been used for such
meaningless
entertainment. There are many precedents for dragons in medieval literature, two of the most
prominent
being in the Old English poem Beowulf and in Edmund Spenser s The Faerie Queene. In both of
these
epic poems, dragons play major antagonistic roles. The foe of Beowulf and the two dragons in The
Faerie Queene serve as important symbolic parts of the story and as reflectors that bring out the
good, or
bad, qualities of the hero. Although each dragon represents ... Show more content on
Helpwriting.net ...
During the ensuing battle the Warren 2
dragon is constantly emitting fierce battle fire and fatal flames that light the land (Beowulf 80).
Christine Rauer, author of Beowulf and the Dragon: Parallels and Analogues, says that Beowulf is
in fact
fighting fire and heat and that with the especially serpent shaped dragon, he is in fact fighting an
incarnation of the devil, or more likely, what the devil represents (Rauer 33). The first dragon from
The
Faerie Queene enters in Canto Eight, also full of fire and hell imagery: the proud Duessa came high
mounted on her manyheaded beast, and every head with fyrie tongue did flame, and every head was
crowned on his creast (Spenser 875). The third dragon is perhaps the most fiery of all: swolyne with
wrath and poyson, and with bloudy gore and with roused and brazen scales, it seems to personify
the king of all evil: Satan (Spenser 914). As his red and black body descends upon his foe, blazing

eyes...did burne with wrath, and sparkled [with] living fire (Spenser 915). He is so evil in looks that
even the cloudes before him fled for terror great and all the heavens stood amazed with this threat
(Spenser 916). These fiery images associated with the dragons connect them with hell and therefore
with
the opposite side of the hero. This association with the Devil is important to understand the
connotations
of the

Zipline Creative Writing
My feet thumped on the wooden stairs as I climbed up the fifth flight. I wondered if my partner
was getting nervous like me. I leaned over the edge and saw the world swirling below me like a
whirlpool. The trees swayed in the lite summer breeze, and their leaves rattled like maracas. I
looked over to my friend from camp. ВґВґAre you nervous? We are really high up.ВґВґ
ВґВґA little bit,ВґВґ She replied. ВґВґIt really isn t that bad.ВґВґ That didn t make me feel any
better. My stomach felt like a swarm of bees, and I felt like I was going to be sick. If only she had
known that the high ropes course was a huge challenge and that it was a series of wobbly ropes and
wood planks. The line started to move again and I climbed up the last flight of stairs.
Suddenly, I remembered last year when I was first trying the zipline, I was standing in this exact
spot thinking the exact same things. I felt very uneasy about doing the zipline, but once ... Show
more content on Helpwriting.net ...
You can do it. I told myself. I had to get across. So I picked up my back foot being careful not to
look down. I placed it onto the next plank were my other foot was waiting. I made it across the
broken plank! I can t believe it. Maybe it wouldn t be so bad in the end. Although I had been
scared, I was determined to finish. I glanced ahead, Only 2 more broken planks to go!
When I got to the end I hugged the tree platform just like my friend.
ВґВґWay to go! That was really nerve wrecking,ВґВґ My friend congratulated me.
ВґВґYeah,ВґВґ I replied. ВґВґYou did great too.ВґВґ
ВґВґGreat Job girls,ВґВґ The instructor said.
I can t believe I did it. I finished the first part of the high ropes course. My heart leaped with joy
and I couldn t wait to tell my mom and dad what I had accomplished when I got home. I realized
that day that even though I was scared, things turned out okay in the end and that it really wasn t
as bad as it seemed. It was actually fun because the high ropes course was a huge

Advantages And Disadvantages Of A Relational Database...
1 Relational Database management system
A relational database management system is based many of the databases system based on
relational database model.
A relational database s use is organizing large amounts of data. Relationships database define the
relationship between two points of tables and these database systems are linked by defining that
relationship. Database is a well maintained collection of data. The data are arranged to model
particular part of reality in a way that supports process requiring information, such as availability
and modelling of rooms in hotels in a way that supports finding a hotel with vacancies.
NumberFirst NameAgeSalary
1Ali421300
2Umar3814000
3Shoaib7013000
4Umar1211020 ... Show more content on Helpwriting.net ...
OODBMS has also over take the favored system for financial application. Similarly, the OODBMS
market is same. The OODBMS continues to find out new application area, such as the www.
ADVANTAGES
1 Recycle and Sharing: The important advantage of extending the Relational data come from
Recycle and sharing. Recycle comes from the able to extend the DBMS to perform better
functionality,
2 expand Productivity: ORDBMS provide expand productivity both developer and for the last user
3 Take of experience in developing RDBMS: Another useful advantage is that. the extended
relational. The important body of knowledge that has gone into developing relational application.
This is a better advantage, as many organization would find it too expensive to change. If the new
function is designed appropriately, this kind of idea should allow organization to take advantage of
the better extension.
Disadvantages
The ORDBMS increased complexity and increased costs. Further, there are the proponents of the
relational approach and theВ· essential simplicity and clarity of the. relational model is lost with
these different types of

New York City Identity Card Essay
Beginning this year, New York City began its municipal identity card program, IDNYC. Anyone
14 years or older living in New York City qualifies for the card and its benefits. The initiative was
announced just around a year ago by Mayor Bill de Blasio. Since its launch in January IDNYC
has seen thousands of citizens sign up and use their cards. The initial rollout saw some hiccups
that slowed sign ups at first. Now with issues resolved, the city boasts that it is meeting the
demand of the city. The card attracts New Yorkers from all walks of life due to its diverse
offerings of free one year memberships to 33 of New York s premiere cultural institutions that
include MoMA PS1, the American Museum of Natural History and the Brooklyn Academy of...
Show more content on Helpwriting.net ...
The cultural institutions are feeling the benefits as well, with many locations noting a rise in
attendance. It s still early, but the upsurge has been fantastic, cultural affairs commissioner Tom
Finkelpearl told WSJ. For the individuals gaining access to new institutions for the first time, like
37 year old Noel Hidalgo, it s all about planning. He told The Wall Street Journal in the same
article, You get the outdoor memberships during the summer, he said. Then as the weather gets
bad, you get your memberships for the museums and the enclosed facilities. In addition to
providing New Yorkers with increased exposure to the arts, cardholders can benefit in other life
improving ways. New Yorkers in need of banking now have less hurdles in setting up a bank
account with IDNYC in place. A common hurdle for immigrants setting up their own accounts has
been a lack of identification. With IDNYC in place, this problem will hopefully see significant
declines in the coming years. Additionally, those needing prescription drug help now have access to
discounts at 95 percent of pharmacies in the

Speed Limits, Road Conditions And Driving Habits
How and why has speed become the number one cause of death to our children and a contributing
factor for many of our older citizens? Speed has become such an epidemic among our teenagers
that government agencies such as the Center for Disease Control (CDC) now publish records and
statistics yearly. During the course of this paper we will review accident statistics, speedlimits, road
conditions and driving habits which are the leading causes of speeding. Even though speed is not
the main factor for vehicle fatalities, speed is dangerous resulting in accidents and influencing
many fatalities. Additionally, the information provided will examine some of the tools provided by
law enforcement and the policies of many insurance companies today to help deter speeders and
prevent automotive fatalities.
Today in the United States and in many other countries vehicle safety is paramount. In Fact, many
of the automotive manufacturers have spent countless hours trying to exercise immense detail to
vehicle safety, and the development to safety devices such as air bags, crumple zones, and frame
and body technology. Fortunately, for drivers, these manufacturers have created real life accident
scenarios which cover everything from rollovers, to frontal impacts, side impacts, and rear impacts.
However, these manufacturers have yet to figure out how to create safety devices that can reduce
speed related accidents, and fatalities. Ultimately, many of the vehicles built by the automotive

