This document describes a novel computational tool called Restriction Site Finder that is developed using Perl programming language. It can calculate the positions in a DNA sequence where a particular restriction enzyme will cut. The tool takes a DNA sequence in FASTA format as input and outputs the complete restriction map. Restriction enzymes recognize and cut DNA at specific nucleotide sequences. They are widely used in molecular cloning and genetic engineering. The tool will help in preparing in silico restriction maps of whole genomes to identify restriction sites before experimental validation.
Fundamental techniques of gene manipulationManigandan s
Restriction enzymes are bacterial enzymes that cut DNA at specific nucleotide sequences. They were discovered in the 1960s and have become important tools in molecular biology. Restriction enzymes recognize short palindromic sequences and make cuts within or near these sequences. There are three main types of restriction enzymes that differ in their subunit structure and cleavage patterns. Restriction enzymes are used in techniques like DNA cloning, Southern blotting, and genome mapping.
DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between DNA fragments, joining two DNA strands together. It plays an important role in DNA replication by joining Okazaki fragments and filling in gaps, as well as in DNA repair and genetic engineering techniques like cloning. The most commonly used DNA ligase is from bacteriophage T4, which utilizes ATP as a cofactor and works efficiently at lower temperatures to ligate DNA strands with either sticky or blunt ends.
1. Nucleases are enzymes that degrade nucleic acids by breaking phosphodiester bonds. Restriction enzymes recognize specific DNA sequences and cleave DNA at or near these sites.
2. Restriction enzymes are classified into three types based on subunit composition, cofactor requirements, target sequence, and cleavage position. Type I enzymes modify and cleave DNA randomly from recognition sites. Type II enzymes recognize palindromic sequences and cleave DNA at these sites. Type III enzymes cleave DNA away from recognition sites.
3. Other nucleases include Bal 31, DNase I, S1-nuclease, and RNase A. Phosphatases and methylases modify nucleic acids and proteins. Ligases join DNA fragments
Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cut specific DNA sequences. TALENs are made by fusing a DNA-binding domain from TALE (transcription activator-like effector) proteins with a DNA cleavage domain from the FokI nuclease. This fusion allows TALENs to be targeted to specific DNA sequences and induce double-stranded breaks, making them useful for genome editing applications.
Gene synthesis involves chemically synthesizing DNA without a template by adding nucleotides one by one. It is the basis of synthetic biology. The key steps in gene synthesis are sequence design, oligo synthesis, gene assembly, sequence verification, and preparing the synthetic DNA. Errors can be introduced at each step, so sequences must be verified before use. Gene synthesis is used widely in research to study biological functions and develop applications like DNA vaccines.
This presentation contains information about restriction enzymes, its nomenclature, restriction digestion, and its application. This also contains information about the chemicals used in restriction and also explains the general procedure of restriction digestion of DNA
This document discusses gene silencing, which is the suppression or interruption of gene expression at the transcriptional or translational level. It regulates gene expression and prevents certain genes from being expressed. There are several types of gene silencing, including transcriptional silencing through genomic imprinting, paramutation, and transposon silencing. Post-transcriptional gene silencing occurs through RNA interference pathways using small interfering RNA, microRNA, Dicer, and RISC complex. Research methods for gene silencing include antisense oligonucleotides, ribozymes, siRNA, and microRNA. Gene silencing has applications in biotechnology and medicine, with advantages such as being cost effective and having high specificity, though it also has disadvantages like potential toxicity.
This document provides information about zinc finger proteins. It begins with an introduction to zinc finger motifs, which are protein structural domains characterized by the coordination of zinc ions. The document then discusses the history of zinc finger discovery, functions, and families. It provides details on the most common Cys2His2 zinc finger proteins and their role in DNA recognition and transcriptional regulation. The document also examines uses of zinc finger nucleases for genome editing and their mechanism of action involving creating double-strand breaks in DNA.
Fundamental techniques of gene manipulationManigandan s
Restriction enzymes are bacterial enzymes that cut DNA at specific nucleotide sequences. They were discovered in the 1960s and have become important tools in molecular biology. Restriction enzymes recognize short palindromic sequences and make cuts within or near these sequences. There are three main types of restriction enzymes that differ in their subunit structure and cleavage patterns. Restriction enzymes are used in techniques like DNA cloning, Southern blotting, and genome mapping.
DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between DNA fragments, joining two DNA strands together. It plays an important role in DNA replication by joining Okazaki fragments and filling in gaps, as well as in DNA repair and genetic engineering techniques like cloning. The most commonly used DNA ligase is from bacteriophage T4, which utilizes ATP as a cofactor and works efficiently at lower temperatures to ligate DNA strands with either sticky or blunt ends.
1. Nucleases are enzymes that degrade nucleic acids by breaking phosphodiester bonds. Restriction enzymes recognize specific DNA sequences and cleave DNA at or near these sites.
2. Restriction enzymes are classified into three types based on subunit composition, cofactor requirements, target sequence, and cleavage position. Type I enzymes modify and cleave DNA randomly from recognition sites. Type II enzymes recognize palindromic sequences and cleave DNA at these sites. Type III enzymes cleave DNA away from recognition sites.
3. Other nucleases include Bal 31, DNase I, S1-nuclease, and RNase A. Phosphatases and methylases modify nucleic acids and proteins. Ligases join DNA fragments
Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cut specific DNA sequences. TALENs are made by fusing a DNA-binding domain from TALE (transcription activator-like effector) proteins with a DNA cleavage domain from the FokI nuclease. This fusion allows TALENs to be targeted to specific DNA sequences and induce double-stranded breaks, making them useful for genome editing applications.
Gene synthesis involves chemically synthesizing DNA without a template by adding nucleotides one by one. It is the basis of synthetic biology. The key steps in gene synthesis are sequence design, oligo synthesis, gene assembly, sequence verification, and preparing the synthetic DNA. Errors can be introduced at each step, so sequences must be verified before use. Gene synthesis is used widely in research to study biological functions and develop applications like DNA vaccines.
This presentation contains information about restriction enzymes, its nomenclature, restriction digestion, and its application. This also contains information about the chemicals used in restriction and also explains the general procedure of restriction digestion of DNA
This document discusses gene silencing, which is the suppression or interruption of gene expression at the transcriptional or translational level. It regulates gene expression and prevents certain genes from being expressed. There are several types of gene silencing, including transcriptional silencing through genomic imprinting, paramutation, and transposon silencing. Post-transcriptional gene silencing occurs through RNA interference pathways using small interfering RNA, microRNA, Dicer, and RISC complex. Research methods for gene silencing include antisense oligonucleotides, ribozymes, siRNA, and microRNA. Gene silencing has applications in biotechnology and medicine, with advantages such as being cost effective and having high specificity, though it also has disadvantages like potential toxicity.
This document provides information about zinc finger proteins. It begins with an introduction to zinc finger motifs, which are protein structural domains characterized by the coordination of zinc ions. The document then discusses the history of zinc finger discovery, functions, and families. It provides details on the most common Cys2His2 zinc finger proteins and their role in DNA recognition and transcriptional regulation. The document also examines uses of zinc finger nucleases for genome editing and their mechanism of action involving creating double-strand breaks in DNA.
1. Biotechnology relies on restriction enzymes that cut DNA at specific nucleotide sequences. Different enzymes cut DNA in different ways, leaving either blunt or sticky ends. Restriction maps show the lengths of DNA fragments cut by these enzymes.
