Essay On Social Media

Essay On Social Media
Writing an essay on the topic of social media is no simple task. The complexity lies not only in
the vastness of the subject matter but also in the ever-evolving nature of the digital landscape.
Social media encompasses a wide range of platforms, each with its unique features, impact on
society, and implications for individuals. To adequately address this topic, one must delve into
the historical, cultural, psychological, and technological aspects that shape the social media
landscape.
Navigating the diverse perspectives surrounding social media adds another layer of difficulty.
Opinions on its influence range from celebrating its role in fostering connections to condemning
its negative effects on mental health, privacy, and societal norms. Striking a balance between
presenting these viewpoints and forming a cohesive argument requires a thorough understanding
of both the positive and negative aspects of social media.
Furthermore, the rapid pace of technological advancements means that any analysis of social
media quickly becomes outdated. Staying current with the latest trends, controversies, and
developments is crucial for crafting a relevant and insightful essay. It demands continuous
research and critical thinking to synthesize the ever-changing information into a coherent
narrative.
The challenge extends beyond content alone; the structure and style of the essay are equally
important. Organizing thoughts in a logical manner, developing a clear thesis, and maintaining a
coherent flow are essential components of a well-crafted essay. Additionally, the writer must
consider the intended audience and adapt the tone and language accordingly, as social media
appeals to a broad demographic with diverse perspectives.
In conclusion, crafting an essay on social media is a demanding task that requires a
comprehensive understanding of the subject, the ability to navigate diverse viewpoints, and the
agility to keep pace with the constant evolution of the digital landscape. It is a challenge that
tests not only the writer's research and analytical skills but also their ability to communicate
effectively. For those seeking assistance, similar essays and much more can be ordered on
HelpWriting.net.
Essay On Social Media Essay On Social Media

Inspector Goole In An Inspector Calls Essay
Explore the characterization and role of Inspector Goole in An Inspector Calls .
An inspector calls was set in 1912 but it was written by J.B Priestly in 1945 which
means it was performed in 1946.
The author s purpose in this play was to convey to the audience that the world
should be is equal to everyone and everyone should be treated equally not divided in
classed.
The writer used the Inspector Goole to give Mr. Birling s family a lesson as well as
the writer s thoughts about the situation. Hence, the Inspector Goole is one of the
most important characters because he is the one questioning the Birling family and
making them see that they are responsible for Eva Smith s death.
In the play it highlights the theme of the generation gaps. ... Show more content on
Helpwriting.net ...
Yes, I wasn t in love with her or anything but I liked her she was pretty and a good
sport . This quotation is showing that he is not lying because he will get the
punishment but he is telling the truth. On the other hand, the old will do anything to
protect themselves. Perhaps I ought to warn you that he s an old friend of mine,
and I see him fairly frequently. This stats that he tries to cover what he did with an
excuse of personal connection. Furthermore, Mrs. Birling is just saying straight out
to the inspector I don t think we want any further details of this disgusting affair .
The word disgusting is described when a person doesn t like something or someone
to talk about usually it shows the negative impact. Thus it is harder for the old
generation to admit their faults since they have lived the life in this way for

Food Intake 3 Days Essay
Food Intake 3 Days According to the World Health Organization, Nutrition is the
intake of food, considered in relation to the body s dietary needs. Good nutrition an
adequate, well balanced diet combined with regular physical activity is a cornerstone
of good health. Poor nutrition can lead to reduced immunity, increased susceptibility
to disease, impaired physical and mental development, and reduced productivity.
(World Health Organization, 2012) Nothing is more important than following a
healthy diet. Eating the wrong foods or not eating enough of the right ones can
deprive the body of the essential nutrients it needs to keep working at full power.
Maintaining a healthy diet can help boost the immune system, improve... Show more
content on Helpwriting.net ...
According to the recommendations, I came in below the suggested amount for all
three categories. Carbohydrates are the body s primary source of energy. Without
adequate carbohydrates, a person may feel fatigued and weak, as the body looks
elsewhere for sources of energy. A severe lack of carbohydrates can deprive critical
bodily organs the necessary energy to properly function. Lipids are naturally
occurring organic compounds that include fats and oils. An excess of some lipids
can increase the chances of certain health problems, lipids are vital nutrients to a
healthy body. Lipids are necessary for the absorption of fat soluble vitamins. A
diet too low on lipids lowers the level of good cholesterol, decreases the body s
energy level and can disturb the body s formation of cells and cell functions.
During the three days of documented intake, my fiber consumption was only 24.3%
of the daily recommendation. Fiber helps promote proper digestive functions,
helps lower cholesterol, and helps in lowering the risk of diabetes and heart
disease. My intake was too low based on the recommended consumption, and
according to the data, I should eat more foods that are rich in fiber. These can be
insoluble fiber sources like wheat bran and nuts or soluble fiber sources like oats,
beans, and apples. The only foods that provided fiber in my meals were the bagels.

Charles Portis Research Paper
Although there are many famous people I could have done this paper on, I chose
to do someone closer to home. I am doing my paper over a famous Arkansan. My
person is one of Arkansas s best fiction writers to this day. He has written quite a
few books like Norwood, The Dog of the South, Masters of Atlantis, Gringo, and his
most famous book True Grit. The name of the man I am writingabout today is
Charles Portis. Charles Portis was born in El Dorado (Union County) Arkansas on
December 28,1933. His parents were Samuel Palmer Portis and Alice Portis, and he
has two brothers and one sister. Charles and his family moved across various towns
across southern Arkansas. They were educated in whatever town they were living in
at the time.(Cunningham)... Show more content on Helpwriting.net ...
When he returned home he enrolled in the University of Arkansas in Fayetteville,
Arkansas, and Charles graduated with a degree in journalism in 1958(Moore).
After college Charles worked for various newspapers as a reporter, Charles worked
at the Arkansas Gazette. Once he finished working at the Arkansas Gazette he
moved to New York. He was hired by the New York Herald Tribune Charles would
work there for four years. During his time working there Charles was sent to the
south many times to cover civil rights related stories during the 1960 s. After a
year of serving as the Herald Tribune s London bureau chief and reporter, Charles left
journalism in the year of 1964, and he went home to right fiction full time ( Charles
Portis ). Two years after Charles came back to Arkansas he released his first book
Norwood. Charles first book was very successful even to gain a movie adaptation in
1970. In 1968 Charles second book was finished it was a very popular book one of
Charles most famous. In 1969 a film adaptation was released making $14.25
million at the box office. Charles other books had more moderate sales. Charles last
book was Gringos in 1991. In 2012 Butler Center Books published the book Escape
Velocity: A Charles Portis Miscellany this book is a compilation of Charles Short
fictions, journalism, his memoirs, and

Similarities Between White Noise And Lolita
Similarities Within Literature
While novels in literature can have different plots, there are handfuls of devices that
are used in the same manner. Upon reading a chapter each from White Noise by Don
Delilo and Lolita by Vladmir Nabokov, plenty of noticeable similarities are found,
whether it be diction or syntax.
The first noteworthy aspect appears in the first sentence of chapter 39 of White
Noise and the first sentence of chapter 35 in Lolita a subject followed by a verb. The
verb drove is used in White Noise, while the verb Left is used in Lolita. Although
leaving to travel is common, both narrators are doing so in order to perform an
action of killing someone. Not only this, but each sentence has the same amount of
syllables, being 21. In a biblical sense, the number can be used to connote death
and rebirth, and a reflection of good and bad things that a person has done. Three
is another number that has been used a various amount of times throughout the
passages. It is first brought up in White Noise in paragraph three of page 290. Jack
states that he drove past [the deserted Roadway Motel] three times and how they
were the first three elements in his plan. As the novel is full of satirical
components, it becomes clear that Delilo may have purposely used drove three
times in paragraph one of 290 as a form of wordplay. Its usage can additionally be
for the purpose of applying emphasis to the word, almost as a method of
foreshadowing for something to come later

Critical View Of The Great Gatsby
The Great Gatsby was written during the 1920s, which is also known as the
Roaring Twenties. In the narrative F. Scott Fitzgerald gave a critical view of this
time. In the 1920s and the 1930s there was a lot going on, for example bootlegging,
drinking, criminal activity, and an evolution of jazz music. The women were also
going through an evolution, in 1920 they got the right to vote and since then they
changed a lot and they became known as Flappers. Women not only wanted to take
care of their families but also wanted to have a career. The independent New
Woman, who rejected marriage for career and political action who often rooted her
emotional life [...] was gradually discredited. In her place came the flapper, who
celebrated her sexual independence... Show more content on Helpwriting.net ...
in Drowne 163). This is definitely the case with Daisy Buchanan. In The Great
Gatsby, the narrative is told through the lens of Nick Carraway, he came to live in
West Egg next door to Jay Gatsby. He gets to know Jay Gatsby and Gatsby is in love
with Nick s cousin, Daisy Buchanan. She is married to Tom Buchanan. Jay Gatsby
and Daisy Buchanan know each other from the past, Gatsby had to leave for war
and he had to say goodbye to Daisy but he never stopped loving her, and in fact she
never stopped loving him either. Daisy is very beautiful and charming, but in fact
Daisy is a shallow, selfish and individual woman. Daisy has a daughter with Tom
Buchanan but that is not her focus, her focus lies with herself and her own life, so
she is much more self centered than women used to be. Gatsby is infatuated by
Daisy and Nick understood why, It was the kind of voice that the ear follows up
and down, as if each speech is an arrangement of notes that will never be played
again. Her face was sad and lovely with bright things in it, bright eyes and a bright
passionate mouth (Fitzgerald 8). In this fragment it shows that men are being lured
towards her and that there is a sexual attraction there, men cannot seem to forget her.
But it is not only the fact that she is beautiful