Hand Hygeine Research Papaer
Capstone Project Abstract
Background
Hand washing and hand hygiene are consider to be the number one, cheap essential measure of
preventing and controlling spread of hospital acquired infections (HAIs). Hand washing and
hygiene can significantly reduce the burden of disease, in particular in hospitalized patient
Unfortunately compliance to hand hygiene recommended standard procedures by the health care
workers (HCWs) has been unacceptably poor. In order to design education program, identification
of several risk factors associated with poor hand hygiene (HH) compliance is of extreme
importance. Objective: The purpose of this study is to implement a hand hygiene program for ...
The identification of several risk factors associated with poor hand hygiene compliance is of
extreme importance in the design of an education program .There should be continues education
and monitoring of healthcare worker on effective hand washing and hand hygiene. According to an
outcome of a study, wearing finger ring, wrist watch, long fingernail and use of hand lotion has
impact on spread of infection by healthcare workers (Fagemes amp;Lingaas 2010. Health care
workers that use wrist watches at work may cause or promote higher total bacteria count than not
wearing a watch. A similar situation occurs with finder ring and health care workers should
remove finger rings and watches when at work, fingernails should be shorter than 2 mm, so as to
reduce HAI (Fagemes amp;Lingaas 2010).
Description of Present Problem
In America and worldwide, millions of patient are suffering from hospital acquired infections also
call nocosomial infection (NIs). This infection rate has high economic effect that is raising daily,
rises from $6.5 to $33.8 billion within last 5 years (Spruce 2013). One in every 136 patients
admitted to hospital or health facility end up with HAIs and become severely ill causing longer
stay in the hospital, thereby increasing the cost of stay and antibiotic treatment. Morbidity rate of
HAIs is very high with thousands died every year (Spruce 2013). The most frequently occurring
hospital acquired infection is urinary tract

Snow Flower And The Secret Fan Analysis
In the novel Snow Flower and the Secret Fan, by Lisa See, the role of women presented by the
author incorporates historical context of societal value and conventions, reveals the agonizing
subjugation necessary for life, and explores the subtleties of female power in a male centric
world. Through characterization, dialogue, and imagery, the meaning behind the story of two
friends reveals itself. Set in rural China in the early to mid 1800s, historical context plays a major
role in defining the value placed on women by their society. Seen from the beginning, a young girl
in a family acts only as a burden on them by being an extra mouth to feed and less valuable than a
son. Young women at the time were only given value based on who they married, whether they had
sons, and if they followed the conventions set before them. The main character, Lily states that her
mother looked at her as a temporary mouth to feed and a body to dress until I went to my
husband s home (See 12). By setting the stage of the time period, See defines the role of women as
child bearers first, and servants to her husband s family second. Despite protests to that idea in
contemporary times, women then understood their roles as being miserable so that their children
may one day succeed. Pain and convention controlled a womans everyday life, such as, When a girl,
obey your father; when a wife, obey your husband; when a widow, obey your son (See 24). Women
held the lowest status in the social

Why We Buy
Marketing 310
Why We Buy: The Science of Shopping
I chose the book Why We Buy: The Science of Shopping by Paco Underhill. This book really
opened my eyes to a lot of marketing issues. In all honesty, I chose this book because I ve always
found the idea behind shopping interesting and I ve always wondered why I walk out of the store
with an item I don t even need. After reading the book, I discovered that this book is actually not
about that at all. This book is actually far more interesting and tackles some serious problems in
marketing today. These days, very few stores open to serve new markets. The primary purpose of
a store in this day and age is to steal someone else s market share. The book outlines key elements
that are ... Show more content on Helpwriting.net ...
The main priority for retailers is to get customers to stay in the store longer, and this important KPI
needs to be measured as well. It s crucial that retailers work on staff and customer interaction. The
more employees interact with customers, the more money customers will spend in the store. It s
critical that retailers consider this fact before understaffing to reduce wage overheads. A common
mistake retailers make is cutting back on floor staff which decreases customer interaction and will
hurt customer sales. It s critical that retailers know who their target market shoppers are and how
to appeal to their needs and wants. The book details examples of how women feel when they
shop. Women don t like to be approached or touched in a store which is why several retail
outlets use wide aisles. The concept of marketing to women is significantly different than
marketing to men. This is one example of why knowing your target market is critical. The store
layout is also very important and should reflect the nature of the target market. The narrower an
aisle is, the less time a woman will spend in the aisle. The most noticeable part of the store is the
store entrance. People tend to flock to the store entrance the quickest and will not stop to read any
advertisements, signs, or displays in the windows. The best way to take advantage of customer
traffic at the store entrance is to have

Battle Of San Romeo Analysis
Towards the start of the 14th century, a renewed passion for the Greek and Roman classics
emerged, captivating the minds of people and bringing forth a significant intellectual movement
known as Humanism. Humanism drew people towards a more secular view of life, encouraging
them to become more interested in themselves, their own independence, and their own personal
expression, while renewing their admiration for worldly pleasures in the here and now.
Furthermore, Humanismhas been described as a mentality that was caught between medieval
theology and modern day criticism and science, with the Renaissanceman appearing to be caught
between faith and reason (Kreis). As such, many influential works of art evolved from this time
period, including Paolo... Show more content on Helpwriting.net ...
Foremost, the scenery in the painting is far from heavenly, as it is extensively adorned with natural
vegetation, a technique that was often used in Humanistic paintings. Likewise, the comprehension
of light and shadow is also displayed, along with individualized facial expressions that conveyed
emotion, allowing the figures to seem full of dimension and lively, rather than being flat and
unrealistic. Furthermore, no one figure is larger than another, a common element of art prior to
Humanism, which allows all figures to appear equal. Prior to the Renaissance, art was primarily
based on religious context, depicting man as flawless and all powerful (Michelangelo s Pieta).
However, in Michelangelo s sculpture, Pieta, though still a Christian influenced artwork, provides
viewers with contrasting characteristics. This sculpture exhibits humanism through the depiction of
real human emotion, suffering and acceptance, and the physical imperfections of the human

Pro Hunting Outfitters Essay
Maybe you are new to the old tradition of hunting. It would make perfect since to hunt with pro
hunting outfitters. But maybe you ve hunted and fished all your life, and you ve got some nice
trophies to prove it! So why should a seasoned hunter with plenty of knowledge and experience hire
professional huntingoutfitters? And exactly what kinds of services should be expected when you
hire pro hunting outfitters?
Let s look at the first question: Why should an experienced hunter hire pro hunting outfitters? There
are actually several very good reasons.
The first reason is Hunting Outfitters save you valuable time. If you work hard, like most of us,
you don t have time to scout properly and maintain hunting land. It takes a huge amount of time ...
Every part of the country operates a little differently. In many areas, private land hunting is
preferred because food plots and established game management insure a healthy herd of game
with a good buck/doe ratio, insuring the chances of a nice trophy buck. If you don t have access
to private hunting land that has been properly managed, you could gain access by hiring pro
hunting outfitters or paying to have access to the land for a do it yourself type of hunt or pay a
trespass fee to hunt on private ranches. In remote areas, especially out west and in Canada, hunts
are on national forests and public land. Good hunting outfitters will have intimate knowledge of the
local game and also have access to hunt in high demand or specific game units.
Hunting Outfitters have invested in all the necessary hunting equipment. Good hunting outfitters
will have expensive equipment including tree stands, shooting houses, safety equipment, ATVs,
snowmobiles, boats, walkie talkies and all the other things you probably don t care to purchase or
have room to store in your garage. And also, think about care and training of hunting dogs (if
needed). A lot of time, money and TLC goes into maintaining a professional hunting operation!
When you consider all that money invested, it makes the money spent with pro hunting outfitters
seem pretty

Poverty Assignment
Answering question number #3 and #4 in the assignment
#3 Below what income would her family be eligible to receive Medicaid, Child Health Plus
(SCHIP), Food Stamps, and subsidized child care? This can be summarized briefly.
Medicaid
For families of three, maximum net income to qualify for Medicaid is $1285
Alternatives:
Family Health Plus (a public health insurance program for adults who are aged 19 to 64 who have
income too high to qualify for Medicaid. Family Health Plus is available to single adults, couples
without children, and parents who are residents of New York State and are United States citizens or
fall under one of many immigration categories) Maximum Gross Annual Income Guide Effective
January 1, 2010| Family Size ... Show more content on Helpwriting.net ...
(http://www.govbenefits.gov/govbenefits_en.portal?_nfpb=true
amp;locateFederalFlow_1_actionOverride=%2FLocateFederalFlow%2Freport
amp;_windowLabel=locateFederalFlow_1 amp;locateFederalFlow_1bid=939
amp;locateFederalFlow_1_code=67 amp;_pageLabel=gbcc_page_locate_federal)
Special Supplemental Nutrition Program for Women, Infants, and Children (WIC)
National School Lunch Program
#4 If she experiences food, housing, or medical emergencies, what are some other resources
available to her family in the local community? This can also be summarized briefly.
About FD Food Disaster Assistance
Ensuring that people have access to food is perhaps one of the most immediate concerns following
a disaster, such as a storm, earthquake, civil disturbance, or a flood. The Federal Emergency
Management Agency (FEMA) is responsible for effectively managing the federal response and
recovery efforts following any national incident, coordinating relief efforts, and making assistance
available to States, communities, businesses and individuals.
Through its Food and Nutrition Service, USDA assists in three ways: * Provides commodity foods
for shelters and other mass feeding sites. * Distributes commodity food packages directly to
households in need. * Issues emergency SNAP benefits.