2. The polymerase chain reaction (PCR) amplifies specific DNA sequences. It uses DNA polymerase to copy short DNA segments billions of times over, by cycling between high and low temperatures.
3. DNA fingerprinting identifies individuals by analyzing variations in noncoding DNA regions containing repeating sequences. The probability that any two individuals will have identical fingerprints across multiple regions is very small.
This document summarizes different types of DNA ligase enzymes including their sources, mechanisms, and applications. It discusses bacteriophage T4 DNA ligase, E.coli DNA ligase, Taq DNA ligase, T4 RNA ligase, and mammalian ligases. The mechanism of DNA ligase involves three steps - adenylation of the enzyme using ATP, transfer of AMP to the DNA donor strand, and formation of a phosphodiester bond between the donor and acceptor strands. The types of ligases vary in their substrate specificities and thermal stabilities, making each useful for different molecular biology applications like cloning and DNA amplification.
This document discusses reverse transcriptase and restriction enzymes. Reverse transcriptase is an enzyme that synthesizes DNA from an mRNA template. It is found in retroviruses and is used to make cDNA from mRNA. Restriction enzymes are molecular scissors found in bacteria that recognize and cut DNA at specific nucleotide sequences. Over 3000 restriction enzymes have been identified that can cut DNA into fragments for uses like DNA sequencing, cloning, and transformation. DNA ligase is then used to join DNA fragments back together.
Restriction Endonuclease: The Molecular Scissor of DNA - By RIKI NATHRIKI NATH
restriction enducleases are called the molecular scissors of DNA. types of restriction enzymes, their structures, subunits, most importantly the use of Type II restriction endonuclease in recombinant technology, mechanism of enzyme action and their applications.
Restriction enzymes are enzymes found in bacteria that cut DNA molecules at specific recognition sequences. They help with gene manipulation by cutting DNA at targeted locations. There are three main types of restriction enzymes: Type I recognize long sequences and cut elsewhere; Type II recognize short palindromic sequences and cut within; Type III have complex recognition sites and cutting. Restriction enzyme digestion is used in techniques like cloning and diagnostic restriction mapping by targeting specific sequences for cleavage.
Restriction enzymes are molecular scissors found in bacteria that cut DNA molecules at specific recognition sequences. They serve as a defensive mechanism for bacteria against bacteriophages by cleaving the phage DNA. There are over 3000 known restriction enzymes that are classified into four main types based on their composition, cofactors, and cutting mechanisms. Restriction enzymes are important tools in biotechnology for manipulating DNA sequences through cutting DNA fragments with specific sticky or blunt ends, which can then be recombined through techniques like cloning.
Chemical synthesis of DNA involves building oligonucleotides from nucleoside phosphoramidite building blocks through a solid phase synthesis process known as the phosphoramidite method. This method involves sequentially coupling the 3’ protected and activated phosphoramidite forms of the nucleosides in the 5’ to 3’ direction to synthesize short DNA strands up to around 200 bases in length. The phosphoramidite method allows for rapid, inexpensive custom synthesis of oligonucleotides which find many uses as probes, primers, and tools for targeted mutagenesis and gene synthesis.
Exonucleases are enzymes that degrade different types of DNAs in specific ways, while endonucleases cleave at specific DNA structures or modifications. Both exo- and endonucleases are useful as molecular biology tools. In this webinar, we will review the activities of exonucleases and endonucleases in more detail, provide insight on how to choose the right exo- or endonuclease for various molecular biology applications, and explain how to use these reagents when developing new molecular biology workflows.
This document discusses enzymes used in genetic engineering, specifically focusing on restriction enzymes and DNA modifying enzymes. It provides details on various types of modifying enzymes including nucleases, polymerases, phosphatases, kinases, ligases and others. Restriction enzymes are described as molecular scissors that cut DNA at specific recognition sequences. DNA ligase is presented as the molecular glue that joins cut DNA fragments. The document outlines the classification, nomenclature, mechanisms and applications of various restriction enzymes and modifying enzymes used in genetic engineering techniques.
Restriction enzyme digestion is a common technique used in gene cloning to prepare DNA fragments for insertion into a vector. Restriction enzymes recognize specific sequences in DNA and cleave the bonds between nucleotides at that site. The amount of restriction enzyme needed in microliters to completely digest one microgram of substrate DNA in one hour at the optimal temperature is defined as one unit of restriction enzyme activity. Restriction digestion is performed as part of gene cloning to isolate the desired DNA fragment, which is then inserted into a vector for cloning.
This document provides an overview of gene silencing and the mechanisms involved. It discusses transcriptional gene silencing which can occur through genomic imprinting, paramutation, histone modifications, transgene silencing, position effects, and RNA-directed DNA methylation. It also discusses post-transcriptional gene silencing mechanisms like RNA interference, nonsense mediated decay, and small interfering RNAs. Some key cellular components that enable gene silencing are also described, such as microRNAs, Dicer, and RISC complex.
Antisense technology uses short DNA sequences called oligonucleotides that are complementary to messenger RNA (mRNA) to prevent specific proteins from being synthesized. When introduced into cells, these antisense oligonucleotides bind to their target mRNA through Watson-Crick base pairing, forming RNA-DNA hybrids that are degraded by RNase H enzyme. This prevents translation and expression of the target protein. There are three generations of antisense oligonucleotides that have been developed with improved stability and targeting capabilities, including phosphorothioate, 2'-O-methyl RNA, and locked nucleic acid chemistries. Antisense technology has potential applications in treating diseases like cancer, viral infections, and genetic disorders.
The document discusses genetic engineering and cloning techniques. It begins by defining cloning as making multiple copies of a target gene, generally using bacteria as hosts. It then describes the basic cloning process of inserting a DNA fragment into a vector, which is then introduced into a host cell to generate multiple copies. Key tools for cloning like restriction enzymes, ligase, vectors and host cells are mentioned. The document provides steps for cloning, genetic engineering, and producing proteins via recombinant DNA technology. It also lists various DNA polymerases and other enzymes commonly used in these processes.
making recombinant DNA and applications in healthYitayehAlemu
Recombinant DNA technology allows for the artificial creation of DNA by combining DNA from different sources. This involves using restriction enzymes to cut DNA fragments, which are then joined together using DNA ligase. Vectors are used to transport and replicate the recombinant DNA in host cells such as E. coli bacteria. Common tools for making recombinant DNA include restriction enzymes, vectors, host cells, DNA ligase, and selectable markers which allow identification of successful recombinants. Recombinant DNA technology has many applications in medicine, agriculture, and industry.
These slides give you detailed information about Recombinant DNA Technology in simple words. Do read it, these points will help you while studying this topic.
Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites.
Aspect of Genetic Engineering_20240216_200211_0000.pdfannalisadixon1
This is a presentation that covers on Module 2 Aspects of Genetic Engineering from the syllabus. For Cape biology Unit 1, students I hope this presentation is helpful and clear for you to get an idea of how to cut and paste DNA, The process of Recombinant Data Technology etc.
A restriction map is a map of known restriction sites within a sequence of DNA. Restriction mapping requires the use of restriction enzymes. In molecular biology, restriction maps are used as a reference to engineer plasmids or other relatively short pieces of DNA, and sometimes for longer genomic DNA. There are other ways of mapping features on DNA for longer length DNA molecules, such as mapping by transduction (Bitner, Kuempel 1981).