Diet Compliance
Dietary compliance for a severely restrictive diet is often bland and unpalatable to
patients; as such, compliance with the diet can be challenging and an undesirable
method of treatment. This study uses a token economy to reinforce compliance with
a long term medically advised diet, spanning the study over the course of four weeks.
Between meals and snacks, there are multiple opportunities each day for a patient to
break the diet, which may have adverse health consequences for the patient. For this
reason, it is crucial to modify the behavior of the patient in order to achieve the
maximum medical support and health benefits.
Diets can be particularly tricky for college students eating on a budget. The student in
the following study will ... Show more content on Helpwriting.net ...
Their study focused on four patients between the ages of 11 18 (two males and two
females) over an average of twelve months. The token economy was used to reinforce
safe eating habits of the patients as they awaited renal transplants, therefore, the
program was only a temporary requirement. The token system followed an ABA
design. First in the procedure, weight, BUN levels, and Potassium levels were
measured in order to track and compare the dietary behavior and adherence in patients
throughout the study. In the intervention phase, medical staff routinely took
measurements during dialysis. For each measurement within the target range
specified for each child, the child could earn 2 3 points. Eighteen points had the
equivalence of two dollars to be used towards purchasing toys or other items in a
prize bank. All items in the prize bank were chosen by the children before beginning
the study. Points were accumulated and presented on a chart made available to
medical staff and patients to provide further motivation, and could be traded in for
prizes at the end of the week. Results showed a significant relationship between the
implementation of the token economy and acceptable weight loss, BUN and
potassium levels. The effectiveness of this study is partially due to the variety of
prizes offered and the lack of parental support needed to succeed (insert

Resilience In Through The Tunnel
Throughout a person s life, they are faced with many different kinds of adversity.
The only way to overcome this adversity is through resilience. Being resilient is one
of the best attributes a person can have because when one is resilient they never give
up.
Resilience is the epitome of overcoming the unexpected and achieving one s goals
no matter what may stand in your way.In the story Through The Tunnel by Doris
Lessing, the author reveals that when one perseveres, they can meet their goals and
overcome adversity. She says One, Two, Three. He counted steadily. He could hear
the movement of blood in his chest. Fifty one, Fifty two...His chest was hurting. He
let go of the rock and went up into the air...On the day before they left, He would do
it. He would do it if it killed him, he said defiantly to himself. When the boy says he
... Show more content on Helpwriting.net ...
As he works towards his goal of holding his breath long enough to make it through
the tunnel, he faces many challenges like getting bloody noses after holding his
breath. Sometimes when one sets a goal they just need to persevere and
understand that it s okay to fail because it is a failure that truly makes one stronger.
When you have finished cutting the grass. How long do you think it ll take me?
Two or three months ...The next morning before noon I finished the job. The last
blade of grass was cut and carried away and the backyard was as bald as a razor could
make it (Wheelis). He s demonstrating resilience by doing the task he s been given
even though it will take him two to three months. In addition, he only has a razor
blade to

Examples Of Animism In Spirit Away
Spirit Away is an anime style fantasy film written and directed by the celebrated
artist Hayao Miyazaki. Originally released in Japan in 2001 to great fanfare,
Disney translated an English version and distributed the film to western audiences
later that same year. In 2002, Spirit Away went on to win an Academy Award for
Best Animated Feature, the Golden Bear Award at the International Film Festival
in 2003, and has become the most successful film in Japanese history to date. The
story focuses on a young, ten year old girl named Chihiro, who in the beginning
proves to be a very apathetic, whiny, and spoiled sort of child but grows and
develops tremendously as a bright soul by the end of the viewer s journey. The realm
in which Chihiro inhabits... Show more content on Helpwriting.net ...
Pythagoreans followed purification rituals that included extensive bathing, with
well developed rules, enabling their souls to achieve a higher rank among the
gods. Chihiro s journey of change and growth takes place in a bathhouse that
caters to these gods. There is notable emphasis on the bathing rites of passage
occurring in the film and as Chihiro tends to her daily work she is often dripping
wet, herself, from drawing baths and providing towel services to the gods. The most
dramatic of scenes includes an ancient stink spirit who arrives in search of its ritual
cleaning. Chihiro begins her duties only to be engulfed in the stench and mire that
flow from the stink spirit and upon successfully removing a thorn from its side, the
spirit proves to be a polluted river spirit, whose trash and pollution pours into the
room. Mindless waste, greed, and disregard for environment, all too well, relate the
ancient Pythagorean teaching that consequences of our daily actions alter our natural
and individual worlds in harmful and destructive ways that we know

Chromatography Separation Of Ortho And P-Nitro Aniline
Ortho and Para Nitroaniline are part of a wide range of pharmaceutical procedures.
The molecular structures of o nitroaniline and p nitroaniline both vary. P nitroaniline
has a significantly more polarity because of the more space between its groups.
Thin Layer Chromatography Separation of O Nitro Aniline and P Nitro Aniline
Chromatography can be defined as a series of steps used to identify, analyze and
separate compound. It is a method used to obtain components from a non volatile
mixture (Preethi, Harita Rajesh, 2017). There are various types of chromatography
separations methods. These include: column, gas, supercritical fluid chromatography
and Thin layer chromatography. All these separation techniques operate under the
same procedure;

Why Is The Sun Wrong
Modern science tells us that the Sun is a big hot ball of hydrogen at the center of the
Solar System, and all the planets orbit around it. But ancient people didn t have
access to the same scientific tools we have today. Their understanding about the Sun
was much more primitive, and often... wrong. Let s investigate the history of the Sun.
Most life on Earth evolved with the Sun in mind; the rising and setting Sun defined
the cycle of daily life for almost all life. Ancient peoples were entirely dependent on
the Sun for light; only the light from a full Moon gave any way to see in the night. It
wasn t until the invention of fire that humans had any way to get any work done after
the Sun went down.
Since the Sun was such an important object,

The Shortage Of The Nursing Shortage Essay
Who has not heard of a terrible experience with staff in a hospital or healthcare
facility? It is likely that the reason that these unfortunate situations have happened is
because of the nursing shortage around the nation. The issue of the nursing shortage
refers to the lack of sufficient qualified nurses in the healthcare system. Thus, with
nursing shortages comes the lack of attention for individual patient needs and even
possible malpractice law suits if the issues persist. Undeniably, the shortage of
nurses around the nation is growing exponentially because of the lack of
experience, education, and resources. Although this is the case, there are actions
that may be executed to help the cause, such as more training in hospitals, school
programs that bridge education with careers, and the encouragement for a more
gender diverse nursing profession. To begin with, let s acknowledge that there are
many underlying problems to the issue of nursing shortages. One of the most
important issues is that the demand for greater experience that is being required is
rapidly growing. The hospitals and medical care facilities always want nurses with
experience, but brand new graduates are not going to have the experience that is
required right out of college. This means that the proportions of young
inexperienced nurses is growing, even if the jobs were to be filled (H. 2016).
Unfortunately, being fully staffed does not mean that the work will be done correctly.
Experienced nurses make

Essay on The Solar System
The Solar System
What are planets? Planets are kinda like asteroid around the sun. There are nine
planets in the solar system, Mercury, Venus, Earth ( Our planet ), Mars, Jupiter,
Saturn,Uranus, Neptune, and Pluto.
The Terrestrial Planets
The terrestrial planets are the four innermost planets in the solar system, Mercury,
Venus, Earth and Mars. They are called terrestrial because they have a compact, rocky
surface like the Earth s. The planets, Venus, Earth, and Mars have significant
atmospheres while Mercury has almost none. The following diagram shows the
approximate distance of the terrestrial planets to the Sun.
The Sun
The Sun is the most prominent feature in our solar system. It is the largest object and
contains ... Show more content on Helpwriting.net ...
Prominences are immense clouds of glowing gas that erupt from the upper
chromosphere. The outer region of the corona stretches far into space and consists of
particles traveling slowly away from the Sun. The corona can only be seen during
total solar eclipses.
The Sun appears to have been active for 4.6 billion years and has enough fuel to go
on for another five billion years or so. At the end of its life, the Sun will start to
fuse helium into heavier elements and begin to swell up, ultimately growing so
large that it will swallow the Earth. After a billion years as a red giant, it will
suddenly collapse into a white dwarf the final end product of a star like ours. It may
take a trillion years to cool off completely.
Mercury
It is the closest planet to the Sun, and second smallest planet in the solar system. Its
diameter is 40% smaller than Earth and 40% larger than the Moon. It is even smaller
thanJupiter s moon Ganymede and Saturn s moon Titan Mercury is one of the planet
that doesn t have a moon or salitlite obriting around it. Mercury obrit around ( and
all the way ) the sun takes about 88 Earth days. Mercury has no atmosphere, and the
planet is too small to hold one. With no atmosphere, there is no heat, so it s temp. is
about 133 C.Mercury was named by the Romans after the fleet footed messenger of
the gods because it seemed to move more quickly than any other planet,obriting
around ( and all the way ) the sun takes

