Mdm2 oncoprotein. Cell Mol Life Sci 55:96–107 1) Researchers identified a novel oncogene, ribosomal protein L10a (RPL10a), using a cDNA library from Daudi cells to transform p53 knockout mouse embryonic fibroblast cells. 2) Western blot analysis of tumors from myc mice showed different levels of p53 and ARF expression, indicating deregulation of the myc-ARF-p53 pathway. 3) Sequencing of DNA from foci identified RPL10a as a potential oncogene, and its interaction with Mdm2 may imitate effects of myc overexpression, contributing to tumor progression in the absence of p53

1. ARTICLE
Identification of novel oncogene RPL 10a using a Daudi cDNA library in
p53 KO Mouse Embryonic Fibroblast Cells
Anil Babu. J. Gaurav. D. Dwivedi*
Department of Molecular Biology, Umeå University, Umeå-901 87, Sweden
*Correspondence: gadu0002@student.umu.se
Summary
The p53 protein is involved in the regulation of cell cycle and apoptosis. Many cancers were investigated for the state of p53
and in over half of the cases, p53 action was found to be absent. Using the Western Blot study, we analyzed tumors from 
Myc mice to comprehend the relation of p53 and ARF. Here we identified the novel RPL 10a in Knockout (KO) mouse
embryonic fibroblast (MEF) cells transformed by Viraport XR plasmid Daudi cell lines to determine the potential oncogenic
nature of RPL 10a Jointly, these conclusions create a hypothesis that RP-Mdm2 interaction serves as an important p53 stress-
signaling pathway which gets stimulated by abnormal ribosome biogenesis and proves vital for shielding against oncogenic c-
MYC-induced tumors.
Introduction
Hence, ARF increases the availability of p53 and results in
ARF
P53 is a tumor suppressor gene which is associated with either p53-mediated cell cycle arrest or apoptosis. p19
the regulation of various cellular activities which leads to inhibits tumor development both through p53 dependent
cellular stress like cell cycle arrest, senescence, and and p53 independent pathway. The molecular mechanism
apoptosis. Mutations in p53 gene and loss of its function involved in p53 independent function by inhibiting the
through deletion, mutation and epigenetic silencing are processing the rRNA through interactions with
frequently found in both familial and sporadic cancers. nucleophosmin (Kawagishi,Nakamura ,Maruyama
More than 50 % of human cancers caused due to the , Mizutani , Sugimoto , Takagi , Sugimoto).This pathway
mutations in TP53 or inactivation of p53 pathway apparently supports to protect the organism from cells
(overproduction of p53 inhibitor MDM2 –murine double that recruit anomalous oncogenic factors and may be turn
minute2).Myc is a transcription factor which activates Arf into cancers (Sherr, 2001). Recent genetic studies are
dependent p53 pathway (Evan and Vousden, 2001; Ko and supporting the evidence for p53 independent function of
Prives, 1996). Mdm2 (Freedman et., al 1999).
Abnormal oncogenic factors are usually responsible in In this study we observed the different levels of Arf and
ARF p53 status in tumor samples which are harvested from
activation of p53 through the p19 pathway (Sherr and lambda-myc mice, and searching for a novel oncogene in
ARF
Weber, 2000; Sherr, 2001). The intensity of p19 protein p53 KO mouse embryonic fibroblasts, so that we used p53
is increased by the tumorigenic signaling, as occurs with KO mouse embryonic fibroblast with retroviruses
overexpression of c-myc or mutational activation of ras containing c DNA library from Daudi cell line for screening
of novel oncogene. Ribosomal protein-Mdm2 interactions
(Palmero et al., 1998; Zindy et al., 1998). The rising ARF
are focusing the new insights for the cancer therapy,
level is affecting the inhibition of Mdm2-mediated through p53 independent Mdm2 (RING finger) functions
ubiquitylation of p53 (Kamijo et al., 1998; Zhang et al., (Marine,et., al 2010).