Restriction mapping is a useful way to characterise a particular DNA molecule. It enables us to locate and isolate DNA fragments for further study and manipulation. The relative location of different restriction enzyme sites to each other are determined by enzymatic digest of the DNA with different restriction enzymes, alone and in various combinations.The digested DNA is separated by gel electrophoresis and the fragment sizes that have been generated are used to build the 'map' of sites of the fragment. The map lets us know 'where we are' in the linear DNA macromolecule.
Restriction_Endonucleases for Gene Manipulation -Unit 1.pptxSamarOza2
Restriction endonucleases are enzymes that cut DNA at specific recognition sequences. There are several thousand restriction enzymes that recognize different DNA sequences. Most are isolated from bacteria and serve to defend the host by cutting foreign DNA. Each restriction enzyme requires a specific recognition sequence, which can be 4-8 base pairs long. They cut DNA, leaving either blunt ends, 5' overhangs, or 3' overhangs. Linkers or homopolymer tails can be added to DNA fragments to allow them to be joined together using restriction sites or base pairing. Restriction enzymes are important tools in molecular cloning and genomics.
1. Biotechnology relies on restriction enzymes that cut DNA at specific nucleotide sequences. Different enzymes cut DNA in different ways, leaving either blunt or sticky ends. Restriction maps show the lengths of DNA fragments cut by these enzymes.
2. The polymerase chain reaction (PCR) amplifies specific DNA sequences. It uses DNA polymerase to copy short DNA segments billions of times over, by cycling between high and low temperatures.
3. DNA fingerprinting identifies individuals by analyzing variations in noncoding DNA regions containing repeating sequences. The probability that any two individuals will have identical fingerprints across multiple regions is very small.
This document summarizes different types of DNA ligase enzymes including their sources, mechanisms, and applications. It discusses bacteriophage T4 DNA ligase, E.coli DNA ligase, Taq DNA ligase, T4 RNA ligase, and mammalian ligases. The mechanism of DNA ligase involves three steps - adenylation of the enzyme using ATP, transfer of AMP to the DNA donor strand, and formation of a phosphodiester bond between the donor and acceptor strands. The types of ligases vary in their substrate specificities and thermal stabilities, making each useful for different molecular biology applications like cloning and DNA amplification.
This document discusses reverse transcriptase and restriction enzymes. Reverse transcriptase is an enzyme that synthesizes DNA from an mRNA template. It is found in retroviruses and is used to make cDNA from mRNA. Restriction enzymes are molecular scissors found in bacteria that recognize and cut DNA at specific nucleotide sequences. Over 3000 restriction enzymes have been identified that can cut DNA into fragments for uses like DNA sequencing, cloning, and transformation. DNA ligase is then used to join DNA fragments back together.
Restriction Endonuclease: The Molecular Scissor of DNA - By RIKI NATHRIKI NATH
restriction enducleases are called the molecular scissors of DNA. types of restriction enzymes, their structures, subunits, most importantly the use of Type II restriction endonuclease in recombinant technology, mechanism of enzyme action and their applications.
Restriction enzymes are enzymes found in bacteria that cut DNA molecules at specific recognition sequences. They help with gene manipulation by cutting DNA at targeted locations. There are three main types of restriction enzymes: Type I recognize long sequences and cut elsewhere; Type II recognize short palindromic sequences and cut within; Type III have complex recognition sites and cutting. Restriction enzyme digestion is used in techniques like cloning and diagnostic restriction mapping by targeting specific sequences for cleavage.
Restriction enzymes are molecular scissors found in bacteria that cut DNA molecules at specific recognition sequences. They serve as a defensive mechanism for bacteria against bacteriophages by cleaving the phage DNA. There are over 3000 known restriction enzymes that are classified into four main types based on their composition, cofactors, and cutting mechanisms. Restriction enzymes are important tools in biotechnology for manipulating DNA sequences through cutting DNA fragments with specific sticky or blunt ends, which can then be recombined through techniques like cloning.
Chemical synthesis of DNA involves building oligonucleotides from nucleoside phosphoramidite building blocks through a solid phase synthesis process known as the phosphoramidite method. This method involves sequentially coupling the 3’ protected and activated phosphoramidite forms of the nucleosides in the 5’ to 3’ direction to synthesize short DNA strands up to around 200 bases in length. The phosphoramidite method allows for rapid, inexpensive custom synthesis of oligonucleotides which find many uses as probes, primers, and tools for targeted mutagenesis and gene synthesis.
Exonucleases are enzymes that degrade different types of DNAs in specific ways, while endonucleases cleave at specific DNA structures or modifications. Both exo- and endonucleases are useful as molecular biology tools. In this webinar, we will review the activities of exonucleases and endonucleases in more detail, provide insight on how to choose the right exo- or endonuclease for various molecular biology applications, and explain how to use these reagents when developing new molecular biology workflows.
This document discusses enzymes used in genetic engineering, specifically focusing on restriction enzymes and DNA modifying enzymes. It provides details on various types of modifying enzymes including nucleases, polymerases, phosphatases, kinases, ligases and others. Restriction enzymes are described as molecular scissors that cut DNA at specific recognition sequences. DNA ligase is presented as the molecular glue that joins cut DNA fragments. The document outlines the classification, nomenclature, mechanisms and applications of various restriction enzymes and modifying enzymes used in genetic engineering techniques.
Restriction enzyme digestion is a common technique used in gene cloning to prepare DNA fragments for insertion into a vector. Restriction enzymes recognize specific sequences in DNA and cleave the bonds between nucleotides at that site. The amount of restriction enzyme needed in microliters to completely digest one microgram of substrate DNA in one hour at the optimal temperature is defined as one unit of restriction enzyme activity. Restriction digestion is performed as part of gene cloning to isolate the desired DNA fragment, which is then inserted into a vector for cloning.
This document provides an overview of gene silencing and the mechanisms involved. It discusses transcriptional gene silencing which can occur through genomic imprinting, paramutation, histone modifications, transgene silencing, position effects, and RNA-directed DNA methylation. It also discusses post-transcriptional gene silencing mechanisms like RNA interference, nonsense mediated decay, and small interfering RNAs. Some key cellular components that enable gene silencing are also described, such as microRNAs, Dicer, and RISC complex.
Antisense technology uses short DNA sequences called oligonucleotides that are complementary to messenger RNA (mRNA) to prevent specific proteins from being synthesized. When introduced into cells, these antisense oligonucleotides bind to their target mRNA through Watson-Crick base pairing, forming RNA-DNA hybrids that are degraded by RNase H enzyme. This prevents translation and expression of the target protein. There are three generations of antisense oligonucleotides that have been developed with improved stability and targeting capabilities, including phosphorothioate, 2'-O-methyl RNA, and locked nucleic acid chemistries. Antisense technology has potential applications in treating diseases like cancer, viral infections, and genetic disorders.