All Men Are Not Created Equal Summary
As a woman I have always thought that all men were superior to women in a
society viewpoint. Black men superior to black women, Hispanic men superior to
Hispanic women, and of course, white men superior to, well, all women, especially
women of color, and men of color. However, when reading the article All Men Are
Not Created Equal I had realized that Asian men are significantly inferior to Asian
women in western society. I never really thought about the imbalance until just
today, reading the article despite having always seen it in my day to day life. I really
enjoyed how the author, Yen Le Espiritu, focused on the historical reason as to why
Asian women are seen as more valuable in western society than Asian men. I, of
course, had learned about Chinese and Japanese immigration and the Japanese
internment in my high school history class, but I was never taught the societal and
family issues that these events had sparked.... Show more content on Helpwriting.net
...
Yet, Asian men had been stripped of their masculinity and power in the household,
causing many of them to become violent, depressed, or both. Not only was society
working against Asian men in a classist perspective, but it was/is also tearing them
down in a sexist regard by not allowing them to be the breadwinner of the
household, like their white counterparts. It was especially interesting to me how
these two articles overlapped into a particularly engaging observation of not only the
social issues of men, but specifically the immense social issues of Asian men.
However, one thing I would have wanted the author of All Men Are Not Created
Equal to elaborate on would be current Asian male status and social

Celebrated Jumping Frog
Knute Rockne, a former football coach for the University of Notre Dame once
said, Win or lose, do it fairly. However, in Mark Twain s story The Celebrated
Jumping Frog of Calaveras County, the main character, otherwise known as Smiley,
does not live by this saying. The story of Smiley and his celebrated jumping frog
takes place in a gold mining camp, which is located in Calaveras County, California,
during the Gold Rush era. The dominant theme in The Celebrated Jumping Frog of
Calaveras County, is that trying to deceive someone can result in unexpected
consequences. Several literary devices, including characters, satire, and diction, are
applied to the plot of the short storyin order to emphasize the primary theme.
Throughout the ... Show more content on Helpwriting.net ...
The prominent choices of diction which appear on the first page of Twain s short
story, some examples include, lurking suspicion and he backed me into a corner
and blockaded me with his chair. . The diction helps foreshadow the deception that
occurs later on in the story; furthermore, the choice of diction suggests intelligence,
which means that someone of higher intelligence is foreshadowed to try and
deceive someone of lower intelligence despite the fact there are consequences. The
dialogue of Smiley being accounted by Simon Wheezler, he ketched a frog one
day and took him home and said he cal klated to edercate him (Twain 3), contains
diction that emphasizes the lack of a formal education. By using diction that
suggests lack of intelligence and education, Twain is able to use the theme of
deception ending with unexpected consequences to showcase that probability that
people with lower intelligence have a hard time learning of their mistakes,
especially when deceived. The final example of diction, well I don t see no p ints
about that frog that s any better n any other frog, (Twain 4), highlights another
person with a lack of education, but this person has more intelligence or at least more
awareness than the people Smiley usually tricks, which will eventually make it harder
for Smiley to deceive him; thus, being unable to deceive him means

US Support for the State of Israel Essay
**It is perfectly acceptable to criticize Israel s policies. Israelis do it all the time in
blistering debates, but criticism turns into classic anti Semitism, according to Stand
with Us and Christians United for Israel in the magazine Israel 101, when it exhibits
the Three Ds of anti Semitism Delegitimization, Double Standards, and
Demonization. Delegitimization: The Jewish State has no right to exist. Israelis do
not belong in the Middle East. Double Standards: Israelis condemned harshly for self
defense measures and social problems that are seen as acceptable or inevitable in
other nations. Demonization: Through distortions and lies, Israel is depicted as the
world s most evil and dangerous country, and the claim is made that if the... Show
more content on Helpwriting.net ...
The final verdict of the movement was that Israel was no longer repudiated by
God, rather, they were still blessed by and special to God. This new view of Israel
caused for the church to join together and form a political lobbying group
representing the fundamental values of Christians called the Moral Majority in the
late 1970 s explains Daniel Friedman in Christian Zionism and its Impact on Foreign
Policy. One belief that became a core issue for the Moral Majority was the State of
Israel. Even though the Moral Majority had to close down, they were the pioneers to
the creating of Christian Zionist groups today with the same core ideology.
Currently, there are multiple organizations that Support the State of Israel. Most are
Christian organizations or have biblical roots. First there Christians United For
Israel commonly referred to as CUFI. The purpose of CUFI is to provide a national
association through which every pro Israel church, organization, ministry or
individual in America can speak and act with one voice in support of Israel in matters
related to Biblical issues (CUFI). Then there is AIPAC, American Israeli Public
Affairs Committee. The mission of AIPAC is to strengthen, protect and promote the
U.S. Israel relationship in ways that enhance the security of Israel and the United
States (AIPAC). Stand With Us mission is support Israel around the world
(Standwithus.com). The International Fellowship of Christians and Jews mission is to
promote

Identity In Sandra Cisneros s The House On Mango Street
The House On Mango Street
Though Sandra Cisneros The House on Mango Street brings up several aspects of
young Esperanza s internal conflict, her discovering what comprises her identity is
the most prominent point throughout the story. While the reader watches a young
girl grow up, they also watch her question all of her observations that shape her
perception of herself. As she deals with life s harsh reality in her low income
neighborhood, the hardships she faces make her question who she really is, and what
defines her.
One of the reasons that it can be complicated for Esperanza to find out who she is, is
that gender roles are being forced upon her future constantly. From her own family, to
her friends abusive fathers, she is shown that her culture ...[doesn t] like their
women strong (Cisneros 10). In the Vignette titled My Name , Esperanza explains
the struggles that she has with the personal meaning she has put behind it. She
explains how her grandma was like her, a wild horse of a woman (Cisneros 11) and
that she was forced into a sad married life. This causes confusion with her identity,
because she doesn t want to inherit her [grandmother s lonely] place by the window.
(Cisneros 11) However, she does want to be her own, strong self. Esperanza learning
how this influences her identity as the book continues will teach her to ignore gender
roles and pay attention to what she feels is most important to her.
Another way that Esperanza has trouble with her identity is the fact that she
ascotiates living on Mango Street directly with who she is. Throughout the book,
she struggles with her house not being a home to her, and that it isn t the place she
thought it would be. When she says that she needs a house she can point to. But
this isn t it. (Cisneros 5) in the first vignette House on Mango Street , you can feel
her embarrasment in the where she lives. Esperanza is the type of person who feels
as if certain items reflect who you are. For example, when the reader hears about her
expectations of a house with three washrooms...[with] trees around it, a great big
yard and grass growing without a fence. (Cisneros 4), she later explains how she is
ashamed of her current living situation compared to

Speech Persuasive Speech Comparison
Speech Comparison #2 Ted Talks is a treasure trove of information, capable of
providing anyone with a mountain of information on whatever might interest them.
It is different to many other sources in regards to how that information is given out,
this being the way most all their videos are of people giving speeches. Given the
vast collection of speeches on the site, we can find many a great performances where
it is obvious that the speaker had a great effect on the audienceand also where the
audience wasn t very much influenced. On the topic of aging and general health,
there were two speeches by Aubrey de Greys and Dan Buettner, and we will be
comparing these two speeches together No great speech can be created without a
good hook. Unfortunately, it seems like neither of them really created a great hook.
They failed to really capture the attentionof the audience and reel them in. Both
introductions had weak hooks, but they made it so that you at least knew what the
speakers were going to talk about and what direction they re going to take with
their speeches. Despite both intros being weak, Aubrey de Grey s introduction was
clearly weaker. Grey did not have any hook whatsoever. Instead, he told the
audience that he was strapped for time and that he would need to dive in right
ahead. Buettner on the other hand, at least tried to create a hook by starting off
with a fact that not many people would know. It was weak, but better than nothing.
The hook is out of the way and next is fluidity for the introduction. Bueller makes it
easy for the audience to follow along with what he s saying. His use of transitive
words guides the audience and it makes it easy to follow along. This along with his
pleasant tone and flow makes it easy to pay attention. A stark contrast to Grey s
speech. Grey at times became quite hard to follow due to his near monotonal voice
and the speed at which he spoke. It was hard to follow what he was saying and
often times I ended up lost, missing quite a bit of the information that he was
giving out. At one point, I even checked that I had not accidentally changed the
video s speed because of how fast it was going. This combined with the lack of any
real hook, made it very hard to pay