1998), where p53 undergoes degradation in 26S
proteasomes (Roth et., al.1998).
Significance
Ribosomal proteins are in the limelight of the modern cancer research. In our studies we found about the unique oncogenic
capability of the human ribosomal protein L10a (RPL10a) in a p53-Knock out mouse embryonic fibroblast cells. The recent studies
suggesting that similar interaction between RP-Mdm2 provokes the formation of Eµ Myc induced lymphomas. We put forward that
the interaction between RPL10a and Mdm2 can imitate some effects of Myc over-expression, contributing in the tumor (lymphoma)
progression in the loss of p53 function.

2. ARTICLE
Results
Western Blot analysis of p53 and ARF expressions
The λ Myc lymphoma samples contained different 14
ARF
levels of p53 , p19 which is illustrated by the
12
Western Blot results. In case of sample 1 (λ 956) and
Number of Foci
10
sample 2 (λ959) p53 expression is normal, while
sample 3 (λ 962) showed that p53 was mutated. 8
6
4
2
0
RV-cDNA cDNA Uninfected
Figure 2. Number of foci observed after infection of
p53KOMEFs.
Daudi cell line cDNA library were used to transform
p53KOMEFs. The cells were also aseptically cultured as a
negative control (uninfected). Followed by 19-days of cell
culture, number of foci was obtained as 8, and 12, foci for
retroviral control, cDNA library, and uninfected plates,
Figure 1. Western Blot Analysis of p53 and ARF Levels.
respectively.
The above samples, sample 1 (λ 956),sample 2 (λ
959),sample3 ( λ 962), were analyzed by western blot
using anti-p53, anti-ARF, and anti-actin antibodies. The
analysis showed different variations of p53 and ARF
expression.Sample3 ( λ 962) indicated that overexpession
of ARF and mutated p53 also observed,while sample 1 and
sample 2 showed normal expression of p 53 ,however no
ARF.
Searching for novel oncogene by cDNA library
p 53 Knockout (KO) mouse embryonic fibroblast
(MEF) cells were infected with the Viraport XR
plasmid Daudi cDNA library, transformation was
determined by foci formation as mentioned in figure Figure 3. PCR reaction and DNA extraction from agarose
gel.
2. PCR analysis of some foci results in the formation
of smear but some of the foci shows two or three The genomic DNA was extracted from 9 foci followed by
bands. Lane 1 represents DNA ladder (1Kb marker), PCR analysis and loaded on an agarose gel .6 bands were
On Lane 2, 5 and 9 foci bands were not separated selected and sent for sequencing. The band 4 resembles to
well. Foci bands which were well separated and the gene coding for RPL10a.
strong were selected for sequencing.

3. ARTICLE
Table 1. Sequencing Result of Band 3
Caaatgtgccttaatataggcgctggggcttgcccatggtgctcttgatatataaggcccggacattctgccagtttttcttgggcaatgacaccaagaagttgacagcc
aggtgaatgttatacacaagctcatcgtctgtcatcttcacgtgaccaacagctacagccagacataacaccttcttcatttggaacttgattgtggacttcacctcatcc
actttggccaccatgttttcgttgtgtgtgagcagggaagggaactttcctgccttatttaaacctgggccgaggattcgtggaatctgcttgatcagagactctgaggc
caaaaacgcatcatatttcttggccagcttcttgaccagttttttattcttgttgagttttttcagcgcctcgatgtccatgtgggggatatccacggccttagcctcgtcac
agtgctgctggtcccccaggacacacacagagaacttagggcggggagtggacttaagcctgacggtgcccgagaagcgcttgtccttctggggatcatagttcttca
agctgatctgcaactccaccgtctccaggaacttgcggcgcttgcgctggttcccgtgcaggacttcccgcaccgcctcgtacagggtgtcgcgagagactttgcctcgt
gccgaattcgtcgacaattcgatccggcagtctagaggatggtccacccccggggtcggcagccttcacgtgggcggcgtgtatccaagctgcgatgccgtctactttg
agggcggtgggggtggtcagcaggactgtgtaaggtcctttccagcgaggttctaggttcttagtctggtgtcggcggacccacactgt
Gel electrophoresis results of mini preparations After sequencing the selected 6 bands (Figure 3)
plasmid DNA. were identified as bands 1, 3 and 4(Figure 4)
representing novel oncogenes. The band 2 correlates
Comparison between the Miniprepartions plamid the genes from untransformed cells next to
DNA digested with restiction enzymes(Eco RI) or un transformed cells, and accidentally harvested. The
digested using Gel electrophoresis analysis which gene which is band 3 out of the three bands (Figure
indicates that colony 3 Eco RI digested sample match 4) selected for sequencing, the sequenced gene was
with the PCR product band 4 ,we isolated from the identified through BLAST search as Gene ID: 4736
PCR analysis (figure 3).The insert bands from Figure (Ribosomal Protein L10a) and the details mentioned
4 match the PCR product band from figure 3. in Table 1.