The document discusses genetic engineering and cloning techniques. It begins by defining cloning as making multiple copies of a target gene, generally using bacteria as hosts. It then describes the basic cloning process of inserting a DNA fragment into a vector, which is then introduced into a host cell to generate multiple copies. Key tools for cloning like restriction enzymes, ligase, vectors and host cells are mentioned. The document provides steps for cloning, genetic engineering, and producing proteins via recombinant DNA technology. It also lists various DNA polymerases and other enzymes commonly used in these processes.
making recombinant DNA and applications in healthYitayehAlemu
Recombinant DNA technology allows for the artificial creation of DNA by combining DNA from different sources. This involves using restriction enzymes to cut DNA fragments, which are then joined together using DNA ligase. Vectors are used to transport and replicate the recombinant DNA in host cells such as E. coli bacteria. Common tools for making recombinant DNA include restriction enzymes, vectors, host cells, DNA ligase, and selectable markers which allow identification of successful recombinants. Recombinant DNA technology has many applications in medicine, agriculture, and industry.
These slides give you detailed information about Recombinant DNA Technology in simple words. Do read it, these points will help you while studying this topic.
Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites. Restriction Endonucleases are the enzymes that cut the DNA on interest from specific sites.
Aspect of Genetic Engineering_20240216_200211_0000.pdfannalisadixon1
This is a presentation that covers on Module 2 Aspects of Genetic Engineering from the syllabus. For Cape biology Unit 1, students I hope this presentation is helpful and clear for you to get an idea of how to cut and paste DNA, The process of Recombinant Data Technology etc.
A restriction map is a map of known restriction sites within a sequence of DNA. Restriction mapping requires the use of restriction enzymes. In molecular biology, restriction maps are used as a reference to engineer plasmids or other relatively short pieces of DNA, and sometimes for longer genomic DNA. There are other ways of mapping features on DNA for longer length DNA molecules, such as mapping by transduction (Bitner, Kuempel 1981).
Restriction mapping is a useful way to characterise a particular DNA molecule. It enables us to locate and isolate DNA fragments for further study and manipulation. The relative location of different restriction enzyme sites to each other are determined by enzymatic digest of the DNA with different restriction enzymes, alone and in various combinations.The digested DNA is separated by gel electrophoresis and the fragment sizes that have been generated are used to build the 'map' of sites of the fragment. The map lets us know 'where we are' in the linear DNA macromolecule.
Restriction_Endonucleases for Gene Manipulation -Unit 1.pptxSamarOza2
Restriction endonucleases are enzymes that cut DNA at specific recognition sequences. There are several thousand restriction enzymes that recognize different DNA sequences. Most are isolated from bacteria and serve to defend the host by cutting foreign DNA. Each restriction enzyme requires a specific recognition sequence, which can be 4-8 base pairs long. They cut DNA, leaving either blunt ends, 5' overhangs, or 3' overhangs. Linkers or homopolymer tails can be added to DNA fragments to allow them to be joined together using restriction sites or base pairing. Restriction enzymes are important tools in molecular cloning and genomics.
Restriction enzymes cut DNA fragments at specific sites, leaving sticky or blunt ends. DNA ligase then joins the ends of DNA fragments together. Recombinant DNA technology uses these enzymes to isolate a gene of interest, cut it and a vector DNA, and join them via ligation to produce recombinant DNA that can be introduced into a host for replication. This allows for genetic analysis and applications in medicine, agriculture, and industry.
Genetic engineering involves directly manipulating genes, often by adding a gene from another species to an organism's genome. This is done through recombinant DNA (rDNA) technology, which combines DNA sequences artificially. A key part of the process is using restriction enzymes to cut DNA at specific sites, then inserting the cut DNA fragment into a vector like a plasmid for replication in a host cell. The engineered DNA is then introduced into host cells, and cells containing the new DNA are identified and isolated through markers on the vector.
Enzymes involved in rDNA technology.pptxPoonam Patil
This document discusses the key enzymes involved in recombinant DNA technology. It describes how restriction enzymes cut DNA at specific recognition sites, and DNA ligases join cut DNA fragments back together. The document outlines the process of recombinant DNA technology, including generating DNA fragments, inserting them into cloning vectors, introducing the vectors into host cells, and expressing the gene of interest. It provides details on various restriction enzymes and DNA-modifying enzymes used in genetic engineering applications.
1. Recombinant DNA technology involves isolating a gene of interest, inserting it into a vector like a plasmid, introducing the vector into a host cell like E. coli, and allowing the host cell to multiply and express the gene.
2. Key tools that enable this process are restriction enzymes, which cut DNA at specific sequences, and DNA ligase, which joins DNA fragments back together. Vectors like plasmids contain origins of replication and selectable markers.
3. Important applications of recombinant DNA technology include producing human insulin in bacteria to treat diabetes and engineering plants for insect resistance. This technology has generated significant scientific and medical advances.
DNA manipulative enzymes can be grouped into four classes: nucleases cut DNA, ligases join DNA, polymerases copy DNA, and modifying enzymes add or remove chemical groups from DNA. Restriction endonucleases are nucleases that cut DNA at specific recognition sequences and are important for gene cloning. They produce either blunt or sticky ends. DNA ligase joins DNA fragments together by forming phosphodiester bonds. Polymerases like Klenow fragment and Taq polymerase copy DNA. Modifying enzymes alter DNA through addition or removal of chemical groups from the DNA backbone. Together, these enzymes enable the precise cutting and joining of DNA required for gene cloning experiments.
As a microbiologist, these are 15 unique areas of Biotechnology you should be familiar with, especially at the master's level
Please Note: If you can't read any text, kindly download and view as ppt
This document discusses restriction enzymes, which are important tools in genetic engineering and recombinant DNA technology. Restriction enzymes cut DNA at specific recognition sequences and are used to cut DNA into fragments that can then be recombined in new ways. The document provides details on the discovery and functions of various restriction enzymes as well as other enzymes used in genetic engineering such as DNA ligase, alkaline phosphatase, polynucleotide kinase, and reverse transcriptase. It also discusses the use of restriction enzymes to build the first synthetic bacterial genome.
Unit 2 discusses molecular tools for gene cloning, including restriction endonucleases, ligases, and other enzymes used in recombinant DNA technology. These enzymes are crucial for cutting DNA at specific points and joining DNA fragments together to create recombinant molecules. Restriction endonucleases cut DNA at specific recognition sequences and are classified into types based on their recognition sequences and cleavage mechanisms. Type II restriction endonucleases recognize short, specific DNA sequences and cut within these sequences, which is useful for precise and reproducible cutting of DNA required for cloning.
Restriction enzymes recognize and cleave DNA at specific sequences. There are three main types of restriction enzymes: Type I and III are large complexes that can cleave DNA far from recognition sites, while Type II cleaves directly at recognition sites and is most commonly used. Restriction enzymes cleave DNA through one of two mechanisms - forming a covalent intermediate or direct hydrolysis. They require divalent cations like magnesium to catalyze the reaction and cleave with high specificity only at cognate recognition sequences.
DNA footprinting is a technique used to identify protein binding regions on DNA. It involves treating DNA with nucleases like DNase I, which will degrade the DNA except for regions bound by proteins. These protected regions, called footprints, can identify transcription factor binding sites that regulate gene expression. The technique was originally developed in 1978 to study the binding specificity of the lac repressor protein, and it provides information on DNA-protein interactions and transcriptional regulation.
Presentation A - Using Restriction Enzymes.pptxBlackHunt1
This document provides information about using restriction enzymes to analyze DNA through gel electrophoresis. It describes how restriction enzymes cut DNA at specific recognition sequences, producing restriction fragments that can be separated by size using gel electrophoresis. The document explains that restriction enzymes are used in research and medicine to create recombinant DNA by producing complementary sticky ends on DNA fragments, and in DNA profiling for various applications. It provides examples of specific restriction enzymes and their recognition sequences.