Los Angeles Is Singing Analysis
In a state so vast and diverse like California, you are going to encounter people with
very eclectic music taste simply because Californians are exposed to a diverse
range of music. In a state that has homed the likes of pop, heavy metal, rock, ska,
alternative, hip hop, and gangster rap, it is very easily for someone to feel at home
in this state, or as Josh Kun puts it in Los Angelesis Singing , songs can orient us to
where we are, ground us in a sense of home... (LAtitudes, 182). Kun goes onto state
They are locators, but they are also bridges, sparks, and launch pads... songs are
handshakes and encounters, dances with strangers... (LAtitudes, 183). I would agree
with Josh Kun because I feel like musicaccomplishes two things; it makes us
reminisce and relate and it also allows us to enter or imagine... Show more content on
Helpwriting.net ...
Vin Scully not only transcribed the game of baseball beautifully but he also had a
knack of putting us into the game. As Kevin Bacon put it in his speech We couldn
t be Kirk (Gibson) and we couldn t be Sandy (Koufax) but somehow you found a
way to put us all in the batter s box, to put us all on the mound. It was something
about Vin Scully s selfishness, about his kindness, about the warmth in his voice
that he somehow managed to bring a city that covered a vast area, of many
languages, of many cultures all together through a game. Kevin Bacon finishes his
emotionally speech with the following, We will miss you, my friend. We will miss
you in our radio, in our cars, in our backyard. You ve been a gift to Los Angeles and
to baseball itself. It seems forever that you ve been guiding us through your personal
window into the game... You leave us and the game, Mr. Scully, but not without
leaving a lasting impression, and not without taking a piece of our broken baseball
heart. The soundtrack of Los Angeles since 1958 can now ride off onto the sunset
knowing he made a lasting impression on millions of Angelinos and generations of
Los Angeles Dodgers

Genetic Dna And Bioinformatics ( Accession No. Xp Essay
RESULTS
Isolation of BbovM17LAP gene
The BbM17LAP gene available in GenBank (accession no.
XP_001609968) was accessed through the National Center for
Biotechnology Information (NCBI), and its sequence was retrieved for further
analysis. The genomic DNA of BbM17LAP was found in chromosome 2, extending
between 1,045,409 bp and
1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding
BbM17LAP consists of 1,578 bp. Alignment of the mRNA sequence with genomic
DNA using Genetyx revealed that the gene has 4 introns within its ORF. The first one
was a 33 bp intron (50 ggtatgtttgtttgaatactgctgaatctgtgta 30) situated near the 50 end of
the gene. The other nucleotide sequences included a
35 bp (50 agatacttacagtaacgatacaagttcatgtaggt 30) intron, a 34 bp
(50 tgggttacactctttatgctatatttgttatagg 30) intron, and a 40 bp (50
gtaagttaattgggctacaagaagcgtaatatacatacag 30) intron all located close to each other
near the 30 end.
Isolation of BbovM17LAP cDNA and bioinformatics analysis
A pair of primers targeting the ORF of BbM17LAP was used to amplify and
sequence the gene from a B. bovis cDNA expression library. This BbM17LAP cDNA
encoded a predicted
55 kDa protein without a signal peptide. The translated
BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP,
having 71% amino acid identity and similarity
(E valueВј0). The other significant homologues included Theileria parva and
Theileria annulata M17 LAPs, both having 61% amino acid identities. The
polypeptide

Comparing Checks And Balances Of The Executive And A
Prime...
President is elected by the voters, while the head of state in a parliament generally
Prime Minister is elected by the legislature. The difference seems small, but it ends
up making a world of difference. The US prides itself on separation of powers the
legislature makes the laws, and the executive executes them. They provide checks
and balances on each other, ensuring that neither one gets too powerful. Either one
can work, though. There are many countries with parliaments, and the executive
doesn t run away with power. The parliament itself is still subject to the checks of
the voters: voters unhappy with the performance of the executive will take it out on
the executive s party. That even gives an opportunity for a third party to arise, for
voters who don t want to switch to the opposite party. The next executive is chosen in
the parliament based on negotiations between the third party and the two major
parties. That s happening in the UK right now, where the Liberal Democratic party is
in an unlikely coalition with the Conservative party, after voters abandoned an
unpopular Labor Party. The LibDems are still much smaller, but very potent as
kingmakers. (And about to be hammered themselves, next time it comes around.)...
Show more content on Helpwriting.net ...
The split control of the legislature and the executive in the US has led to complete
gridlock, leaving voters unhappy with the executive and livid about the legislature.
There are a million variants to implementing both systems. The executive branch has
many different functions, and you can divide them in different ways. Some countries
have both a President and a Prime Minister, and even a Monarch with some control as

HELLP Syndrome Case Study
t A twenty year old patient came into the doctor at 26 weeks gestation displaying
preeclampsia. The patient was transferred to Sanford where she had the baby two
days later. Following the birth, she developed HELLP syndrome like symptoms.
The reason why as small population of women develop HELLP syndrome is largely
unknown, but us believed to be caused by abnormal vascular development or genetic
variation. HELLP syndrome has also been known to be confused with acute fatty liver
of pregnancy (AFLP) or thrombotic thrombocytopenic purpura due to their
symptomology being similar. There are short term treatments for HELLP syndrome,
but only true treatment is to give birth to the child. Currently there is no preventative
measures except to not get pregnant.
Introduction
The following case study analyzes a female patient ... Show more content on
Helpwriting.net ...
Alterations in the TLR 4 gene are common in preeclampsia patients and even more
with those with HELLP syndrome, leading an autoimmune related disorder and sever
hypertensive disorder during pregnancy. The hypertensioncan lead to liver damage
and proteinuria.7,8
The vascular endothelial growth factor genes are responsible for endothelial cell
proliferation, promoting cell migration, inhibiting apoptosis and induces
permeabilization of blood vessels prompting permeabilization of blood vessels. The
over formation of blood vessels such as in the placenta of HELLP syndrome patients,
could lead to hypertension and possibly liver issues.9
The FAS gene is responsible for the regulation of programmed cell death or
apoptosis. A single nucleotide substitution of the FAS gene has been associated with
an increased risk of developing HELLP syndrome. This is most likely due to the
stress from the pregnancy causing an over production of this gene in the liver
causing liver cell necrosis, increasing the liver

Case Study Of David s Escape
David was forced into a difficult situation after acknowledging Sally s and Kathrine
s imprisonment by the Waknuk community. Two options remained: risking
everything by running away for a chance of freedom, or staying silent and waiting
until the citizens of Waknut realize the group s secret. David, who sincerely loves
his sister, Petra, realizes if she is discovered the outcome would be austere. When
Michael proposed the strategy of escape and the consequences of being caught that s
when David recognises the danger of Petra. He agrees with Michael s plans and
protects Rosalind and Petra on their journey to the Fringes no matter what the cost.
David, from a young age, has understood the injustice of the society of Waknuk. Deep
down he

A Report On Flight Service
The courteous and attentive in flight service determines if every passenger has a
sound experience while they are traveling by airplane. In fact, the in flight service is
made more complicated by four principal components following: the safety of
aircraft, excellent facilities, an entertainment system and dining service. The dining
service will be the only object of the analysis to avoid confusion. People tend to
dislike airlinefood because of its terrible taste, though it was the highlight of the air
travel in the past. Meanwhile, it is a fascinating object to study because it has no
need of the large economies of scale, but it has many barriers to entry on account of
the very high standards for the chef. As a kind of by product of the airline industry,
although launching a new business in the market of the airline mealis risky, it would
be worth taking a gamble in the short run. The appropriate examples in the market of
the airline mealcan be used to define the product and the market in turn. In the
process, people can have a very clear notion of market of the airline meal and form
their opinion on the question that if a new company should enter the market. The
product of the in flight dining, the meals served by the crew, is a diversified private
good. A private product in economics is defined to be the excludable and rivalrous
good. The meal is a kind of private good because the meal is rival, in other words, the
food eaten by a person cannot be shared to and

Athlete s Warehouse Paper
The abbreviation, SWOT, stands for strength, weakness, opportunities, and threats
respectively. In this paper, I will utilize and explain how the SWOT analysis will
apply to an organization identified as Athlete s Warehouse. This paper will identify
three examples of SWOT that are evident for Athlete s Warehouse and aid in forming
an overall conclusion of the department using both internal and external analysis
tools. The following are some strengths that the company demonstrates. Firstly, Colin
and Ed, make a great managementteam where the work is well divided and fair.
Colin ensures that operations goals are met while Ed runs the store day today. The
company is run very well. In addition, Colin and Ed offer expert advice to
customers when people inquire about the products. This is because both Colin and
Ed are well educated in the sports/athletic field with Colin even having a Ph.D. in
physical education. This builds rapport and trust with their clients so that the store
may be visited more frequently as well as word of mouth advertising. Lastly, the
brothers have great supplier contacts that will provide them with good quality goods.
Firstly, Colin and Ed, are having financial difficulty in terms of acquiring a good
location. There are torn between the location at the mall and downtown where the
cost is very different and mostly out of reach for the brothers. Furthermore, they are
not able to sign with top sportswear companies like Nike due to monetary issues
and lose to competitors who can provide those goods. Lastly, Colin and Ed are
having trust issues with each other and aren t on the same page as far as conducting
business goes. This weakness can make the venture quite unstable and more likely to
fall