Discussion
Precise diagnostic and therapeutic stratagies could
be developed by understanding the biochemical,
cellular,and molecular mechanisms which are the
back bone of the different stages of cancer
development.
The western Blot analysis results show the p53 level,
sample one and two are almost similar, but it was
quite higher in third sample. In sample one and two
there is no Arf expression which is similar to loss of
Arf function observed in 24 % of overall Arf- MdM2-
p53 pathway deregulation (Eischen., et.al 1999 ), but
Figure 4. Plasmid DNA digestion with EcoRI.
the third sample indicating the overexpression of
After incubation of plasmid samples with EcoRI, the both p53 and Arf. In p53 KO cells, ARF directly binds
digested samples (D) and undigested plasmids (UD) were to c-Myc protein and inhibits c-Myc–induced
loaded on an agarose gel. Two different DNA band sizes hyperproliferation and transformation with
were observed between UD and D plasmids extracted associated inhibition of acknowledged c-Myc target
from all colonies. The digested plasmid DNA samples 1, 3, gene induction (Boone., et al 2010).The p53 is
and 4 showed two bands representative for successful
stabilized by Arf by binding with MDM2, so it would
enzymatic digestion.
have also expressed at higher levels as p53, due to
deregulation of myc (Translocation of myc gene

4. ARTICLE
between chromosome 8 and chromosome 14-t8:14, Experimental Procedures
leads to Burkitt’s lymphoma.
Analysis of  Myc lymphomas
The number of foci found in the plates is important,
which indicate the efficiency of transformation of The λ Myc lymphoma samples were harvested from
mouse embryonic cells to transformed cells. The p53 mice and kept frozen until added the lysis buffer to
KO mouse fibroblast embryonic cells transformed each pellet, dissolved it by pipetting up and down.
with the cDNA vector identified as the novel Homogenize the samples with the help of 20 gauge
needle and syringe. The samples were centrifuged at
oncogene ribosomal protein (RP L10a). Many of the
1500 rpm for 5 minutes. The supernatant (Protein
ribosomal proteins are majorly involved in the RP-
solution) transferred to fresh tube and replaced it on
Mdm2 interaction to inhibit the ribosomal ice. BioRad protein assay solution was used for
biogenesis (Macius et al 2010). The development of quantification of protein samples.
Eµ-Myc-generated B-cell lymphomas and intestinal
adenomas as a result of APC loss are delayed in mice Western blot was performed using primary
with decreased levels of Mdm2. Loss of RP-Mdm2 antibodies α-p53 (1:500/ Sigma), α-Arf (1:500/Santa
interaction provokes Eµ-Myc induced Cruz), and anti-β-actin (1:20,000 /Sigma). After
lymphomagenesis. c-Myc upregulates ribosome incubation the membrane was washed off and
biogenesis through the activation of many nucleolar treated with developing liquid- SuperSignal West
proteins which involved in this process (Ruggero and Dura (Pierce) followed by developed on X-ray film
(Fujifilm Lifescience).