Genetic recombination and genetic engineeringshobejee
Herbert Boyer and Stanley Cohen created the first recombinant DNA molecule in 1973, proving that genetic engineering is possible. Walter Gilbert and Frederick Sanger then developed methods to determine DNA sequences. This allowed genes to be isolated, identified, and induced to express proteins in host cells. Recombinant DNA techniques have revolutionized biology and medicine by precisely modifying genetic endowments and producing clinically useful proteins. The techniques involve using restriction enzymes to cut DNA fragments for insertion into cloning vectors like plasmids, which are then replicated in host cells to amplify the gene of interest.
Recombinant DNA technology involves joining DNA fragments from different sources to produce novel DNA molecules. This is done by using restriction enzymes to cut DNA fragments at specific recognition sequences, and DNA ligase to join the fragments together. Vectors like plasmids are used to clone and replicate the DNA fragments of interest. Restriction enzymes recognize palindromic sequences and cut the DNA either as blunt ends or sticky ends. The DNA fragments can then be ligated into an expression vector to produce the desired protein. cDNA libraries are useful for cloning eukaryotic genes by reverse transcribing mRNA to cDNA.
Lourdes conducted research that led to the characterization of over 50 peptides from fish-hunting snail venom and the use of conotoxins to study the human brain. Her discoveries impacted neuroscience as conotoxins continue to be used to examine brain activity.
Ramirez focused on studying the genetics of native plants like coconuts and rice in the Philippines. Her research empowered agricultural scientists and farmers by advancing plant breeding and genetics. She pioneered genetics instruction and was called the "Mother of Cell."
Recombinant DNA technology has revolutionized cell study. Advances in manipulating DNA allowed combining techniques such that researchers can now isolate specific genes to precisely study their structures and functions.
This document is a biology investigatory project submitted by Arajit Kumar Pati on the topic of genetic engineering. It provides an overview of genetic engineering and recombinant DNA technology. It describes various techniques used in genetic engineering like DNA cloning, restriction digestion, use of vectors, recombinant DNA formation, insertion of genes into hosts, and production of gene products. It discusses the wide applications of genetic engineering in fields like medicine, agriculture, and industry. It concludes that genetic engineering has revolutionized our understanding of inheritance and molecular biology.
This document discusses various enzymes and vectors used in genetic engineering. It describes DNA ligase and T4 DNA ligase, which are used to join DNA fragments. Restriction enzymes cut DNA at specific sequences and are used for tasks like DNA sequencing and cloning. Vectors like plasmids, bacteriophages, cosmids, yeast artificial chromosomes (YACs), and bacterial artificial chromosomes (BACs) are used to transfer foreign DNA. The document also discusses DNA polymerases, nucleases, and other enzymes that modify DNA, and how they are applied in genetic engineering techniques.
Monitoring and Managing Anomaly Detection on OpenShift.pdfTosin Akinosho
Monitoring and Managing Anomaly Detection on OpenShift
Overview
Dive into the world of anomaly detection on edge devices with our comprehensive hands-on tutorial. This SlideShare presentation will guide you through the entire process, from data collection and model training to edge deployment and real-time monitoring. Perfect for those looking to implement robust anomaly detection systems on resource-constrained IoT/edge devices.
Key Topics Covered
1. Introduction to Anomaly Detection
- Understand the fundamentals of anomaly detection and its importance in identifying unusual behavior or failures in systems.
2. Understanding Edge (IoT)
- Learn about edge computing and IoT, and how they enable real-time data processing and decision-making at the source.
3. What is ArgoCD?
- Discover ArgoCD, a declarative, GitOps continuous delivery tool for Kubernetes, and its role in deploying applications on edge devices.
4. Deployment Using ArgoCD for Edge Devices
- Step-by-step guide on deploying anomaly detection models on edge devices using ArgoCD.
5. Introduction to Apache Kafka and S3
- Explore Apache Kafka for real-time data streaming and Amazon S3 for scalable storage solutions.
6. Viewing Kafka Messages in the Data Lake
- Learn how to view and analyze Kafka messages stored in a data lake for better insights.
7. What is Prometheus?
- Get to know Prometheus, an open-source monitoring and alerting toolkit, and its application in monitoring edge devices.
8. Monitoring Application Metrics with Prometheus
- Detailed instructions on setting up Prometheus to monitor the performance and health of your anomaly detection system.
9. What is Camel K?
- Introduction to Camel K, a lightweight integration framework built on Apache Camel, designed for Kubernetes.
10. Configuring Camel K Integrations for Data Pipelines
- Learn how to configure Camel K for seamless data pipeline integrations in your anomaly detection workflow.
11. What is a Jupyter Notebook?
- Overview of Jupyter Notebooks, an open-source web application for creating and sharing documents with live code, equations, visualizations, and narrative text.
12. Jupyter Notebooks with Code Examples
- Hands-on examples and code snippets in Jupyter Notebooks to help you implement and test anomaly detection models.
5th LF Energy Power Grid Model Meet-up SlidesDanBrown980551
5th Power Grid Model Meet-up
It is with great pleasure that we extend to you an invitation to the 5th Power Grid Model Meet-up, scheduled for 6th June 2024. This event will adopt a hybrid format, allowing participants to join us either through an online Mircosoft Teams session or in person at TU/e located at Den Dolech 2, Eindhoven, Netherlands. The meet-up will be hosted by Eindhoven University of Technology (TU/e), a research university specializing in engineering science & technology.
Power Grid Model
The global energy transition is placing new and unprecedented demands on Distribution System Operators (DSOs). Alongside upgrades to grid capacity, processes such as digitization, capacity optimization, and congestion management are becoming vital for delivering reliable services.
Power Grid Model is an open source project from Linux Foundation Energy and provides a calculation engine that is increasingly essential for DSOs. It offers a standards-based foundation enabling real-time power systems analysis, simulations of electrical power grids, and sophisticated what-if analysis. In addition, it enables in-depth studies and analysis of the electrical power grid’s behavior and performance. This comprehensive model incorporates essential factors such as power generation capacity, electrical losses, voltage levels, power flows, and system stability.
Power Grid Model is currently being applied in a wide variety of use cases, including grid planning, expansion, reliability, and congestion studies. It can also help in analyzing the impact of renewable energy integration, assessing the effects of disturbances or faults, and developing strategies for grid control and optimization.
What to expect
For the upcoming meetup we are organizing, we have an exciting lineup of activities planned:
-Insightful presentations covering two practical applications of the Power Grid Model.
-An update on the latest advancements in Power Grid -Model technology during the first and second quarters of 2024.
-An interactive brainstorming session to discuss and propose new feature requests.
-An opportunity to connect with fellow Power Grid Model enthusiasts and users.
Building Production Ready Search Pipelines with Spark and MilvusZilliz
Spark is the widely used ETL tool for processing, indexing and ingesting data to serving stack for search. Milvus is the production-ready open-source vector database. In this talk we will show how to use Spark to process unstructured data to extract vector representations, and push the vectors to Milvus vector database for search serving.