The End Of The Cold War Between The United States And...
The end of the Cold War between the United States and Soviet Unions was a start for
a new Western order. Many expected that it would be peaceful, free trade and
expanding markets and cooperation among states (Hawthorn, 1999). However, some
scholars might argue that neoliberalism preserved the dominance of wealthy states. A
variety of different arguments have been raised taking into consideration democracy
and international order. This essay will consider three different theoretical
perspectives on the topic through summarising the key points and analysing the
strengths and weaknesses of these perspectives. Firstly, American hegemonywill be
considered, secondly, civic identity of the Western political order will be discussed
and finally, economic openness liberal order will be taken into account.
One of the major realist dimensions for the Western political order is American
hegemony. With the end of the Cold War
, American hegemony appeared to be the
supreme power of the world (Deudney and Ikenberry, 1999). It can be seen, American
economic power revealed in international financial institutions such as IMF, WB and
WTO. As a dominant member in WTO, the United StatesForced the weaker states to
accept the organization s rules on international trade, otherwise, they will lose if they
choose not to follow the rules (Hawthorn, 1999). In addition, Deudney and Ikenberry
(1999) state that liberals see transnational relations as the establishment of alternative
system that will

A Good Man Is Hard To Find Essay examples
Flannery O Connor s short story collection A Good Man is Hard to Find has many
elements of a southern gothic work. Images of ancient castles with sliding panels
create suspicious themes and settings that lead the readers into the dark and gloomy
world of the southern United States. With all of the violence, horror, and dismal
surroundingspresented in O Connors stories there is too a moral messagegiven. Later
gothic work did not always explain horror like this, holding little moral value to
contrast their grotesque images (notes, November 1). O Connor s stories do include
a strong moral element, frequently in the form of religious explanations. The
characters within A Good Man is Hard to Find are usually... Show more content on
Helpwriting.net ...
If Sammy is not a good man is he evil? Could he represent Satan, Red Sammy is a
fitting parallel name. Sammy then states that quot;a good man is hard to find. quot;
Could this be forewarning to the grandmother s confused values of what is right or
wrong (good or bad)?
Soon the family is on their way again but the grandmother forces her way by using
the children. Getting the kids exited enough to annoy their father so much that he
breaks down and changes the route and seeks out the old gothic house. We soon
learn that the grandmother has made a geographical mistake thinking Georgia for
Tennessee. Her ignorance starts a chain of events which will result in all their
deaths: Brining the cat along even though she knew it wold not be allowed, forcing
her will even when unsure if it was right (O Connor, 2, 11). The grandmother s
uncertainty of geography could be read as mirroring her spiritual uncertainty.
After the car crashes we see that the grandmother is self serving. She uses gender
roles ( quot;you wouldn t shoot a woman quot;) and religious images to try and
save herself and to make the Misfit to look well upon her (O Connor, 14 19). This
plea seems very self serving. Why not ask quot;you wouldn t shoot a family, would
you? quot; The argument of religion as a reason to be good is rejected by the Misfit
(O Connor, 21). By dismissing Christ s history the Misfit also rejects the
grandmother s self serving values.

Disney s Employment Of Various Master Narratives And
Its...
The Walt Disney Company franchise has had a large amount of influence in the
culture of the United States through the widespread distribution of Disney products
and image. The power of popular media has even more so made Disney characters,
and Walt Disney himself, important and easily recognizable cultural icons for a
large majority of Americans. Henry Giroux (2002) described that in today s world,
media has increasingly become a primary agent of communication and education for
children (p. 100). As powerful socializing agents, Disney films have come to occupy
an important role in the discourses found in the culture of the United States. Since the
target audience for Disney is essentially the youth of the nation, a vast majority of
children are introduced to a great number of ideas representing culture, race, gender,
politics, societal norms, and even the criminal justice system in North America
through their narratives. This essay will attempt to illustrate how Disney s
employment of various master narratives and its way of representing crimes and
criminals in films have impacted social conceptions of criminality within American
society.
Representation is an essential part of the process by which meaning is produced and
exchanged between members of a culture. It does involve the use of language, of
signs and images which stand for or represent things (Hall 2013). Moscovici, one of
the founders of the social representations theory explained that, Our reactions to

The Hunger Games And It s The One I Just Finished
Reading
The best book series in the world finally exist. It s called the Hunger Games. Even
people who hate reading love it since it is that good of a book. The first book in this
series is called the Hunger Games and it s the one I just finished reading. This book
gives society a twist, and changes the way people think because finally, for once in a
story, the female lead character is the one who can fight better. I m sick of all those
stories where they portray women as weak and need a man to save them. I hatestories
like that and hungergames is finally a story in which the woman is the one saving the
man. I would recommend this book to anyone and I think that even if you hate books
in general you should read this book sometime in your... Show more content on
Helpwriting.net ...
Her worlds flow smooth into your head and never confuse you. Even amazing
books like Divergent confused me before when the writer was talking about how
she s in a glass box but then suddenly the main character feels concrete around her.
That was so confusing and I never remember once being confused like that in this
book nor do I remember any grammar mistakes. Now let s start with the ending
since I just can t stop thinking about it. It was such a relief that Katniss Everdeen
won the hunger games along with Peeta. I remember when Rue told Katniss, You
have to win, and finally she did win. It was a little scary at the end however since
there was a chance Cato would win. But luckily Katniss and Peeta were fighting
together on the same side and were powerful enough to defeat him. After Cato fell
off the cornucopia and into the mutts I feel bad for Katniss and Peeta for having to
listen to his screams. They had to listen to his screams for so long in the cold. In
the hunger games it gets really cold at night so could you imagine such a night to
sleep in. You are in the dark and extremely cold on top of a cornucopia and the
whole night you have to listen to the screams of someone being slowly ate by
Capitol engineered mutts. Also you know that if you fall down from the cornucopia
you will die a painful death and scream just like the Cato who is slowly dying.
Katniss is an amazing person because she was generous enough to

Smelly Wolf Research Paper
Once there was a smelly wolf that smelled like socks. He was a nice wolf but
people thought he was mean like these people Hansel and Gretel, Red Riding
Hood, Humpty Dumpty, Beauty and the Beast, Cinderella, the Princess and the
Frog, Harry Potter, Sherk, Peter Pan, Smurfs, Tinker Bell, the Little Mermaid, the 3
Blind Mice, Aladdin, the Wizard of Oz, Tangled, Snow White, Frankenstein,Hello
Kitty,Barbie, Ken,3 Musketeers, Dora the Explorer, Go Diego Go, my Little Pony,
Elmo,Cookie Monster, The Flintstones, The Little Red Hen, Chicken Little, Dumbo,
Puss In Boot, Percy Jackson, Spongebob, The Ugly Duckling. So the king invited
him for dinner so he had to get ready so he went to dinner the king ask him , What
do you do. And the wolf said he

Essay On Pay Raise
Are you ready to request for a salary increase? It might well be that you are due one
in the UK, the national salary surveys from the CIPD reveal how only 58% of public
sector companies gave pay rises to employees in 2016, when before the financial
crisis the figure stood at 73%.
Since purse strings have been tightened in many organisations across the globe, you
need to know how and when to seek a raise. In this guide, you ll receive four of the
most important salary increase tips to arm yourself with:
How having a realistic sum in mind can help your request succeed.
How you need to build a strong case of added value before you pop the question.
Why timing your request right can make or break your chances of a raise.
How ... Show more content on Helpwriting.net ...
This doesn t mean selling yourself short but if you want a raise, you have to be able to
justify why you are worth it. If you can show on paper why your boss should pay
you $1 million, then go ahead and do it. But if you can t, you want to ask for a raise
that s closer to the value you add to the company.
So, how can you pick a realistic figure? How do you ensure you aren t asking for
something unattainable while also ensuring you aren t asking for too little? Before
you walk into the negotiating room, you need to conduct research.
To determine what you should earn, you should take the following steps:
List your current tasks and responsibilities. Look at your job contract and write down
the tasks and responsibilities you are required to do under your current contract.
Underneath, list the tasks and responsibilities you are doing that are not part of your
current job description the additional value you add to the company.
Research the industry and role averages. Examine what industry averages are and
what people in your position earn on average. You can find salary information on
websites such as salary.com, totaljobs.com and glassdoor.com. Focus your search on
similar job titles, educational background, industry and geographical location.
These two should give you a better idea on how much additional value you are
adding to the company, as well as what people doing similar tasks are earning. If you
find that you re already being

Narrative Report On A Christmas Carol
On Saturday, December 2, 2017, I attended A Christmas Carol: The Musical, a
production featured in the Amaturo Theater at Broward Center for the Performing
Arts. A Christmas Carol is about an elder man, Ebenezer Scrooge, who despises
Christmas. Scrooge is a wealthy man infatuated with the idea of money, which makes
him a very stingy, greedy, selfish, and egotistic human being. Working as a banker,
Scrooge has an employee named Bob Cratchit, who works long hours, for very little
pay. On Christmaseve, Cratchit gives hints for a raise or a bonus, and instead of
giving it to him, Scrooge goes on a rant about how Christmas is not a real holiday
and it is just an excuse for people to try to get extra money. Through his entire
speech, he keeps saying Bah Humbug . In the end of the speech, he asks Cratchit
tauntingly, I suppose you want Christmas off as well ?, but eventually, he gives
Cratchit the day off. In addition to this, Scrooge has a housekeeper named Mrs.
Dilber. Dibler has worked for Scrooge for a long time, and not once has he raised
her pay or given her a bonus. Just like Cratchit, Dilber hints for a Christmas bonus
by holding out her hand in front of Scrooge. However, instead of taking the hint,
Scrooge cannot see past his own selfish ways and hands her his dirty clothes stating,
Have them clean for tomorrow . With that, Dilber storms out his house infuriated. By
withholding a Christmas bonus from his employees, Scrooge is taking away from
their Christmas