Pandolfi 2003). Eµ-Myc transgenic mice develop B
cell lymphomas (Adams et al., 1985) similar to that Harvesting of Foci, DNA extraction and its
which are observed in Bukitt’s lymphomas bearing a amplification
translocated (t8;14) c-MYC allele(Alitalo et al.,
1987).Similar to the mammalian system, deficiency p53 Knockout (KO) mouse embryonic fibroblast
of several Ribosomal proteins in zebrafish also (MEF) cells were plated at a density of 180,000
initiates p53 dependent cell growth arrest and cells/6 cm on a petridish (Delta Si) and infected with
apoptosis. Overexpression of RP initiates tumor Viraport XR plasmid cDNA library supplemented with
formation (Chakraborty et., 2009). In case of p53 8 µg/mL of polybrene (Sigma) and cultured in DMEM
independent functions of Mdm2, likewise in Mdm2 (GIBCO) medium. The mouse embryonic fibroblast
(RING Domain basis) ubiquitylation contributes to (MEF) cell culture plate and mouse embryonic
Ras-ERK- mediated degradation of the transcription
fibroblast (MEF) cells containing viral vector were
factor, FOXO3a to promote cell proliferation (Marine
used as control to compare the cell morphology.
et., al 2010). Another evidence for p53 independent
Media was drained off and then PBS added to the
Mdm2 action is the ability of the Mdm2 to induce
cells. Foci harvested under the inverted microscope
monoubiquitylation of dihydrofolate reductase
by using the pipette tip and transferred to eppendrof
(Maguire et., al 2008). The other proteins include Rb,
tube.
E2F1 and Samds are also supporting the Mdm2
oncogenic function of p53 independent and Mdm2
Identification of novel oncogene RPL 10a
plays a key role in IGF1R mediated p53 independent
proapoptotic function. In fact identification of Direct PCR lysis reagent (Viagen Biotech) used to
MDM2-RP interactions provides the new thought isolate genomic DNA from foci. Lysates were
puts to develop anticancer drugs (Kawai et., al 2003). analyzed using PCR under conditions specified in the
Viraport Manual. After size separation on an agarose
gel, specified bands were then isolated for further
analysis. QIAquick Gel Extraction kit was used to
remove agarose from DNA. The eluted DNA (30 µl)
from gel extraction procedure was sent for DNA

5. ARTICLE
sequencing (GATC Biotech), the remaining samples and Yanping, Z. (2010). An ARF-independent c-MYC-
pooled (120 µl) together in one eppendrof tube and activated tumor suppression pathway mediated by
ribosomal protein-Mdm2 interaction. Cancer cell 18, 231-
used for cloning (ligation, transformation). Ligation 243.
reaction was carried out with the pGEMT easy
cloning kit (Fermentas). Freedman DA, Wu L, Levine AJ (1999) Functions of the
MDM2 oncoprotein. Cell Mol Life
The mini preparation plasmid DNA was digested with Sci 55, 96–107.
restriction enzyme Fast Digest EcoR1 (Fermentas) Kawai, H., Wiederschain, D., and Yuan, Z.M. (2003). Critical
and separated by agarose gel electrophoresis. contribution of the MDM2 acidic domain to p53
ubiquitination. Mol. Cell. Biol. 23, 4939-4947.
Acknowledgments
Ruggero, D., and Pandolfi, P.P. (2003). Does the ribosome
We thank to Dr. Jonas Nilsson, Mr. Linus Plym translate cancer? Nat. Rev. Cancer 3, 179-192.
Forshell, Mrs. TachaZi Plym Forshell and Mr.
Kamijo, T., Weber, J. D., Zambetti, G., Zindy, F., Roussel, M.
Pramod.K, for their guidance and the knowledge
F. and Sherr, C. J. (1998). Functional and physical
they imparted to us. We also thank to our laboratory
mates for their cooperation and support. interactions of the ARF tumor suppressor with p53 and
Mdm2. Proc. Natl. Acad. Sci. USA 95, 8292-8297.