Freshworks Rethinks NoSQL for Rapid Scaling & Cost-EfficiencyScyllaDB
Freshworks creates AI-boosted business software that helps employees work more efficiently and effectively. Managing data across multiple RDBMS and NoSQL databases was already a challenge at their current scale. To prepare for 10X growth, they knew it was time to rethink their database strategy. Learn how they architected a solution that would simplify scaling while keeping costs under control.
Introduction of Cybersecurity with OSS at Code Europe 2024Hiroshi SHIBATA
I develop the Ruby programming language, RubyGems, and Bundler, which are package managers for Ruby. Today, I will introduce how to enhance the security of your application using open-source software (OSS) examples from Ruby and RubyGems.
The first topic is CVE (Common Vulnerabilities and Exposures). I have published CVEs many times. But what exactly is a CVE? I'll provide a basic understanding of CVEs and explain how to detect and handle vulnerabilities in OSS.
Next, let's discuss package managers. Package managers play a critical role in the OSS ecosystem. I'll explain how to manage library dependencies in your application.
I'll share insights into how the Ruby and RubyGems core team works to keep our ecosystem safe. By the end of this talk, you'll have a better understanding of how to safeguard your code.
HCL Notes and Domino License Cost Reduction in the World of DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
GraphRAG for Life Science to increase LLM accuracyTomaz Bratanic
GraphRAG for life science domain, where you retriever information from biomedical knowledge graphs using LLMs to increase the accuracy and performance of generated answers
This presentation provides valuable insights into effective cost-saving techniques on AWS. Learn how to optimize your AWS resources by rightsizing, increasing elasticity, picking the right storage class, and choosing the best pricing model. Additionally, discover essential governance mechanisms to ensure continuous cost efficiency. Whether you are new to AWS or an experienced user, this presentation provides clear and practical tips to help you reduce your cloud costs and get the most out of your budget.
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...Alex Pruden
Folding is a recent technique for building efficient recursive SNARKs. Several elegant folding protocols have been proposed, such as Nova, Supernova, Hypernova, Protostar, and others. However, all of them rely on an additively homomorphic commitment scheme based on discrete log, and are therefore not post-quantum secure. In this work we present LatticeFold, the first lattice-based folding protocol based on the Module SIS problem. This folding protocol naturally leads to an efficient recursive lattice-based SNARK and an efficient PCD scheme. LatticeFold supports folding low-degree relations, such as R1CS, as well as high-degree relations, such as CCS. The key challenge is to construct a secure folding protocol that works with the Ajtai commitment scheme. The difficulty, is ensuring that extracted witnesses are low norm through many rounds of folding. We present a novel technique using the sumcheck protocol to ensure that extracted witnesses are always low norm no matter how many rounds of folding are used. Our evaluation of the final proof system suggests that it is as performant as Hypernova, while providing post-quantum security.
Paper Link: https://eprint.iacr.org/2024/257
TrustArc Webinar - 2024 Global Privacy SurveyTrustArc
How does your privacy program stack up against your peers? What challenges are privacy teams tackling and prioritizing in 2024?
In the fifth annual Global Privacy Benchmarks Survey, we asked over 1,800 global privacy professionals and business executives to share their perspectives on the current state of privacy inside and outside of their organizations. This year’s report focused on emerging areas of importance for privacy and compliance professionals, including considerations and implications of Artificial Intelligence (AI) technologies, building brand trust, and different approaches for achieving higher privacy competence scores.
See how organizational priorities and strategic approaches to data security and privacy are evolving around the globe.
This webinar will review:
- The top 10 privacy insights from the fifth annual Global Privacy Benchmarks Survey
- The top challenges for privacy leaders, practitioners, and organizations in 2024
- Key themes to consider in developing and maintaining your privacy program
Skybuffer AI: Advanced Conversational and Generative AI Solution on SAP Busin...Tatiana Kojar
Skybuffer AI, built on the robust SAP Business Technology Platform (SAP BTP), is the latest and most advanced version of our AI development, reaffirming our commitment to delivering top-tier AI solutions. Skybuffer AI harnesses all the innovative capabilities of the SAP BTP in the AI domain, from Conversational AI to cutting-edge Generative AI and Retrieval-Augmented Generation (RAG). It also helps SAP customers safeguard their investments into SAP Conversational AI and ensure a seamless, one-click transition to SAP Business AI.
With Skybuffer AI, various AI models can be integrated into a single communication channel such as Microsoft Teams. This integration empowers business users with insights drawn from SAP backend systems, enterprise documents, and the expansive knowledge of Generative AI. And the best part of it is that it is all managed through our intuitive no-code Action Server interface, requiring no extensive coding knowledge and making the advanced AI accessible to more users.
Ivanti’s Patch Tuesday breakdown goes beyond patching your applications and brings you the intelligence and guidance needed to prioritize where to focus your attention first. Catch early analysis on our Ivanti blog, then join industry expert Chris Goettl for the Patch Tuesday Webinar Event. There we’ll do a deep dive into each of the bulletins and give guidance on the risks associated with the newly-identified vulnerabilities.
How to Interpret Trends in the Kalyan Rajdhani Mix Chart.pdfChart Kalyan
A Mix Chart displays historical data of numbers in a graphical or tabular form. The Kalyan Rajdhani Mix Chart specifically shows the results of a sequence of numbers over different periods.
How to Interpret Trends in the Kalyan Rajdhani Mix Chart.pdf
C0261012019
1. International Journal of Engineering Science Invention
ISSN (Online): 2319 – 6734, ISSN (Print): 2319 – 6726
www.ijesi.org Volume 2 Issue 6 ǁ June. 2013 ǁ PP.12-19
www.ijesi.org 12 | Page
Restriction Site Finder: A Tool for Finding Restriction Sites in
Genome Using Perl
Bhartesh Kumar1*
, Vijay Laxmi Saxena1
, Ashok Kumar Saxena2*
,
Shrasti Gupta 2 ,
P.P.Mathur3
1*
(Bioinformatics Infrastructure Facility Centre of D.B.T. D.G.(P.G.),College, Kanpur India.)
1
Head of Department of Zoology, Bioinformatics Infrastructure Facility Centre of D.B.T. D.G.(P.G.),College,
Kanpur India.)
2*
(Department of Zoology, D.A.V. College Kanpur, Uttar Pradesh, Pincode-208001, India.)
2
(Bioinformatics Infrastructure Facility Centre of D.B.T. D.G.(P.G.),College, Kanpur India.)
3
(The Dean, School of Life Sciences and Professor of Biochemistry & Molecular Biology&.Vice Chancellor,
KIIT University, Bhubaneswar India.)
ABSTRACT : Restriction enzymes are the enzymes basicallyused by bacteria for theirdefensemechanism. after
the discovery of thèse enzymes their utility in the biotechnology and molecularcloningis of wide perspective,
now a daysthis enzyme iswidelyused as molecularscissors in recombinant DNAtechnology. Restriction enzyme
cuts double strandedDNAatspecific sites. thispropertycanbeused to generate fragment of Desiredgene as well as
Restriction map of genome of an organismthistoolRerstriction site finderis a noveltoolbased on
PERLwhichcancomputationallycalculate the positions of DNAwhere a particular Restriction enzyme cuts and
Whole restriction map of the DNAsequenceprovided as input . Input must begiven in FASTA format. This
isanoveltool to prepare restriction map of a wholegenome and to previouslyfind the restriction sites for it.