History of Stonehenge Essay
History of Stonehenge
On May 20, 1996, TIME magazine contained an advertisement for the Mita DC
8090 copying machine. It included a vivid image of a very recognizable work of art,
Stonehenge. TIME magazine is a weekly news magazine and its readers are educated
and interested in current events, politics, business, science, and the arts. The text of
the advertisement states, The new Mita DC 8090 has the technology to manage
complicated copying jobs from start to finish it s fully automatic. Sunsets should be
watched, not copiers. The advertisement utilizes the beautiful image as a setting to
make the product look attractive and the text to suggest that the copier will save time
and effort. It also assumes that the reader will ... Show more content on
Helpwriting.net ...
Although the original function of Stonehenge is not known for certain, its orientation
is clearly related to the movement of the sun.
Two obvious differences between the magnificent stone monument itself and the
reproduction on paper are their sizes and media. The heel stone from the original
stands over 20 feet high; the magazine version is confined to a two dimensional
page and the stones are one to two inches high. The woman and the copying machine
are placed in the picture to indicate the great dimensions of the monument, but the
effect is not the same because the massiveness of the stones can only be suggested
in the reproduction. The functions of each work are also different. The original was
probably used as an observatory or a religious site and

Why Is Mattress Important
Why is a Mattress Important? Numerous individuals, when contemplating the
reason for their back agony, don t consider where they invest the most energy each
and every day. The commonplace Briton spends around 6 to 9 hours each and
every day on his bedding. That is what might as well be called around 100 full 24
hour days consistently. Doesn t it bode well that on the off chance that you are
encountering back agony and are searching for the cause, that you ought to hope to
see where you are investing the lion s share of your energy? Low quality sleeping
cushions are the aftereffect of countless issues all over the nation. On the off chance
that you ve ever woken up with a sharp undeniable irritation or back, then you more
likely than not

Adolescent Oral Health Beliefs
Adolescents Oral Health Beliefs
For future oral health professionals, understanding adolescent oral health and oral
health beliefs, is essential when providing healthcare that will contribute to their well
being. I have chosen three articles encompassing adolescents oral health beliefs. After
reading these articles, I have gained more knowledge on adolescents oral health
beliefs. Firstly, adolescents can consider oral health care to be boring or useless.
Secondly, some adolescents demonstrate healthy oral care attitudes and behaviours
and are aware that brushing their teeth is important for avoiding dental problems.
Lastly, all the adolescents considered that good oral health will give them an
attractive appearance as well as a fresh breath.
The article An exploratory qualitative study of Otago adolescents view of oral health
and oral health ... Show more content on Helpwriting.net ...
This study highlighted that adolescents perception, attitude and behaviours toward
oral health conditions are directly related to their oral hygiene behaviours. In
addition, female adolescents tend to have better oral health conditions than male.
Meanwhile, adolescents in this Swedish study also considered that good oral hygiene
behaviour will help them prevent dental problems as well as help them maintain a
good appearance. However the Swedish adolescents in this study with dental
problems, such as gingivitis tended to have less positive attitude toward the oral
health.
Those three articles have provided me with a good learning experience on
adolescents oral health beliefs. It has helped me understand more fully the importance
of adolescent oral health. What I have learned here will influence my future practice
as an oral health

Professor Bach s Illusions
Professor Bach s illusions and visual phenomena are very amazing, they make me
dizzy, headache and they could trick our eyes. I have been exploring all of the
illusions and they all driving me crazy but I found that Leaning Tower Illusion and
Thompson s Thatcher Illusion are interested to me and I hope you , too. So I decided
to talk about these two illusions.
Leaning Tower Illusions , this Illusionis cool and also weird that the tower on the left
is straight but when I click the button move , the tower in the right is not parallel as
the left one and it lean to the right , then I click again and the right one moves back
to the left one and they are identical. Also, when I use the little circle next to the
move to change the angle

Meursault Quote Analysis
Later in the novel, Meursault has an altercation with two Arab men, ultimately
resulting in him having to shoot and kill one of them. Meursault was upset that he
had to resort to taking the man s life but also when he was in the act he did not think
of the repercussions of murdering somebody. Meursault alludes to the sunagain at the
time he was about to shoot the Arab. My forehead was especially hurting me.. (55).
Meursault does not dwell on the past nor does he worry about the future, he always
lives in the present and in turn, was ultimately the reason he murder the Arab man.
She lay down right next to me and the combined warmth of her and the sun made me
doze off. (51). This quote refers to the fact he found comfort after the murder from the
sun. Meursault used the sun to cope with the stress from him murdering the Arab
man and referenced it many prior and after the murder.... Show more content on
Helpwriting.net ...
During the course of the trial Meursault seemed very emotionless, like he was at his
mother s funeral which was used against him while on trial. Meursault hardly payed
attention to what was happening during the trial and was spacing and did not help
his case at all. Meursault no longer finds comfort in the sun, it gives him nothing but
anxiety and fear. As the sun gets hotter, things get worse . (82). Meursault keeps
staring at the sun and it hurts him now instead of bringing him serenity. The sun no
longer provides any benefit for Meursault ever since he refered to it when he was
about to murder the Arab

Using Vlan And Vpn Network ( Virtual Local Area Network
)
Introduction: The devices on one or more LANs can be configured to communicate
as though they were directed connect referred to as VLAN (Virtual Local Area
Network). They are located various geographical areas. Since VLANs are taking into
account intelligent rather than physical connections, they have a great degree
flexible. VLANs characterize broadcast domains in a Layer 2 network, in which the
broadcast domainis the arrangement of all devices that will get broadcast frames
which originates from any device inside of the set. Broadcast domains at time have
limitations by routers that don t forward broadcast frames. Layer 2 switches
broadcast domains regardless of the setup of the switches. Switches permit one to
make numerous broadcast domains. Every broadcast domain is similar to a
particular virtual bridge inside of a switch. [1]
VLAN VPN highlight is a basic yet flexible Layer 2 and it labels private network
packets with external VLAN labels allowing the data to be transmitted both inward
and external VLAN labels. Implementation of VLAN and VPN Access: the VLAN
VPN allows packet with a VLAN tag, the device will label the packet with the
default VLAN tag of the receiving port and add the source MAC location to the
MAC location table of the default VLAN. If the packet transports a VLAN tag, the
packet turns into a double labeled packet. Then the packet turns into a bundle
conveying the default VLAN tag of the port. [2]
Requirement for Multiple VLANs: The various

Essay on 602.3.5-01 ETT4 Task 1
Content Structuring
One of the qualities that a good teacher should possess is to help and ensure that our
students develop skills that will last a lifetime. One way we can do this is to help
students develop good organization and note taking skills. Using graphic organizers
is an easy and effective way to deliver information and demonstrate new techniques to
students. Graphic organizers are also great tools that help students focus on what they
are learning and also aid in learning the information.
Because there are so many different types of organizers and a variety of uses for
them, the way each are introduced is crucial. The proper introduction will ensure that
the students will be able to identify, organize, and integrate key... Show more content
on Helpwriting.net ...
Also, when using a Venn diagram, we don t have to use complete sentences because
there is not a lot of room, so we will just write a word or two.
What can we say about the candy bar? (Student responses are written on one side of
the diagram) Alright, good. Now what can we say about the granola bar? (Student
responses are written on the other side of the diagram) Good job everyone! So what
do these two things have in common? This is what we will be writing in the middle
part of the Venn diagram.
(Students discuss similarities, and I write their responses in the middle of the
diagram.)
Awesome work everyone! I think you guys are getting the hang of it.
Ok class, now we are going to be comparing the main characters from two different
books. I am going to read you a story and I want you to listen to the story because we
will be discussing it afterwards. (I read the story aloud.)
Alright, so tell me some things about the main character, and I will write them in the
diagram. (Students give me multiple different facts about the character) Great job
everyone!
Now I have a small challenge for you. I have printed out a Venn diagram for all of
you to fill out using the information we gathered from the first story, and also from a
second book that I will read aloud, but this time you will be working in small
cooperative groups to finish filling out the
Venn

Hofstede s Four Cultural Differences
1.Using Hofstede s four cultural dimensions as a point of reference, what are some of
the main cultural differences between the United States and France?
When referencing Hofstede s four cultural dimensions it is apparent that the United
States and France have different perceptions of one another. The United Statesviews
the French as arrogant, flamboyant, hierarchical, and emotional. Whereas, France
views the United States as naive, aggressive, unprincipled, and it s people being
workaholics. (Doh and Luthans, 2015)
The first main cultural difference would be power distance. The power distance
dimension indicates the point at which the less powerful members of organizations
and institutions accept and expect that power is distributed ... Show more content on
Helpwriting.net ...
The French would rather have well structured management with rules and regulations
in place rather than take risks that may not have a positive outcome. Whereas,
Americans are the complete opposite, meaning that they are more willing to take
risks and are less traditional when it comes to rules and regulations.
The third cultural difference is masculinity. Masculinity is defined by Hofstede as a
trait, which emphasizes ambition, acquisition of wealth and differentiated gender
roles. (Tidwell, n.d) A society that is focused on money and success is said to be
high in masculinity. The United States is an example of an area that is high in this
dimension. For example, when the Disney company decided on opening a park in
France they didn t even take into consideration how the French would react or what
type of impact this could have on the their culture. Being that they have the masculine
characteristics they were more concerned about wanting to prevail on others.
The fourth cultural difference is individualism. According to Hofstede individualism
is defined as the tendency of the people to mainly look after themselves and their
immediate family. (ClearlyCultural, n.d) In the United States and France
individualism is pretty high. However, individualism is slightly higher in the United
States being that they are more likely to