Justice And Justice In Hamlet
The definition of justice can mean many distinctive things. However it can make people forgive,
or get revenge. I think it just depends on the situation. In my Final Essay, I m going to answer this
question for you, Can justice and forgiveness go hand in hand? There are numerous amounts of
examples I will show you, and one of them even includes a film called Simon Birch. Justiceis what
you fight and earn properly. Revenge is naГЇve, and can be hurtful, if somebody hurts you, handle it
maturely and respectfully.
The well known play by Shakespeare, Hamlet; is one example of justice and forgiveness. Hamlets
uncle, Claudius kills his own brother, Hamlet Sr. He puts poison in his ear while he was dozing.
Hamlet finds out and doesn t tell anyone, everyone think he has gone mad, even his own mother,
Gertrude. Claudius marries Gertrude and becomes king. Hamlet continues to make a play about
how Claudius killed Hamlet Sr. and Claudius feels uncomfortable and leaves. During the whole
play, Hamlet tries to get revenge on Claudius in whatever possible way he can. However, Claudius
convinces everybody that Hamlet is lying about what he has been saying about him. At the end of
the play, Hamlet and Claudius duel to the death. Claudius gets wounded and Hamlet feels like he
has won and that he finally got revenge and justice for his father. So, in that story justice and
forgiveness can go hand in hand, it s all about how you handle the situation.
My second example is from a movie called

Roy Medvedev Analysis
With the destruction of the Tsarist regime, Russia stood at a crossroads no state had ever been at.
For the first time ever, a Socialist nation advocating Communism had managed to create a
functioning state. The works of Marx and Engels, pushed forth as the cure for the oppression of
the proletariat, had fallen successfully on the ears of Vladimir Ilyich Lenin, who, with his theory of
the Vanguard party, pushed the Russian Empire into the Soviet era. Leninism became the central
tenant of the Soviet system, being advocated and admired by every successive Soviet leader, and
by many in modern Russiato this day. The modernity of the issue leads many in modern Russia to
justify certain actions, harkening back to Lenin himself, still displayed in... Show more content on
Helpwriting.net ...
The virtues of one are inherently found in the other, the downfalls of one, inherently found in the
other as well. Lenin s own realization of this near the end of his life, his insistence on trying to
prevent any one man from taking power in the USSR, proves that while attempting to prevent
Stalinism, Lenin s own foundational government set the path for it. Leninism was naturally led to
Stalinism, and that must be addressed lest it be used to justify, misleadingly, the same once

Describe The Importance Of Active Listening Skills
Most of my experience in trying to quickly establish a helping relationship of mutual trust and
respect is with people in the middle of a traumatic event. I always remain calm and keep a level
voice, I want them to feel like they are being treated in a warm and friendly manner. I normally
use active listening skills in order to convey respect for the individual and make them feel like
their problem is important and a priority. Especially when helping someone in a panic state, using
repetitive persistence has been very beneficial. In that, I will repeat as many times as needed, I
need you to tell me what you need so we can help you (or a family/friend that may be in distress),
to get the person to focus on the situation and let them know

The Development History Of Gis
The Development History of GIS Geographical Information System (GIS) is a computerised
management based system that is used to collect, store and analyse spatial data. It allows users to
interpret data to follow trends, patterns and understand relationships analysis. The early beginnings
of GIS started when French geographer Charles Picquet noted in 1832, the deaths by cholera in
Paris using halftone colour gradient (De ChГўteauneuf, L. F. B, 1834, pg.1). John Snow is
considered one of the founders of modern epidemiology. In 1854, London suffered a series of
cholera outbreaks and noted their deaths by using points on a map. After plotting and studying
the distribution of the information, he noticed that the majority of the deaths were near 13 water
pumps that were close to his home and there was more of a concentration around one particular
pump. He had the handle removed and the outbreak of cholera soon diminished. He used
Thiessen polygons to back up his theory and found the majority of the deaths fell within the
polygon nearest to the offending pump. (Mapping the 1854 London cholera outbreak, n.d., p.1).
From about 1881, another development took place called Photozincography and this allowed the
maps to be divided into layers. A photo negative was taken and was place onto a glass plate and
then a carbon copy was taken from the negative. This was then placed on treated paper, then
floated in water and then laid down in a zinc plate covered with lithographic ink. To

How Is Love Presented In Plato s Symposium
The view of love presented in Plato s Symposium is not a very positive one to a modern reader;
although some of its eulogies can appeal to various emotions or make sense logically, they fail to
present love in a way that is both humane and sends a positive message. While Aristophanes eulogy
depicts humans as inherently flawed and lacking independence, Socrateslogic based definition takes
away the emotion and humanity from love and leaves readers with an unappealing image of love
that leaves little to no room for mystery, curiosity, and pure emotion. One of the most famous
eulogies delivered in the Symposiumis delivered by Aristophanes in the form of a myth; he states
that long ago, people lived in conjoined pairs with two faces, four arms,... Show more content on
Helpwriting.net ...
While it may be logical for Socrates to reject Alcibiades advances on grounds of exchanging
bronze for gold (219A), it is very unappealing and inhumane to see a potential relationship
forsaken simply because it is not a fair transaction . Alcibiades appears to be showing a real
emotional connection to Socrates, but he is simply not given a chance due to Socrates view on
what love should be. This is especially unappealing because oftentimes, we do not even try to
comprehend the logic or reasoning as to why we love someone or something; we simply
acknowledge that there is an emotional connection that sometimes cannot be fully explained
based on transactional value. Socrates definition also completely eliminates any mystery or
curiosity about love in the eyes of the reader; such a logical and transactional analysis presents
love as a formula that can be easily determined and explained. However, that is simply not the
reality. Love has always been an incredibly tantalizing subject for one reason it is mysterious.
People can seem to fall in love with each other in the blink of an eye, or a loving relationship
could take years of friendship to finally develop. Essentially, it is extremely difficult to pinpoint
exactly why we love someone or something,

The Impact Of Employee Motivation On Organizational...
Employee Motivation Motivation of employees plays a crucial factor in determining their
performance with regard to productivity and engagement in their respective duties. Actually,
employees who are adequately motivated tend to enhance their performance, be more productive,
feel more satisfied, and be more engaged in their work. Managers should take responsibility to
enhance their employees in order to enhance their contributions to the organization or company
resulting in increased productivity. The significance of employee motivationto organizational
productivity is linked to the widely accepted belief that motivation is the basic driver of human
behavior. The significance of motivation in driving human behavior has contributed to the
development of various theories of motivation, which are mostly applied in real life organizations
or businesses. The application of these theories has considerable effects on organizational
productivity, employee turnover, and employee satisfaction.
The Concept of Employee Motivation Motivation can be described as a psychological process
that influences individuals choices about work related behaviors. While managers tend to consider
employee motivation as the desire to work, this concept refers to a general procedure that has
considerable effects on nearly all behaviors. This is primarily because the concept of employee
motivation is based on the principle that the resultant behavior is carried out in order to generate
desired

Why Are School Uniforms Or Bust
School Uniforms or Bust!
How would it feel to be made fun of every day at school just because of what you wear? Is that
fair to the person being made fun of when they have no control over the matter? I think not. If
schools required their students to wear uniforms, It would make student feel more equal, there
wouldn t be discrimination just because of what a person is wearing: everyone would be wearing
the same thing. Schools should require uniforms for the following reasons: an increase in test
scores, a decrease in school violence, and it will also help relieve the financial issues of buying
school clothes. I certainly think it will help. Having uniforms will reduce the financial burden on
parents, it will eliminate dress competition and it will reduce the number of instances of stealing or
having clothing stolen, said Lawson ( Will ).
People who support school uniforms argue that they will prevent students whose families can t
afford a lot of clothes from being bullied. There is some ... Show more content on Helpwriting.net ...
People that oppose school uniforms say that they are a financial burden for poor families
(Wilde). On average, American parents spend around $130 on clothes for their kids each school
year. While the average annual cost of school uniforms are $249 (see figure 2). I know that
based on this information it would seem that buying regular school clothes would be a cheaper
option than school uniforms, and on paper it is. But, trending clothes have a huge impact on the
cost of regular school clothes, explained by the following excerpt of an article titled Pros and
Cons of School Uniforms. In some cases, the use of school uniforms is more affordable to families
because there is not as much pressure to buy expensive, trendy clothing. Uniforms are made to last,
and can be washed easily, and frequently. After the initial cost of buying uniforms, there is no need
to spend as much money on clothing