KEYWORDS -restriction enzyme, DNA, molecule DNA sequence, PERL
1. INTRODUCTION
A restriction enzyme (or restriction endonuclease) is an enzyme that cuts double-stranded DNA. The
enzyme makes two incisions, one through each of the phosphate backbones of the double helix without
damaging the bases. The chemical bonds that the enzymes cleave can be reformed by other enzymes known as
ligasesr, so that restriction fragments carved from different chromosomes or genes can be spliced together,
provided their ends are complementary. Many of the procedures of molecular biology and genetic engineering
rely on restriction enzymes. The term restriction comes from the fact that these enzymes were discovered in E.
coli strains that appeared to be restricting the infection by certain bacteriophages. Restriction enzymes therefore
are believed to be a mechanism evolved by bacteria to resist viral attack and to help in the removal of viral
sequences Restriction enzymes are DNA-cutting enzymes found in bacteria (and harvested from them for use).
Because they cut within the molecule, they are often called restriction endonucleases. A restriction enzyme
recognizes and cuts DNA only at a particular sequence of nucleotides. For example: The bacterium
Hemophilusaegypticus produces an enzyme named HaeIII that cuts DNA wherever it encounters the sequence
5'GGCC3'
3'CCGG5'
The cut is made between the adjacent G and C. This particular sequence occurs at 11 places in the
circular DNA molecule of the virus phiX174. Thus treatment of this DNA with the enzyme produces 11
fragments, each with a precise length and nucleotide sequence. These fragments can be separated from one
another and the sequence of each determined HaeIII and AluI cut straight across the double helix producing
"blunt" ends. However, many restriction enzymes cut in an offset fashion. The ends of the cut have an
overhanging piece of single-stranded DNA. These are called "sticky ends" because they are able to form base
pairs with any DNA molecule that contains the complementary sticky end. Any other source of DNA treated
with the same enzyme will produce such molecules. Mixed together, these molecules can join with each other
by the base pairing between their sticky ends. The union can be made permanent by another enzyme, DNA
ligase, which forms covalent bonds along the backbone of each strand (FIG NO 1). The result is a molecule of
recombinant DNA (rDNA). The ability to produce recombinant DNA molecules has not only revolutionized the
study of genetics, but has laid the foundation for much of the biotechnology industry.
1.1 MECHANISM OF ACTION OF RESTRICTION ENZYMES
The action of restriction enzymes is in many respects as varied as the enzymes themselves. In general,
however, the process is one of recognition of the binding site, binding of the enzyme dimer to the DNA,
2. Restriction Site Finder: A Tool for …
www.ijesi.org 13 | Page
cleavage of the DNA, and enzyme release.. To begin, all restriction endonucleases will bind DNA specifically
and, with much less strength, non-specifically. This is a characteristic of many proteins that interact with DNA.
It is probable that even non-specific DNA binding will induce a conformational change in the restriction enzyme
dimer that will result in the protein adapting to the surface of the DNA strands (Vaidiu and Aggarwal, 2000).
These changes are not the same as those that occur when the dimmer binds to the recognition site though. As the
dimer slides along the DNA strands, it searches for recognition elements and, when these are encountered, an
interaction between the protein and the DNA ensues in which the non-specific complex is converted into a
specific complex. In general, intimate contact is held by 15 – 20 hydrogen bonds that form between the protein
and the DNA bases in the recognition site. These bonds are shown to be mediated through specific amino acids,
primarily ASP and GLU, held in a proper threedimensional configuration. (FIG NO :2) Simplified scheme of
the mechanism of Type II restriction enzyme digestion. The homodimer will either bind directly to the
recognition site (Specific Binding) or nearby (non-specific Binding). The case of non-specific binding, if the
recognition site is not too far away the enzyme will move along the DNA strand until it hits the recognition site.
Once the enzyme locates the recognition site it will couple and then hydrolyze the sugar phosphate bonds of the
DNA. Finally, the enzyme will release leaving the cleaved DNA molecule behind.
1.2 RESTRICTION ENZYME - ACTION OF ECORI
The enzymes Dra I (TTTAAA), Ssp I (AATATT), and Pac I (TTAATTAA) are but three of these “AT-
cutters.” Further, most restriction enzymes will cleave the DNA inside the recognition site but there are several
that do not. The enzyme Mnl I recognizes the non-palindromic sequence CCTC but cleaves the DNA seven
bases downstream (i.e., CCTC 7/7). Other examples include Bbv I (GCAGC 8/12) and Hga I (GACGC 5/10).
The enzyme Acc I recognizes the sequences GTATAC and GTCGAC. (Fig: 3)
The standard nucleotide coding system is:
A, C, G, T, U
R (G or A) Purine
Y (T or C) Pryimidine
K (G or T) Keto
M (A or C) Amino
S (G or C) Strong
W (A or T) Weak
B (G, T, C) (not A)
D (G, A, T) (not C)
H (A, C, T) (not G)
V (G, C, A) (not T or U)
N (all).
Table:1 and Table No. 2
II. PROPOSED METHOD
Requirment: Perl 5.0 and Restriction Enzyme DatabaseRestriction Enzyme Data.The RE data is
available in a variety of formats, as a visit to the REBASE web site at(hhh://www.neb.com/rebase/rebase.html).
User can decide to get the information from the bionet file. REBASE version 604 bionet.604REBASE, The
Restriction Enzyme Database http://rebase.neb.com Notepad and Microsoft word is usable, but always save as
text or ASCII only.
2.1.2 Working of Program:
To run perl program depending on your operating system. Window is closely coupled with Intel 32 bit
chip; these are often called wintel or win 32 binaries. Eeample: Perl usrlocalbin Perl re.pl
2.1.3 Windows
On window system, it is usual to associate the file name extension .pl with Perl program. this isdone as
a part of the Perl installation process, which modify the registry setting to include this file association. You can
launch allergen program by typing perl allergen.pl. Window has a path variable specifying folders in which
system looks for program, and this is modified by the Perl installation process to include the path to the folder
for the Perl association ,
C: If you are trying to run a Perl program that is not installed in a folder known to the path variable , you
can type the complete path name of program, for instance . Perl C:windowdesktop Perl re.pl.
Input file:
Nucleotide sequence for any gene or whole genome in fasta format.