Christopher Innes The Historical Avant-Garde
The Historical Avant Garde expressed new ways of art and reformed the traditional
sense of art. Christopher Innes used three words that described the Avant Garde:
populism, primitivism, and philosophy. These components can be seen in the figures
1 3 that help define some known movements of the Avant Garde. The movements that
are particularly focused in these figures is Dada, Expressionism, and Surrealism. Each
image displays an aesthetic characteristic of the Avant Garde, as well as defining
what the movements stood for. In addition, the visual imagery of these figures
illustrates a new method of art, in attempt to create a better art. To begin, the Avant
Garde opposed the bourgeoisie theatre, and many of the elements used was to contrast
Primitivism held a contrast to western forms, and one of the non western forms that
was seen was spirituality. Not only this but in Murder: The Women s Hope, the
characters are dressed in savage appearance, which is not usually the typical attire in
a traditional bourgeoisie play (Kokoschka 220). This can also be seen in Figure 3,
and it would explain why the women s breasts are exposed and why the man is not
wearing a shirt as well. This perspective is one of the elements of the Avant Garde, as
it is something considered new as well as going against the anti establishment of the
traditional theatre. Furthermore, the Avant Garde opposed mainstream theatre, and
many of the Avant Garde movements went against theatre. This was done by having
using more interaction with their audience, creating cultural changes, and holding
more physical

Henry Weeks Sanderson, And Edward Hunter
This is a true story of two men. And while not able to contain their whole lives in a
few small pages, much of their story will be told. The names of these two men are
Henry Weeks Sanderson, and Edward Hunter. Sanderson: a previous member of the
Mormon Battalion and mayor of Fairview, Utah. Edward Hunter: the third presiding
Bishop of The Church of Jesus Christ of Latter Day Saints and body guard to the
LDS Prophet Joseph Smith. These are only some of the major accomplishments and
personas linked to the listed men. These two people have changed my history, and the
history of countless others. Henry is my fourth Great Grandfather and Edward (while
significantly more distant a relative) is my fourth Cousin nine times removed. There
is much... Show more content on Helpwriting.net ...
During one of my rambles I went into the pasture, I presume to have a nearer view
of the horses or perhaps to give them a fright to see them run. But a large stallion
observing me, and no doubt thinking me an intruder, took after me with open
mouth and I barely sufficient time to make my exit through a hole in the fence
(familysearch.org stories). As is easy to see through this writing, Henry was a
vivid journalist, and He kept a highly detailed journey of his many life events
(familypedia.wikia.com). Another easily pictured experience is shared by
Sanderson. During his childhood, at the age when I first began my rambles, there
was a small dog that was my companion and upon one occasion when we were out
together I seemed to have had occasion to crawl through a pole fence, and in doing
so the pole above me was dislodged and falling upon me, pinned me fast, and I
could neither retreat nor advance. The dog seemed to have the sagacity to see that I
was in perilous condition and needed assistance. It therefore went to the house and
my it s antics attracted the attention of my mother who came to my relief
(familysearch.org stories). Stories similar to these are very common for the time that
Henry was around, but his colorful descriptions make the accounts much more lifelike
and entertaining. Although much of Henry s life may have contained several typical
experiences, several factors of it make it remarkably different from other children
growing up in the

Against Universal Health Care
Universal health care is a program where every one in the country has medical
coverage for surgery, illness, and treatments that would cause problems with your
health. The United States is currently the only industrialized country that has no
universal health care. Universal health care is a controversial topic because people
don t know if they want it here in the United States. Some reasons why people might
want it is because it gives everyone coverage as long as you are a citizen of that
country. A reason why you would not want a universal system is because the
coverage you get may not cover certain operations. Although universal health care
may sound appealing, it actually has flaws. Universal Health Care should not be
considered in the... Show more content on Helpwriting.net ...
Every patients main concern when going to a hospital is to get a surgery to fix a
problem that they have, or to receive prescriptions for illnesses and diseases. But a
factor most probably are not worried about when they go to a hospital is how they
are being treated. Doctors already have a difficult task to perform, but overcrowding
the hospitals will cause them to be busy and possibly conduct their job with out the
amount of care that is required. Giving out prescriptions in a hospital could also be
effected. Patients vital medicine could be mixed up with someone else s and cause
even more harm. The wait time in a hospital for an operation is also effected by
over population. In the United States there is already about a 2 hour wait time in
each hospital that you go to (Mortal Peril). Adding a universal health care system
would only cause that time to increase. There are some cases where the operation
cannot be delayed because of excessive bleeding or a lady about to give birth. Both
of these examples need to be treated within a certain amount of time or the patient
could possibly die. The graph below shows how other countries wait times with a
universal healthcare system compare to the United

Ray Bradbury s Short Story The Pedestrian
Ray Bradbury the author of the short story The Pedestrian purpose behind writing
this unique story, was to show his audience the threat of technology and how in the
future it may potentially take over our lives completely. In a city of 3 million
people the crime rates have plummeted so dramatically that there is only one police
car left. The author paints a picture of empty streets, dreary houses and dark
windows with people stuck inside all night glued to their T.V screens. It was not
unequal to walking through a graveyard for only the faintest glimmers of firefly light
appeared in the flickers behind the windows. People have become so addicted to TVs
that they don t emerge from their homes during the night, due to this the crime
problems

Essay On Invasive Species
This project is a partnership between the University of Oregon s Environmental
Leadership Program and the management at Newberry National Volcanic
Monument (NNVM) in the Deschutes National Forest. Our team, a group of 11
undergraduate students, collected data on invasive species at NNVM in
September and October of 2017. Our survey routes were based on a map produced
by the United States Forest Service (USFS) that outlined the previously recorded
locations of invasive species at NNVM. The USFS map was a composite of several
data sources and was the best available information prior to our survey. Our team
used this map to evaluate previously recorded populations and to look for new or
unknown populations. Our evaluations included updating... Show more content on
Helpwriting.net ...
This high elevation caldera is home to a range of wetland and forest habitats which
host diverse flora and fauna. Today, NNVM is a popular destination for hikers,
campers, and boaters; unfortunately, humans are key vessels for the dispersal of
seeds and plant matter. Because East and Paulina Lakes are heavily trafficked by
foot and boat, these areas particularly vulnerable to the introduction and
dissemination of invasive species. Further, the shores of both lakes receive full
sunlight and have poorly drained soil, providing prime habitat for invasives to
thrive. A section of land on the west side of East Lake, just north of the obsidian
flow, is privately owned and has not been maintained by the USFS uniformly with
the rest of the NNVM. Our team was graciously given permission by the land
owners to survey the properties. and found large populations of common mullein
and canada thistle, as well as smaller populations of bull thistle and reed
canarygrass. These findings pose a unique management predicament, because the
populations found on private land will most likely seed out to other areas of NNVM
if not managed. Because of the significance of these populations and their location of
private land, our team suggests a partnership between the USFS and the private
landowners. Introduction Our team recorded data on six invasive species at NNVM:
dalmatian toadflax (Linaria dalmatica), reed canarygrass

Why Is Nina Dobrev A Good Role Model
Everyone has a different role model for their own different reasons. Sometimes it s
just because of what they do and their films, and other times it s because of their
great personality and loving nature. Overall, everyone has a specific person they
look up to whether it s a celebrity or their mother. Nina Dobrev, one of many
actresses, stands out amongst the crowd for me. She is kind and compassionate
and always modest and humble. Through hard work, patience, and persistence,
Nina Dobrev has become a successful actress as well as an amazing role model.
Nina Dobrev s childhood held many amazing memories for her. Born on January 9,
1989 in Sofia, Bulgaria; her full name was Nikolina Constantinova Dobreva, but Nina
Dobrev for short. When Nina... Show more content on Helpwriting.net ...
For one, she supports many charities like communities in schools,
DonorsChoose.org, Elton John AIDS Foundation, Free The Children, Motion
Picture and Television Fund Foundation, Rape Foundation, and many more (Look
To The Stars). My parents gave us chores and wanted us to work for everything.
We never got anything handed to us. I bought my first car. I learned that if I want
something in life, I have to take the necessary steps and measures to achieve what I
want (141). Nina works hard and never gives up, following what her parents taught
her and what she is teaching to supporters everyday. I ve always wanted to
constantly challenge myself and play different characters in different genres,
whether it s action, drama, romantic, comedy, or a period piece. I ll never take a
part just for a paycheck or to fill time. I want to do projects that I really enjoy (148).
Instead of just doing things she doesn t really what to do, she manages to do what
she lives and she does it so well it inspires young minds to follow her lead, to work
for the things they want. Through hard work and persistence, Nina Dobrev has
become a successful actress and inspiring role model. Her childhood which led to
her acting shows young girls to work for what they want. All her films and
television shows are the outcome of that persistence and hard work. Nina Dobrev
may have what she wants, a great career that she loves with great friends she loves,
but she never stops working and never stops supporting other people and friends.
What makes anyone a good role mode is their story and personality in which Nina
Dobrev has no shortage