Art In The 1920s Essay
The 1920s were a time of great prosperity and revitalization. This decade gave way to many great
social milestones for every class of people. From the limits for immigration to the boom of the auto
industry American society was drastically altered. Issues such as foreign immigration,prohibition,
the Ku Klux Klan,evolution, women s roles, and race were the focus of the populus and drove
politics within the nation. Art played a major role in how the black community expressed their new
found sense of culture. Painting has always been a way for someone to portrait their ideas. The
African American community had major breakthroughs in the 1920s. One of these breakthroughs
was the pursuit of the fine arts. The arts of poetry,sculpting,writing... Show more content on
Helpwriting.net ...
As a whole the Harlem Renaissance ended slowly from the early 30s to the early 40s. This was
due to the Great Depression and the world s attention shifting towards the war in Europe. The
Harlem Renaissance was very important because it was a time in American history where black
people openly expressed their culture and their pride for being black. The effect that the Harlem
Renaissance had was unique to the 1920s because of the proximity to WWI. After the war the
black community wanted recognition for their bravery and valor overseas and at home. Another
factor that helped with the Harlem renaissance was Prohibition. Prohibition had helped because
people needed entertainment when they drank illegally. Also people were tired of the old was
which was also seen in the new found power that women had grasped in society. Recently before
this there was Red Summer where lots of people had died during the race riots that broke out all
across the country. In American history the Harlem Renaissence gave black culture and influence a
major kickstart which still shows its influence today. Many black artists of all varieties go back to
the style of the 1920s to get back in touch which their roots. The Harlem Renaissance has had an
everlasting effect on the black community in

Compare And Contrast Africa And American Civilizations
The civilizations of America, Africa, and Europe each had their own political, economic, and
religious systems that changed drastically when people from each continent encountered one
another. In the Americas, the Native Americans had developed large and massive empires that
would come to marvel the world. In Africa, there were are also large empires, home to millions of
people. Western Europeon the other hand did not have any large empires or well organized
societies. However, this would all change when the Europeans came in contact with the people
in the Americas and Africa. It would be the Europeans that rose up while the other races fell.
Before the Europeans arrived in the New World, it was filled with wealth and resources. When
the Spanish first explored the New World they returned to Spain with strings of pearls and gold.
The land was also full of Native Americans. The native people in the Americas had created some
of the greatest empires in the world. These empires spread all across the New World especially
in Mexico and Guatemala. These empires were home to over 60 million people. Most of these
people lived in the great empires of the Aztecs and Incas, the two largest empires at the time. Both
of these empires housed more people than most European cities at the time. The Aztecs had a
diverse trade system that included tributes from the people to the leaders of the empire. They
required tribute to be payed to them, typically consisting of gold, textiles, and cacao.

The Weimar Republic
Tobin Mayhew Saer
Nazi Germany
Essay #1
February 23, 2016
In 1919 the German people attempted to create a parliamentary democracy with the Weimar
Republic. Born in the ashes of defeat, the Weimar Republic was heavily burdened with failures of
the past. For decades historians have sought to understand why the Weimar Republic failed and if it
was doomed to do so from the start. The answer to this question is very complex as many
different factors were involved. The fait of Weimar Germany was in the hands of many different
ideas and forces that caused its failure which make it very difficult to isolate one or two for being
solely responsible for its demise. Many take one look at Adolf Hitler s Nazi regime and place
immediate blame on it ... Show more content on Helpwriting.net ...
A very substantial reason for the failure of the Weimar Republic was the impact of the Great
Depression and the massive inflation that resulted because of it. Finally, with Germany on its
knees begging for a sense of unity and hope, Adolf Hitler and the Nazi regime came to power
officially ending the short lived Weimar Republic. After World War I
, Germany signed the peace
settlement at Versailles, France in June of 1919. The severity of the terms caused intense political
debates and division in Germany. A majority of Germans strongly opposed signing the treaty and
the left and right wings had different ideas about how to respond to it. Right wing nationalists like
the NSDAP demanded the government completely renounce the treaty and not comply with its
harsh terms. Those who were more moderate such as the supporters of the Weimar republic
scorned this approach, as they believed it would cause retaliation, economic issues or even war.
When the treaty was signed, the German people felt that they were treated unfairly and a
consensus that the Weimar Republic was soft footed arose. This was the first of many more issues
to come. It has been argued that the financial reparation fees imposed on Germany were too
excessive. This burden on the post war economic situation caused German recovery to be next to
impossible. Within three years of the signing of

Love and Lust in the Lyrics (Shakespeare s Sonnets)
A sonnet is a poem of fourteen lines that rhyme in a particular pattern. William Shakespeare s
sonnets were the only non dramatic poetry that he wrote. Shakespeare used sonnets within some
of his plays, but his sonnets are best known as a series of one hundred and fifty four poems. The
series of one hundred and fifty four poems tell a story about a young aristocrat and a mysterious
mistress. Many people have analyzed and contemplated about the significance of these lovers .
After analysis of the content of both the young man sonnets and the dark lady sonnets , it is clear
that the poet, Shakespeare, has a great lovefor the young man and only lusts after his mistress.
In order to fully understand the depth of emotion that ... Show more content on Helpwriting.net ...
So the lover, the poet, treats the loved object, the young man, as he would himself. The loved
object serves as a substitute for some unattained ideal. In the case of the sonnets, the ideal is love.
Being in love allows the poet to have what he wants but could not acquire before and serves as a
means of satisfying his self love.
Joseph Pequigney, author of Such is My Love: A Study of Shakespeare s Sonnets, agrees with
and elaborates on Freud. He writes, All of these characteristics belong to the poet s love for the
friend. It is a love that pays handsome narcissistic dividends; it is advantageous also for the
friend, who is praised for personal qualities that would likely pass unnoticed were the poet not
under the spell of his beauty. Pequigney goes on to touch on the antithesis of the poet s love for
the young man, his lust for his mistress the dark lady . Because the mistress offers no self seeking
advantages, she is disesteemed with vice but never virtue ascribed to her (Pequigney 157). The
poet attacks and questions her physical attractiveness as the affair goes on and she arouses lust that
comes and goes.
Sonnets 127 154 are addressed to the dark lady (hereafter the mistress). Shakespeare s relations to
his mistress vacillate; sometimes sanguine, tender, teasing, or bitterly anger; yet it is a simpler
relation than that

Judith Butler The Values Of Efficiency Summary
In Judith Butler s article The Values of Difficulty , in which she wrote in response to Denis
Dutton s article Language Crimes: A Lesson in How Not to Write, Courtesy of the Professoriate ,
she argues that complex ideas require complex language to develop societal change and challenge
common sense. Butler shows how difficult language us useful, but I disagree with her overall
claim. I do not think that intricate wording is needed for a logical point to be made. Judith Butler
wrote this article to argue against the beliefthat scholarly writing is overcomplicated just to boast
intelligence. Butler begins by explaining how scholars, whose work topics focus on he
humanities, are accused of bad writing by the journal Philosophy and Literature. She believes
that intellectuals in such fields should explain how their work interplays in everyday life, but
that these intellectuals should also create new ways of looking at the world. A more socially just
world would be possible if common sense were to be challenged. Butler s definition of common
sense is different than traditionally thought of. While common sense may be defined as having
good judgment in practical matters to most, she seems to define it as an old way of thinking,
stating that, Many quite nefarious ideologies pass for common sense. For decades of American
history, it was common sense in some quarters for white people to own slaves and for women not
to vote. (p.147) She thinks that for society to improve,

William Carey Rhetorical Analysis
Gary,
I thoroughly enjoyed reading your informative discussion post this week. Regarding the mission
of William Carey, you wrote, Although he was known as a Christian scholar, his compassion for
humanity turned him into a proponent of social reform. Having a love for those for whom he
was called, he took on the attitude of Christ. As Christian leaders, I hope and pray that all of our
missions are direct and profound such as Dr. Carey. He was called upon by Godas so many of is,
however we do not take the time out to become a living vessel for God, the Almighty. Through
Christ and my gathering strength from the Holy Spirit, I shall continue to live for a better
tomorrow, thus all of God s people no matter their religion, tradition, creed,