Kawagishi, H., Nakamura, H., Maruyama, M., Mizutani, S.,
References
Sugimoto, K., Takagi, M., Sugimoto, M. (2010). ARF
Adams, J.M., Harris, A.W., Pinkert, C.A., Corcoran, L.M., Suppresses Tumor Angiogenesis through Translational
Alexander, W.S., Cory, s., Palmiter, R.D., and Brinster, Control of VEGFA mRNA. Cancer Res. 70: 4749-4758.
R.L.(1985). The c-myc oncogene driven by immunoglobulin
Ko , L.J., & Prives , C. (1996). P53: Puzzle and paradigm.
enhancers induces malignancy in transgenic mice. Nature
Genes Dev.10, 1054-1072.
318, 533-538.
Macias E, Jin A, Deisenroth C, Bhat K, Mao H, Lindström
Alitalo, K., Koskinen,P., Makela, T.P., Saksela, K., Sistonen,
MS, Zhang Y. (2010) An ARF-independent c-MYC-activated
L., and Winquist, R., (1987). Myc oncogenes: activation
tumor suppression pathway mediated by ribosomal
and amplification, Biochim. Biophys. Acta 907, 1-32.
protein-Mdm2 Interaction. Sep 14;18(3):231-43.
Chakraborty, A., Uechi, T., Higa, S., Torihara, H., and
Marine, J.C. and Lozano, G. (2010) Mdm2- mediated
Kenmochi, N. (2009) Loss of Ribosomal protein L11 affects
ubiquitylation:p53 and beyond. Cell Death and
zebrafish embryonic development through a p53
Differentiation. 17, 93-102.
dependent apoptotic response. PloS ONE 4, e4152.
Maguire M, Nield PC, Devling T, Jenkins RE, Park BK,
David N. Boone, Ying Qi, Zhaoliang Li, and Stephen R. Hann
(2011). Egr1 mediates p53-independent c-Myc–induced Polan˜ski R et al. (2008) MDM2
apoptosis via a noncanonical ARF-dependent regulates dihydrofolate reductase activity through
transcriptional mechanism. PNAS 108 (2) 632-637.
monoubiquitination. Cancer Res 68:
Eischen, C.M., Weber, J. D., Roussel, M.F., Sherr, C.J., and 3232–3242.
Cleveland, J.L. (1999). Distruption of the Arf-MdM2-p53 Roth, J., M. Dobbelstein, D.A. Freedman, T. Shenk, and A.J.
tumor suppressor pathway in Myc induced Levine. 1998. Nucleo-cytoplasmic shuttling of the hdm2
lymphomagenesis. Genes Dev. 13, 2658-2669. oncoprotein regulates the levels of the p53 protein via a
pathway used by the human immunodeficiency virus rev
Evan, G.I., & Vousden, K. H. (2001).Proliferation, cell cycle
protein. EMBO J. 17:554–564.
and apoptosis in cancer. Nature.411, 342-348.
Sherr CJ and Weber JD. (2000). Curr. Opin. Genet. Dev., 10,
Everado, M., Aiwen, J., Chad, D., Krishna, B., Hua, M.,
94–99.
Lindstro, M.,

6. ARTICLE
Sherr CJ. (2001). Nat. Rev. Mol. Cell. Biol., 2, 731–737. .
Weber JD, Jeffers JR, Rehg JE, Randle DH, Lozano G,
Roussel MF, Sherr CJ and Zambetti GP. (2000). Genes Dev.,
14, 2358–2365
Zhang Y, Lu H (2009), signaling to p53: ribosomal proteins
find their way. Cancer Cell. 2009 Nov 6; 16(5):369-77.
Zindy F, Eischen CM, Randle DH, Kamijo T, Cleveland JL,
Sherr CJ & Roussel MF 1998 Myc signaling via the ARF
tumor suppressor regulates p53-dependent apoptosis and
immortalization. Genes and Development 12 2424-2433.