Comparison Of Hershey s And Mars Rivalry
The notorious Hershey s and Mars rivalry retains a dominant presence throughout
society. The two men behind the corporations endured and pursued their life
aspirations and goals, arising from harsh backgrounds and founding these empires
out of nothing: Milton Hershey and Frank Mars. While these men may have had
luck on their side, analyzing the history of these men, their tenacity, perseverance,
and tactics have allowed their legacies to flourish, signifying that these men were
exceptionally talented men. Both Hershey and Mars came from broken families
who had fathers who failed on multiple occasions and abandoned them to pursue
their dreams, they both decided to found their empires based on their fathers
failures. However, this allowed both of these men to grow more aware and learn not
to follow the mistakes their fathers made. Mars was able to use his creativity from
his childhood to create a combination candy bar (50), and Hershey who watched his
father through seventeen enterprises, it lent him the power to... Show more content on
Helpwriting.net ...
On both sides, they have gone through the same business experience as their fathers.
Nevertheless, they were more knowledgeable and possessed more determination
which paid off. Hershey endured tags like black sheep because of the similarity to his
dad, which he proved wrong when the caramel business opened. The company grew,
but Hershey s stubbornness compelled him to pursue more significant dreams,
creating Hershey park. Notwithstanding, this dream required extreme patience since
inexpensive milk chocolate had been far fetched. Coincidently, Mars talent with
business permitted him to convert a $45,000 plot of land into a $500,000 showplace
(57). These examples confirm that despite what they encountered, they had already
thought one step ahead and manipulated new ideas that made business boom,
utilizing their talent to their

A Surprise Trip
A Surprise Trip
Observation Essay
It was about 10:30 Saturday morning when I woke up, still feeling bad from the
night before. My boyfriend decided at the last minute to surprise me and four of
our children with a day at the beach the day before. We left with only the clothes on
our backs and bathing suits. It was only after we arrived that we decided to stay the
night. So we got us a room at the Sea Foam motel in Nags Head, NC.
After I was finally able to get up from the bed, I woke the children up to get ready
so we could leave. We all took showers, packed up all our belongings and headed
out. It was well past the check out time before we left, but the housekeeper just
laughed and told us to take our time. We all jumped into the ... Show more content on
Helpwriting.net ...
My boyfriend and I watched as the seagulls flew overhead and the children tossed
them breadcrumbs, ducking their heads every time one would swoop down over
them. Just before we reached the Island, I caught a glimpse of a pod of dolphins
swimming along in the distance. Minutes later we were able to spot the Island, so
we all headed back to our vehicles as we approached Ocaracoke. Once we reached the
dock, we waited in the van until it was our turn to exit.
Once we had departed the ferry, we continued south on Highway 12. We passed
several restaurants and gift shops on our way. There were people walking and
riding bikes along the sides of the road as we drove past. It was not very long
before we had reached the southern tip of the Island, so we turned around on
Highway 12 and started heading back north towards the ferry. Along the way we
decided to stop by one of the gift shops called The Pirates Chest. We all went inside
to look around. The shop was filled with little knick knacks, toys, shells, etc. We let
each of the children pick them out something, paid the cashier and we were on our
way again.
Before we reached the ferry, we made one more stop by The Dipping Dots for some
ice cream. The shop had all sorts of goodies, including cakes, brownies, fudge and
candy. The children walked around the shop while we waited for the cashier to finish
helping another customer. I could tell that they were

Causes Of Change Blindness
Psychologists often study the processes of stimuli through sensation and perception,
and experimental research is tested for those who fail to perceive certain stimuli. Our
perception of the world around us accounts for the method in which we perceive
stimuli or fail to perceive it. Change blindness, inattentional blindness, absolute
threshold, difference threshold, blind spot, and sensorineural hearing loss are often
reasons why we do not recognize stimuli; we become unconscious to it. Change
blindness and inattentional blindness are very closely related because they
correspond to an individual s ability to perceive a change or an obvious and
unexpected stimulus that is in plain sight. Change blindness refers to a perceptual
phenomenon where

Feature Matching
Determining the most beneficial augmentative and alternative communication device
is a critical component in AAC because it takes time and dedication to teach a client
how to use the device as well as teach others around them how to understand.
Hypothetically if a SLP were to provide wasted effort the results could have the
potential to be devastating because in some circumstances all the client has is little
time. Lucky enough for speech language pathologists there are models for assessment
that provide guided intervention tactics. Assessment models can be described as
feature matching, the participation model, and or the universal design for learning.
Typically, feature matching is a quick and easy way to guide assessment because
essentially... Show more content on Helpwriting.net ...
The participation model begins by identifying the participation patterns and
communication needs where the clinician then identifies participation barriers
(Beukelman Mirenda, 2013, p. 108). SLP s are then taught to differentiate between
assessing opportunity barriers and assessing access barriers in the concept that the
working clinician evaluates policy, practice, facilitator skill, facilitator knowledge,
attitude, and current communication (Beukelman Mirenda, 2013, p. 108). The client
s current communication assessment includes a full assessment of their possible
potential to increase natural abilities, an assessment of potential environmental
adaptations, and an assessment of the potential to utilize AAC systems or devices
(Beukelman Mirenda, 2013, p. 108). Once there has been a thorough analysis the
speech language pathologist should plan and implement interventions that will span
across the present and the future with a follow up to determine how effective the
intervention has been in advancing a client s participation (Beukelman Mirenda,
2013, p.

The Natural Environment
How does the natural environment influence culture?
There is a myriad of varying definitions for the word culture. Instead of defining
culture in general terms, it is often defined by how it is related to the environment;
and consequently, how it is affected. Culture provides direction, and reason.
Throughout history, people have remained stalwart and true to their roots and
traditions. However, it has become evident that, with the changing environment, many
traditional practices have had to adapt. Climate change is a key component causing
this adaptation. Through reflecting upon environmental relativism, and cultural
aspects, such as subsistence patterns, economic systems, and religion and world view,
it can be concluded that the natural environment influences culture by causing
environment based traditions to mould to external factors.
Environmental relativism can be defined as follows: the ways in which certain
aspects of the physical environment are relevant to cultures and traditions. It is how
the environment relates to a culture (personal communication, Kathy Rettie,
September 7, 2017). The environment is an ever changing system; it often cannot be
predicted. Climate change, such as warmer winters, rising sea levels, and changes in
precipitation, provide evidence that the individuals affected by the physical
environment must change their way of life to adapt. This is particularly true for
many nomadic cultures, who base their survival off the changing weather

The Great Pyamid of Giza is One of the Seven Wonders of...
The Great Pyramid of Giza is the most famous pyramid(Barrow). It is over 140
meters high and that makes it the largest pyramid in the world(Barrow). Even
though it is massive in size, it only took about 20 years to build(Barrow). People
think this pyramid is famous because, it is very large and was built before the major
advancements in technology. Another reason, why people think the pyramid is
famous is because, it is one of the 7 Wonders of the Ancient World(Great). The Great
Pyramid of Gizais the oldest and the only monument still standing of the 7 Wonders
of the Ancient World(Great). The ways that the Egyptians built the pyramids was
amazing. The history of pyramids is very interesting. The first know pyramid is the
Step Pyramid.... Show more content on Helpwriting.net ...
So, the pyramids were ways to protect the pharaoh s body so that they could live on
in the afterlife(Barrow). The pyramids were built by cutting up large blocks into
smaller more movable blocks. Then they were pushed up ramps and put in there right
spot on the pyramid. There was an estimated 20,000 workers and took about 23 years
just to build The Great Pyramid of Giza(Ancient). The pyramids took so long to build
that when a pharaoh came into power, he started construction on his pyramid right
away(Ancient). The pyramids are built mostly out of limestone(Ancient), because
they had so much of it in that time.
There are about 138 pyramids in Egypt(Ancient). Some are huge and some very
small compared to the Great Pyramid of Giza. It is 480 feet tall and was made out of
about 2.3 million blocks of limestone(Ancient). One thing that is very interesting is
that the bases of the pyramids are perfect squares and they didn t have any of the
machines that we have today(Ancient). Something nobody knows is that In 2006,
Michel Barsoum undertook extensive chemical and x ray analysis of both the
external and internal sections of pyramid stones...Results that some portions
of...pyramids are actually made from concrete...(Logan). Inside the pyramids there is
many things. The most common things to find in a pyramid is the pharaoh and any
treasures or possessions that his family thought he might need in the
afterlife(Barrow)(Ancient). On the walls of the tomb are paintings and

Essay On Social Media

Recommended

Recommended

More Related Content

Similar to Essay On Social Media

Similar to Essay On Social Media (20)

More from Shelly Mcclellan

More from Shelly Mcclellan (20)

Recently uploaded

Recently uploaded (20)

Essay On Social Media