Iran And The P5 + 1
Negotiations between Iran and the P5+1 began in 2006, to assure that P5+1 world powers that Iran
would not develop nuclear weapons and to guarantee that Iran that its rights to enrich nuclear fuel
for civilian purposes under the third pillar of the Treaty on the Non Proliferation of Nuclear
Weapons, to which it is a party, was esteemed. During the time of the negotiation, the United States,
the European Union and others enforced some agreements on Iran, which have been referred to by
President Rouhani as a crime against humanity. Fast forward to 2015 and now Iran and six world
powers are trying to reach a preliminary agreement on their goals to limit Tehran s nuclear program
in exchange for lifting economic agreements. However Iran will only sign the agreement if
economic sanctions are removed the first day of the deal s implementation.
The Iran Nuclear deal started when talks led to a breakthrough interim agreement agreed in
November of 2013 that was known for being called the Geneva Accord and the Joint Plan of
Action that also began in February 2013. Prior to that there were numerous unsuccessful attempts in
trying to negotiate a deal with Iran since way back in 2002 when Iranian nonconformist groups
raised an alarm over the country s nuclear programed by revealing the existence of two facilities
that were not declared to the IAEA which stands for International Atomic Energy Agency that s
considered as the United Nations nuclear watchdog. There are two reasons that

Similarities Between Rasputin And Julius Caesar
Connecting the Murders No one in the political realm is ever killed without reason. Furthermore,
With those reasons are often related by both the ideals of the killers and the beliefs of the victim.
Nonetheless, how can two people, centuries apart, Grigori Rasputin and Julius Caesar, possibly be
related? History repeats itself more than once in a lifetime, and a closer look can reveal its secrets.
Both men betrayed by their closest friends and advisors, their murders would leave their stain in
history. However each stain would leave its own unique pattern, and while similar to a point, they
each contain their own unique story and circumstances.
The night of December 17th, 1916 would shake the russian monarchy, whether for good or for
worse ( The Death of Grigory Rasputin. ). Grigori Rasputin had become to close the the Russian
Noble family. He became the trusted ... Show more content on Helpwriting.net ...
Men fear losing their power, and will go at great lengths to protect their power. In the case Julius
Caesar, they feared losing their positions as senators. The Russian nobles feared that Rasputin
would manipulate the monarchy to do his bidding. I do believe that Rasputin s death was
justified, as the man had become so unstable and scandalous he was losing control. However in
the case of Julius Caesar, I do not believe that the killing was justified. Caesar had led Rome to
the brink of a golden age and the conspirators had sent Rome spiraling back into an age of civil
war. In general it is his qualities as an honest leader and individual that lead me to believe Caesar s
killing was unjustified. Another trait I noticed about political assassinations is that it typically
happens with groups of similarly minded people. People who fear the idea of change. Therefore
the type of men and women who usually would not find themselves together can be united to do
something they believe is right or

Paganism Research Paper
When I was young, I always knew magick exists in our world. I dabble with a spell that will help
me stop bleeding, which comes in handy when hiding a scar from my parents or prevent blood
loss. However, as I gotten older weird phenomenon would happen. Such as, seeing events before
it happens, being able to drain someone s car batteries while I m in the car, and of course
obtaining luck while having a silver dollar coin in my possession. Although, some religious people
may argue that Pagans are devil worshipers in considering what they believed they are provoking
evil demons. Which in, Paganism is in fact an Earth Centered religionthat believes in all religion,
and magick.
According to River Higginbotham, Paganism, also called neo Paganism ... Show more content on
Helpwriting.net ...
River Higginbotham, stated that magick is the actions of many consciousnesses voluntarily
working together within an aware and interconnected universe to bring about one or more
desired results . Magic is nature; the caster of spells has to believe in themselves and knowing it
is possible to have the god like powers. Magic users, call or summon a spirit or an energy force
and bend it to their will. Such as, people call forth Jesus to give them strength. For me, I used my
own chi to help me cast spells and heal. However, by casting a stop raining spell and using my chi
sometime it s so tremendous that I could stop the rain, but made me so tired that it takes me four
hours of sleep to regain my

Jumonville Massacre
Pennsylvania. Washington s men murdered the gathering in what came to be recognized as The
Battle of Jumonville Glen. France and England initially pursued the French and Indian War mainly
for power of the area known as the Ohio River Valley. The Ohio River Valley was a property filled
with fur bearing animals and profuse resources. Both English and French colonists wanted to settle
it to make fortunes in the fur trade. The Ohio River formed by the union of the Allegheny and
Monongahela Rivers at the time Pittsburgh, Pennsylvania ran through the valley. As French settlers
arrived upon the area from Canada, and English settlers came from Virginia, territory clashes were
unavoidable. Neither side was willing to negotiation, as each assumed they... Show more content on
Helpwriting.net ...
This regulation caused stresses between colonists and imperial representatives, who made it clear
that the British Parliament would not discourse American protests that the new laws were
onerous. British refusal to act to American requests for adjustment endorsed colonists to debate
that they were part of a progressively dishonest and overbearing empire in which their traditional
rights were endangered. This situation ultimately acted as the base for the colonial Declaration of
Independence. Boston Tea Party in 1763, the British government developed from the Seven Years
War loaded by heavy debts. This led British Prime Minister George Grenville to cut duties on
sugar and molasses but also to urge the law more firmly. Since enforcement of these duties had
formerly been negligent, this eventually increased income for the British Government and assisted
to raise the taxes funded by the colonists. The colonial governments of New York and
Massachusetts sent strict letters of dissent to Parliament. The end of the war had additionally
carried about a postwar recession, and British traders began to appeal expense for debts that
colonists had gained buying

Aladdin And The Wonderful Lamp Analysis
In Aladdin and the Wonderful Lamp by Andrew Lang and The Little Mermaid by Hans Christian
Anderson, both protagonist s pursue the object of their desire. In Aladdin and the Wonderful Lamp,
there s a protagonist named Aladdin, who is the son of a poor tailor. One day a magicianapproaches
Aladdinby disguising himself as his uncle. The magician ends up taking advantage of Aladdin
by using him to get a wonderful lamp. Aladdin without not knowing anything about the
wonderful lamp goes with the magician to get it. Aladdin manages to get the wonderful lamp,
but refuses to give it to the magician until he gets out of the cave. The magician traps him.
Aladdin remains in the cave for two days. He sees the ring the magician gave him and rubs it. In
front of him a genies appears, which changes his life forever. One day Aladdin hears the sultan s
order about his daughter, the princess going for bath. This makes Aladdin very eager to see the
princess. Despite of knowing that the princess always wears a veil, Aladdin sneaks and sees the
princess without her veil. However in The Little Mermaid, there s a protagonist named Ariel. Ariel
is a mermaid, who lives under the sea in her father s kingdom with her father, five sisters, and
grandmother. Ariel spent her time hearing stories from her sister about the surface of the ocean.
She questioned her grandmother and always wondered about it. Ariel wasn t allowed to go up to
the surface of the ocean until she reached fifteen. When Ariel

An Essay About A Mate
Mate. My mother used to tell me the definition of mate was your destined love true love to say
the least. A person that will stick with you through the thick and thin, no matter the destination.
A mate is supposed to protect you from the harmful ways of the world. A mate was supposed to
fight with you side by side. A mate is supposed to love you no matter the cost. I never really
thought about mates or well superficially my mate. I thought I was always going to be alone,
fighting my own battles and defeating my own wars with no else s help but only my own. But I
guess life has its mysterious ways of confusing the living life out of me and possibly my mate to.
The hand on my shoulder sent bolts of electricity to run out through my body starting from the
tip of my toes to all the way to the tip of my fingers. My body fell on infinite bliss. Even though
this touch erupted fireworks in my stomach this touch also calmed me, comforted me in many
ways than one Physically, Mentally and Emotionally. I felt safe and free but that didn t last long.
The hand on my shoulder slipped off slowly and gently but that action only ripped away all the
bliss and comfort from it, bringing back the cold to my body. I turned around slowly facing the
owner of the hand that was touching me only moments go but it felt like his last touch was months
ago, what was this person touch doing to me? The owner of the hand had its mouth slightly open
from shock, his eyes were flooded with emotion, confusion

Impacts of Service-Learning on College Students Essay
The functional area of service learning is currently emerging as an acknowledged department at an
institution of higher education. The theoretical roots of service learning go back to John Dewey,
and the early twentieth century. However, current research on service learning pedagogy dates
back only to the early 1990 s. Best practices for the field are still being created as more and more
new offices are springing up on campuses throughout the United States and institutions
internationally. The reason this functional area is becoming ever popular is due to the positive
impact it has on students and most all educational outcomes.
Service learning is considered both academic and co curricular. Academic service learning is credit
bearing ... Show more content on Helpwriting.net ...
The biggest impact is with the students civic engagement. However, outcomes of service learning
do not end there. Outcomes of service learning range from academic to moral to life skills and all
outcomes that fall within (Eyler Giles, 1999).
Academic Outcomes
Some of the academic based outcomes of college that are impacted by service learning include
knowledge application, content understanding, critical thinking, and even grade point average.
Astin and Sax (1998) identified ten academic outcomes affected by service participation, and all
ten were positively affected by service. In their study, grade point average, retention, aspirations for
educational degrees, graduate school prep, general knowledge, discipline knowledge, time devoted
to studying, extra credit, and faculty contact all showed varying increases due to service
participation.
Eyler and Giles (1999) discuss how students in their study perceived themselves to identify social
issues easier due to service learning participation, which is the first step in critical thinking ability.
Students were also more likely to think critically about these social issues when their service was
linked to a particular social problem. There is little research connected to critical thinking and
service learning, but the small amount that there is indicates some increases in critical thinking
ability.
Students who participated in

Alcohol and Drugs are Passed from Parents to Children
Children are introduced to drugs and alcohol at a very young age. Many of them see alcohol and
drugs in their homes, used by their parents on daily bases. Some of these children don t even
realize that it is wrong, not normal , and not accepted in other homes until they are old enough to
understand that situation in their home is a problem and that it is wrong. Minors usually begin
using alcoholat around age 13. Statistics show that by the time they are high school sinners, 81
percent of teens have used alcohol. Alcohol consumption and alcohol abuse are more widespread
among young people than many adults realize.
According to Webster s New World Medical Dictionary, 3rd Edition, Addictionis a chronic
relapsing condition characterized by compulsive drug seeking and abuse and by long lasting
chemical changes in the brain. Addiction is the same irrespective of whether the drug is alcohol,
amphetamines, cocaine, heroin, marijuana, or nicotine. Every addictive substance induces pleasant
states or relieves distress. Continue use of addictive substances induces adaptive changes in the
brain that lead to tolerance, physical dependence, uncontrollable craving and, all too often, relapse.
Dependence is at such a point that stopping is very difficult and causes severe physical and mental
damage from withdrawal (WILLIAM C. SHIEL JR., 2008).
Over the past two decades, many researchers have identified subgroups of alcohol and drug user
based in similarities like drinking style

Star Jones Research Paper
Star Jones Ex husband Al Reynolds Wiki, Affair, Gay/Bisexual, Net Worth
Bio
Born in June 1968, Al Reynolds is currently running in age 49 years. He was born in Virginia. He
holds American nationality. He was born in the Southern Baptist family as the youngest among the
six children. Being born in deeply religious family, he often visited church regularly along with
family members.
Career and net worth
Reynolds has been able to manage information far from the eye of public. Despite of continuous
introspection about how he started working or his job career but nothing can be disclosed. As
per the sources, it is found that once in his life career he used to work as an investment banker.
has branded himself as an expert in finance. Though precisely not known why he changed his
profession but lately he is said to be working as professor at Florida Memorial University in
Miami. Working since a very long in this sector, he has accumulated net worth of $5.0 million. The
net worth seems to be incrementing in the days to come.
Personal Life
Being a public figure it is very difficult to remain under the radar. Little information regarding his
personal life can be found easily. Reynolds has been married once. He was married to popular
figure, Star Jones. After few months of dating, he proposed Jones. ... Show more content on
Helpwriting.net ...
The news surfaced all over the internet when he came out as gay/bisexual. The issues of gay
/bisexual have created tensions amid many people. That s why he decided to open about his
sexuality through the national media. He wanted to be the encouragement and hope for other
people who are going through such hardships. He mentioned that he have been sincere in every
relationship he has been through. Information regarding his past affairs can not be found anywhere.
As of now he is single and is happy with status he has now. Overtime he became more tougher and
empathetic, and became the strong person as he is

Organizational Structure Of The Business Organization
In connection to the above, it is very important to highlight that in his restaurant, Jack has at least
twenty employees whom he has been working together with. These employees play different roles
in the restaurant as defined by the management of the restaurant headed by Jack. Some of the
employees are engaged in cleaning services, others are also engaged in welcoming the customers,
and others are engaged in serving the customers among others. According to Jack, the employees
engaged in cooking the different delicacies are the ones that perform the most challenging roles in
the restaurant. This is because they have just to be the best, offering the best skills in order to
ensure that the qualities of the foods are not compromised at all... Show more content on
Helpwriting.net ...
In depth Understanding of Motivation
Motivation can be described as the level of influence that the employees or workers bring to the
businesses relevant to their specific jobs. In connection to the above it is of crucial significance
to note that employee motivation is majorly influenced by three main factors. The factors
comprise of the energy, creativity as well as commitment that such employees or workers bring to
the jobs. These factors contribute greatly towards the realization of success in the business.
Therefore, it is important to note that in order to realize success, it is very important to ensure
that such factors are greatly observed. Professionalism should always be employed in ensuring
that the issue of employee motivation is not compromised in any other way. This is because
compromising employees in any way may occasion revolts, withdrawal as well as laxity in their
practices. This may precipitate such issues involving poor employee performance, thereby leading
to failure of such businesses.
As such, it is of crucial significance to note that employee motivation always plays a significant role
in upholding the behaviors of employees thereby positively influencing their performances. This
leads to achievement of the organizational goals,

Israel s Impact On The West Bank
Israel has made travel between major Palestinian population centers (Jenin, Nablus, Ramallah,
Bethlehem, and Hebron) in the West Bank easier over the last several years. Several major
checkpoints in the West Bank that restricted direct movement between and into these cities have
been removed or modified. However, in general this opening is less the result of an overall easing in
movement restrictions than the result of the institutionalization of movement controls into a formal
and permanent regime of restrictions that has replaced roadblocks with gates that can be opened
and closed at the whim of the military and that has reconfiguring how Palestinians travel.
According to the United Nations Office for the Coordination of Humanitarian ... Show more content
on Helpwriting.net ...
While Palestinian movement is severely restricted, a separate system of roads that are closed to
Palestinians or that bypass Palestinian communities has been set up for Settlers to ensure their
unrestricted movement in the West Bank and between the West Bank and Israel.[iii] According to
the Israeli human rights organization B Tselem,
there were 67 kilometers of roads in the West Bank that Israel classified for the sole, or
practically sole, use of Israelis, first and foremost of settlers. Israel also prohibits Palestinians from
even crossing some of these roads with vehicles, thereby restricting their access to nearby roads
that they are ostensibly not prohibited from using. In these cases, Palestinians travelers have to get
out of their vehicle, cross the road on foot, and find an alternative mode of transportation on the
other side. [iv]
OCHA has also reported that in 2013 at least 55 West Bank communities which are home to more
than 180,000 people remain completely isolated as a result of roadblocks, barriers, checkpoints and
other movement restrictions. All of the main roads into and out of these communities remain
blocked and residents wishing to leave these communities must use alternative routes that are two to
five times longer than the blocked direct routes. Many

Welch Mission Statement
Critical Analysis:
In order for corporations to be categorized winning corporations, there must be a set foundation
that allows the corporation and the agents inside it, to move as a cohesive unit towards one
mission. A clear mission is important because it is the base of the creation of a strategic plan in
obtaining the results desired by the corporation. It is much easier to map out the plan towards a
clear, concrete, and descriptive mission statement than one that can be misinterpreted by the
employees making the calls within the corporation. But for a company s mission and values to
truly work together as a winning proposition, they have to be mutually reinforcing (Welch 21).
When the goal is not clear, it is hard to set the valuesвЂ•how ... Show more content on
Helpwriting.net ...
Welch claims that anyone brought into the corporation should have the first two E s, the ones
which are characteristics of a candidate s personality, energy and energize. When energy is talked
about, it is the inner power of someone looking to do greater things, they are motivated and ready
to work, while energize is the capability to make people feel pumped up and ready to tackle a task
and stay on routine. These two qualities everyone in the corporation should have as well as
intelligence (different than education), maturity, and integrity. Choosing a manager can be tricky
but there are more traits that are needed in order to be a winning manager; the ability to foresight,
authenticity, seeking the smartest people to associate around, and resilience. An effective manager
is extremely important because they are the people who emphasize on the mission and make the
goals a reality through their management of

Tommy John Surgery
Baseball players and fans call it Tommy John surgery, after the pitcher who was the first to have
the surgery 29 years ago. By any designation, it is one of the major advancements in sports
medicine in the last quarter century. Technically it is a ulnar collateral ligament replacements
procedure. Pitching overhand is a particularly stressful motion; the strain it puts on a player s
joint is commonly injurious. Pitchers such as Kerry Wood, Matt Morris, John Smoltz, Mariano
Rivera, Tom Gordon, and Eric Gagne all have a four inch scar on their pitching arms as evidence
of this career saving surgery. These players typically perform as well, if not better, after the
operation and have stronger arms, with radar gun readings to match.... Show more content on
Helpwriting.net ...
Usually this tendon will be harvested from the leg that is not used as the plant foot in the pitcher
s delivery. The removal of either of these tendons has a negligible effect on function. Then, the
surgeon opens up the elbow. In the original procedure, Frank Jobe used a large incision to get
exposure to the joint. For an idea of the size of this incision, hold your right arm out from your
body with your palm pointed upwards. With your other hand, feel along the inside of the elbow
until you can find what feels like a hard round nub. That s the proximal end of your ulna bone.
The incision would have taken place along the inside of the arm, beginning several inches above
the elbow and ending several inches below. As Dr. Akizuki explains, In order to get exposure to
the joint you used to have to detach the entire flexor attachment [the muscles that flex the elbow
you can feel those muscles by feeling along the incision site]. You used to just fillet that open. Once
inside the elbow the unlar nerveis recognized, lifted out, and moved to provide greater access to the
joint. This is the funny bone nerve and it runs inside the ulnar groove. With the muscle separated
and the ulnar nerve safely out of the way, the surgeon would then locate the damaged ligament.
First scraping out the damaged tissue, then the next step is to drill tunnels in the

Theme Of The Wind In The Willow
Pastoral Themes in the Wind the Willows
Pastoral works refer to a genre of literature that focuses on the bucolic aspects of nature and the
countryside. The English countryside represents the ideal location for a pastoral work. One such
work is the Edwardian children s story, The Wind in the Willows by Kenneth Grahame. Since its
publication in 1908, the story has become a beloved children s classic. However, the story
represents Edwardian society in England, and uses anthropomorphized animals to represent
Edwardian men. As a pastoral work, the events of the story occur in the English countryside, where
the animals work together to care for the wild one in their group, Mr. Toad. Mr. Toad s Wild Ride
through he English countryside ... Show more content on Helpwriting.net ...
The author used the background of a pastoral vision to help elucidate the characteristics of
Edwardian society. Mr. Toad is one of the most known characters from the work. He is extremely
wealthy and essentially bored with his life. His English country life does not offer him
fulfillment. As such, he jumps from interest to interest, quickly grabbing at new hobbies. As a
wealthy landed scion, he has the luxury of this lifestyle. From the earliest mentions of his home,
Toad Hall, it becomes apparent that he represents the landed gentry. Rat points out his home
from the river. The stables are over there to the right. That s the banqueting hall you re looking at
now very old, that is. Toad is rather rich, you know (Grahame 19). Toad quickly changes his
interests, spending the money his father left him. Rat describes this character flaw of Toad:
Boating is out. He s tired of it, and done with it. I wonder what new fad he has taken up now?
(Grahame 21). Toad quickly takes up motoring as his new hobby. Motoring referred to the hobby
of driving and racing cars, something only the wealthy could afford at this time. All of this is
discussed as the characters take a slow ride down the river and then sit quietly in the countryside.
An outdoor luncheon helps to create the image of the setting. The English countryside represents
the perfect pastoral setting, and the characters all seem to enjoy

Hypatia Of Alexandria
The First Female Mathematician Mathematics has always been described as the purest science and
considered as one of the most important aspects in many countries around the world, especially
developed countries. Theoretically, the most significant requirements for a life of a mathematician
is the mathematical ability. Nevertheless, very few women get involve in this field, which creates
a myth, and slowly develops into a stereotype in society, that women are naturally not good at
math. However, many people would be surprised, that the world s greatest living mathematician for
a time was a women (Deakin 13). Hypatia of Alexandria was, indeed, a physically beautiful woman
who used her talent and intelligence to defy the stereotypes against... Show more content on
Helpwriting.net ...
Hypatia of Alexandria, unfortunately, met a tragic end. Before going into the story of her death, it
is important to go back and examine the reasons behind it. According to Costa Giovanni in her
journal Hypatia, the Daughter of Theon, when Christian took root in Alexandria, Egypt, in A.D.
390, frequent battles and riots broke out between those of opposing religions. Hypatia was a
Neoplantonist, which encourage logical reasoning rather than taking anything on blind faith. As a
result, with her exceptional level of knowledge and dignity, Hypatia became a center of all
attention. In reality, many believed that Hypatia was such a great influence that Christianity would
not survive as long as she was alive (Morrow and Perl

Essay on Mother s Leisure Satisfaction
Introduction
A women s leisure style changes abruptly upon the arrival of children because she is no longer
only responsible for her personal needs, but the needs of other human beings. Her time is no
longer her own; she coordinates eating, sleeping, school, and homework schedules. In addition to
juggling these activities, she has a marriage to sustain, as well as her own personal matters. This
can be a lot for one person to handle and leaves little time for personal leisure pursuits for any
mother. Mothers tend to be hard workers, as they spread themselves thin amongst all of the children
who are dependent upon them for life. This sense of duty a mother feels towards her children is so
strong, many mothers ... Show more content on Helpwriting.net ...
Constraint. Anything that hinders a mothers ability to participate in intrinsic leisure.
Satisfaction. The fulfillment of drives, motives, needs, or expectations (Siegenthaler amp; O Dell,
2000, p.285).
Leisure. The freedom to perform activities in life, not done by obligation, but by free will.
Delimitations
The delimitations in our study are as follows:
1. By design, the study is delimited to stay at home mothers with children still living in the home.
To minimize lurking variables we have chosen not to survey working mothers or mothers who are
currently enrolled and attending school at a university.
2. Our group of study will include only women who belong to the Church of Jesus Christ of Latter
day Saints.
3. All of the women we are studying are married.
4. All women participating in the study must have the adapted IQ of 80 or above, due to
specifications stated on the Leisure Satisfaction Measure.
Limitations
The limitations of our study are as follows:
1. A weakness in our study is location. Perhaps a mother s leisure satisfaction is dependant on
the town in which she lives or the recreational opportunities and services around her. Leisure is
viewed differently by someone living on a farm in Nebraska than it is by someone who lives in
New York City. The person who lives in the city has countless options of things to go and do which
are close by, while the person living in a rural setting might need more time

Net Neutrality Vs Open Internet Essay
Along with consumer advocates and human rights organization, many internet application
companies like Yahoo, Amazon, eBay, Vonage etc. support net neutrality regulation. Google
published a statement in 2008, opposing market power of broadband providers to control access to
content and other applications. They further compared the situation to that of the
telecommunication market, where companies are not allowed to control who their customers call
or what those customers are allowed to say. The Sites which favor net neutrality propose to have an
equal platform for every content on the Internet, in short they demand Open Internet.Net neutrality
is a highly important component for open internet. The idea of an open internet reflects that anyone
... Show more content on Helpwriting.net ...
This means that cable companies would be required to allow Internet service providers free
access to cable lines, like the model used for dial up Internet. They also intend to make sure that
the cable companies cannot screen, disrupt or filter Internet content without a court order. This in
turn would allow FCC (Federal Communications Commission) to enforce rules of net neutrality
effectively. Furthermore, Net neutrality advocates argue that allowing cable and
telecommunication to act as gatekeepers i.e. being able to control speed of loading of websites,
as well as letting them to demand a toll on quality of service would create an exploitative
business model and would also slow down innovation in online services. Further, they also argue
that by charging certain sites, ISP s may be able to block those who are unable to pay. Also, the
advocates assert that every content on the Internet must be treated same and must move at the same
speeds. Presently, the order is meant to set a precedent that all ISP s as well as communication
companies cannot impede customers from using their networks the way they desire unless there is
a valid

Potential Torts And Contract Legalities And Ways To Avoid...
Running Head: TORTS AND CONTRACT LIABILITIES AND WAYS TO AVOID THEM
Potential Torts and Contract Liabilities
And Different Ways to Avoid Them
Abstract
People who do business as a sole proprietor or in a partnership are liable for the torts committed
by them and for torts committed by the business and its agents. The best way to avoid tort liability
is to set establish their business as a corporation or a limited liability company. A corporation or
limited liability company will act as its own entity for all intent and purposes. When it becomes it
own entity you will have to separate your finances from that of the business. Remember that it does
not matter what type of business organization you select, ... Show more content on Helpwriting.net
...
Remember that it does not matter what type of business organization is selected, if a person
commits a tort they are still personally held responsible. For example, if a shareholder in a
corporation runs over an employee while driving a company truck, he or she is still held liable
for negligently operating the vehicle. There are certain clauses that can be beneficial in a
contract as well as clauses that one should be wary of. Some clauses that can be beneficial
include hold harmless clauses, which are used to shift liability from person to another; and
indemnification clauses, which are designed primarily to transfer the liability and expense of
claims brought against the business away from the entity (Rapp). While some clauses are
beneficial, one should be wary of others. For example, one should avoid clauses pertaining to his
or her rights and duties in the event that a claim or suit arises, which can create a contractual duty
on their part (Rapp). Entering into a provider agreement that forfeits a person s ability to seek
compensation for services they are entitled to should also be avoided. One should always be
cautious of forfeiting their right to compensations (Rapp).

Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus.
In order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The
results for my DNA was not able to be determined through sequencing. The DNA samples of the
class recorded that 62% of the participants were tasters (carries the allele at the TAS2R38 locus)
and 38% of the participants were non tasters (does not carry the allele at the TAS2R38 locus).
Objective: The objective of the project is to be able to determine which alleles are carried at the
TAS2R38 locus and verify if the genotype reflects the expected phenotype. Methods:... Show more
content on Helpwriting.net ...
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a
flavor and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng
/ВµL (6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/ВµL DNA /100 ВµL H2O). The DNA
sample was divided by 100 ВµL instead of 25 ВµL of H2O because the sample was diluted 4
times. Experiment 3: The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The
reverse primer found is 5 ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work
for my obtained DNA as there was no evidence of movement of the DNA. PCR did work for lab
numbers 33 and 12. The size of my fragment could not be determined and cannot compare to the
size that was expected. The negative control was clean as there was no traces of movements.
Experiment 6: The DNA concentration after TAS2R38 PCR purification and quantification was
0.344 ng/ВµL (34.4 ng/mL). My genotype at the TAS2R38 locus was not determined by the
sequencing. The genotypic frequencies of the class obtained by sequencing: 0.4 (40%) TT, 0.4
(40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class obtained by sequencing: 0.6 (60%) T
and 0.4 (40%)

Essay on Bobbie Ann Mason s Shiloh
Bobbie Ann Mason s Shiloh In the story Shiloh by Bobbie Ann Mason, The reader gets different
points of view and different feelings about the characters and the story. In this story the narrator
explains how time and distance can create a gap between two people. It also talks about how
naГЇve Leroy really is and also how self centered he is. It allows the reader to understand that
sometimes in doing something good people could be doing something that hurts others. This story
reveals to the reader how distance and low communication can separate individuals from each
other. Leroy, the narrator, is a person that has lived separated from his wife Norma Jean for a lot of
time because of the job he has. This has created a gap between... Show more content on
Helpwriting.net ...
Leroy could be said that he is a little naГЇve because he thinks that nothing has changed and that
everything is the same as before. What he doesn t realize is that what has changed the most is
his wife. In this story the reader gets the impression that Norma Jean and Leroy are living in a
lie. Although Norma Jean has found other things to do while he is away she feels lonely and
trapped. Leroy on the other hand feels that she is happy with the life style they have. But what
Leroy does not realize is that they have grown apart. Leroy is having a hard time realizing that
his relationship with his wife is not as strong as he thinks it is. He feels the need talk about their
dead son, but doesn t know if he should mention him to Norma Jean. As it says in the story and
Leroy wonders if one of them should mention the child. (47) This crates a complicated scenario
for Leroy who is having trouble understanding what has happened between him and his wife.
This allows the reader to think badly about Leroy, and also lets the reader judge the way Leroy is
acting. But the reader also understands him since he has been talking about his son for a long
time with other people. As it says in the story Leroy used to tell hitchhikers his hole life story
about his travels, his hometown, the baby. (51) This is why Leroy feels the need to

The Role of Women in Islam
Lomonosov Moscow State University Business School
The Analysis of the Role of Women in Islamic Culture by ...
May 24, 2012
Abstract My paper is written in purpose to cover the issue of the role of women in Islamic culture.
My first part is devoted to the status of women according religious texts of Islam, Quran and Sunna.
The first factor that determines the role of Muslim women is spirituality. In this regard women are
equal to men; they ... Show more content on Helpwriting.net ...
Osman M.F. , a Ph.D. in Islamic law and institutional history from Princeton University, supports
this statement by stressing out that women are not seen as a mere shadow or an extension of a
man, always following him (1993, p.3). He believes that women are free as individuals and are
responsible for their faith and actions under the Islamic law. Hasan Abdul Ghaffar, a scholar of
Hadith and a member of the Islamic Ideological Council in Pakistan, takes the same stand and
concludes: There can thus be no doubt that in the Hereafter, men and women will both be
judged, each individual bearing the burden of its own acts, each soul will be punished for its
transgressions and each will be rewarded for its obedience to Allah (1996, p. 4). As Women s
League points out basing on the Quran, both males and females are supposed to play the role of
vicegerents (1995, Role as Vigerents section), praying to God and living up to his injunctions so
that they can finally get to the paradise: Say: Behold, my prayer, and all my acts of worship, and
my living and my dying are for God alone (Quran, 6:163). Some people may regard that the
vicegerency of a woman should mainly be performed through childbearing. Nevertheless, there is
no division of the vicegerency between sexes in the Quran, moreover, women should not be
disregarded for being infertile or deciding not to have children. As evidence, the prophet
Muhammad had children only from two of his wives, Khadija and

Hitler s Policy Of Appeasement
There was not one single cause that started World War II, but instead a result of several different
factors. The Treaty of Versailles was excessively harsh and angered the Germany people, The
Great Depression resulted in European Nations not have the resources to prepare an army, Hitler s
dream of making Germany a global power and the futile Policy of Appeasement were all factors
that caused World War II.
Although multiple factors contributed to the start of WW2, Hitler s agenda was the most
prominent factor in starting WW2. Hitler always wanted to go to war regardless of other things
happing around him. Hitler s rhetoric during the 1920s had made it clear that, should he come to
power, Germany would set about rearming. (H.P. Willmott, R. Cross, C. Messenger (2010) p. 28)
As early as the 1920s Hitler was planning to go to war, which is a clear indicator that Hitler s
agenda was always going to cause a war. Adolf Hitlerturned his attention to three foreign policy
goals. Second, Germany should be restored to its rightful place as the strongest European power,
and a Greater Germany should be created. (H.P. Willmott, R. Cross, C. Messenger (2010) p. 28)
Hitler wanted to make Germany the strongest European power, and the only way that was going to
happen was through war. The combination of Hitler s announcements of rearming and the idea that
one of his key goals was to make Germany the strongest European power demonstrate that Hitler s
agenda was to go to war, leading to

Pros And Cons Of Self Driving Cars
Technology is ever advancing in our society today. It continues to progress and further itself and it
is benefiting us substantially. It is helping our epistemological understanding on the way the world
operates and how to further our work and understanding of the world. It is benefiting us
economically, making it faster to produce goods and creating new ways to make money. One of the
fastest growing ways to earn a fortune is that of the automobileindustry and the evolution of cars. In
the early 1900 s, Henry Ford start the assembly line for the Model T, which mass produced cars. It
evolves with interchangeable parts, so if something broke it was less expensive to repair. 100 years
later, we now look to make cars able to drive on their own, self driving cars, but is it a good idea?
There are many benefits and just as many negatives to having a self driving car, and this will be a
brief synopsis on what some of these reasons are.
There are several ways that these self driving cars can be manufactured and operated in order to
make them how they are. One method is to attach a copious amount of sensors to the vehicle so
anytime it senses an object coming it ll avoid it. This method wouldn t be very practical,
however, because oncoming traffic would run the car off the road. There would also be no way to
keep the vehicle in the road because there would be nothing to keep the vehicle on the road. Or,
possibly, the sensors could go bad if they get covered with elements anywhere in

Social Implications Of Animal Testing Essay
Social implications:
There are also positive and negative social implications. There is often not a huge amount of
success around animal testing. Things that work on animals often don t work and cannot prove to
work on humans. The testing of just one substance can involve using up to 800 animals, and could
cost over $6 million. This proves that animal testing is expensive, time consuming, unpredictable,
and not easily reproducible. When an animal test doesn t end successfully it s costing a lot of
money. This money could be spent on more necessary things that would benefit the public. Animal
testing can be dangerous to society and the people who the drugs are tested on after the animals.
Usually even if the animal survives the experiment, it

How To Write Good Essay In Ielts Exam. Online assignment writing service.

How To Write Good Essay In Ielts Exam. Online assignment writing service.

Recommended

Recommended

More Related Content

Similar to How To Write Good Essay In Ielts Exam. Online assignment writing service.

Similar to How To Write Good Essay In Ielts Exam. Online assignment writing service. (20)

More from Tricia Hillard

More from Tricia Hillard (20)

Recently uploaded

Recently uploaded (20)

How To Write Good Essay In Ielts Exam. Online assignment writing service.