Eg.: NM_000660. Reports Homo sapiens tran...[gi:63025221]
3. Restriction Site Finder: A Tool for …
www.ijesi.org 14 | Page
>gi|63025221|ref|NM_000660.3| Homo sapiens transforming growth factor, beta 1 (Camurati-Engelmann
disease) (TGFB1), Mrna
CCTTCGCGCCCTGGGCCATCTCCCTCCCACCTCCCTCCGCGGAGCAGCCAGACAGCGAGGGCC
CCGGCCGGGGGCAGGGGGGACGCCCCGTCCGGGGCACCCCCCCGGCTCTGAGCCGCCCGCGG
GGCCGGCCTCGGCCCGGAGCGGAGGAAGGAGTCGCCGAGGAGCAGCCTGAGGCCCCAGAGTC
TGAGACGAGCCGCCGCCGCCCCCGCCACTGCGGGGAGGAGGGGGAGGAGGAGCGGGAGGAG
GGACGAGCTGGTCGGGAGAAGAGGAAAAAAACTTTTGAGACTTTTCCGTTGCCGCTGGGAGC
CGGAGGCGCGGGGACCTCTTGGCGCGACGCTGCCCCGCGAGGAGGCAGGACTTGGGGACCCC
AGACCGCCTCCCTTTGCCGCCGGGGACGCTTGCTCCCTCCCTGCCCCCTACACGGCGTCCCTCA
GGCGCCCCCATTCCGGACCAGCCCTCGGGAGTCGCCGACCCGGCCTCCCGCAAAGACTTTTCC
CCAGACCTCGGGCGCACCCCCTGCACGCCGCCTTCATCCCCGGCCTGTCTCCTGAGCCCCCGC
GCATCCTAGACCCTTTCTCCTCCAGGAGACGGATCTCTCTCCGACCTGCCACAGATCCCCTATT
CAAGACCACCCACCTTCTGGTACCAGATCGCGCCCATCTAGGTTATTTCCGTGGGATACTGAG
ACACCCCCGGTCCAAGCCTCCCCTCCACCACTGCGCCCTTCTCCCTGAGGACCTCAGCTTTCCC
TCGAGGCCCTCCTACCTTTTGCCGGGAGACCCCCAGCCCCTGCAGGGGCGGGGCCTCCCCACC
ACACCAGCCCTGTTCGCGCTCTCGGCAGTGCCGGGGGGCGCCGCCTCCCCATGCCGCCCTCCG
GGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTGCTGACGCCTGGCCGGC
CGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATC
GAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCCAGCCCCCCGAGCCAGGGGGA
GGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTGTACAACAGCACCCGCGACCGGGT
GGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAGGCCGACTACTACGCCAAGGAGGTCA
CCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACAC
AGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTC
TCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTAC
CAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCG
CCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAA
ATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTG
GACATCAACGGGTTCACTACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGG
CCTTTCCTGCTTCTCATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCAC
CGCCGAGCCCTGGACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAG
CTGTACATTGACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCAT
GCCAACTTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTC
CTGGCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCG
CTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCCAAC
ATGATCGTGCGCTCCTGCAAGCAGCTGAGGTCCCGCCCCGCCCCGCCCCGCCCCGGCAGGCCC
GGCCCCACCCCGCCCCGCCCCCGTGCCTTGCCCATGGGGGCTGTATTTAAGGACACCCGTGCC
CCAAGCCCACCTGGGGCCCCATTAAAGATGGAGAGAGGACTGCGGATCTCTGTGTCATTGGGC
GCCTGCCTGGGGTCTCCATCCCTGACGTTCCCCACTCCCACTCCCTCTCTCTCCCTCTCTGCCTC
CTCCTGCCTGTCTGCACTATTCCTTTGCCCGGCATCAAGGCACAGGGGACCAGTGGGGAACAC
TACTGTAGTTAGATC
III. EXPERIMENTALRESULTS
3.1: The Restriction Enzyme that cuts the Given Sequence.
The name file is human.txt.(given the >gi|63025221|ref|NM_000660.3| Homo sapiens
transforming growth factor, beta 1).Fig No. 4-6
Restriction Enzyme that not cut the sequence:
AvaIII, Ava458I, AviI, AviII, AvrI, AvrII, AvrBII, BacI, Bac465I, BadI, BaeI, BaeI,
BaeI,BaeI, BalI, BamFI, BamGI, BamHI, BamKI, BamNI, BanI, BanIII, BauI, BauI, BavI, BavAI,
BavBI, BavCI,BazI, BbeI, BbeAI, BbfI, BbiI, BbiII, BbiIII, Bbi24I, BbrI, Bbr7I, Uba1211I,
Uba1212I, Uba1213I, Uba1215I, Uba1216I, Uba1217I, Uba1219I, Uba1220I, Uba1221I, Uba1222I,
Uba1224I, Uba1225I, Uba1226I, Uba1227I, Uba1229I, Uba1232I, XmaIII, XmaCI, XmaJI, XmiI,
XmlI, XmlAI, XniI, XorI, XorII, XpaI, XphI, YenI,YenAIYenBI, YenCI, YenDI, YenEI, ZhoI, ZraI,
ZrmI, Zsp2I And More than………
3.2 : Result of Bioedit Software : -
The result is obtained from bioedit software are given below
AflII 453, 561
AflIII 1326
ApoI 955, 1068
BanII 187
5. Restriction Site Finder: A Tool for …
www.ijesi.org 16 | Page
NgoGV 47, 196, 608
NlaIV 47, 196, 608
NruI 13
NspI 1330
PflMI 156
PleI 534, 787
PmeI 1052
PsiI 1122
Psp5II 874
TspRI 386, 452, 485, 734, 1027
XcmI 1237
BsrI 273, 386, 442, 475, 724
BtsI 1022
3.3 :ENZYMES THAT DO NOT CUT:
AarI, AatII, AccI, AceIII, AclI, AhdI, AloI, AlwI, AlwNI, ApaI, ApaLI, AscI, AvaIAvrII, BaeI, BaeI,
BamHI, BanI, BbvCI, Bce83I, BcefI, BcgI, BcgI, BciVI, BclI,BglI, BmgI, BmrI, Bpu10I, Bpu1102I, BsaI,
BsaAI, BsaBI, BsaHI, BseSI, BsgI, BsiEI ,BsmI, BsmBI, BsmFI, BspMI, BsrBI, BsrFI, BssHII, BssSI, BstAPI,
BstDSI, BstEII,BstXI, BstZ17I, BtrI, ClaI, DraIII, DrdI, EaeI, EagI, EcoNI, EcoRI, FseI, FspI,GdiII, HaeI,
HincII, HindIII, HpaI, HphI, KpnI, MluI, MmeI, MscI, MspA1I, MunI,NarI, NcoI, NdeI, NgoAIV, NheI, NotI,
NsiI, NspV, PacI, Pfl1108I, PinAI, PmlI,PpiI, PshAI, PstI, PvuI, PvuII, RcaI, RleAI, RsrII, SacI, SacII, SalI,
SanDI, SapI,SbfI, ScaI, SexAI, SfiI, SgfI, SgrAI, SmaI, SnaBI, SpeI, SphI, SrfI, SspI, StuI,SunI, SwaI, TaqII,
TaqII, Tth111I, VspI, XbaI, XhoI
1-To demostrate the using of restriction site finder, input file Homo sapiens transforming growth factor was
used the output file gave data for position which restriction could be foundaswellas those restriction enzyme for
which no site werwfound .
2-On further validation with bio edit when the result were comparable (please see output input File).
3-The restriction finder computes the sites of DNA sequence which are recognized by Restriction enzymes.
IV. FIGURES AND TABLES
Fig. 1- Buln end and sticky end
6. Restriction Site Finder: A Tool for …
www.ijesi.org 17 | Page
Fig. 2&3- Mechanism of R.E.action
Fig. 4- Choose The Oppition 1 or 2.
Fig 5: Choose The Options 1 result given.
7. Restriction Site Finder: A Tool for …
www.ijesi.org 18 | Page
Fig.6:Choose The Opption 2 result given
TABLE 1:Different name of Microorganism and Restriction Enzymes.
TABLE 2:It is the represented the some enzymes of recognition sequence and cut
Enzyme Source Recognition
Sequence Cut
EcoRI Escherichia coli 5'GAATTC
3'CTTAAG
5'---G AATTC---3'
3'---CTTAA G---5'
BamHI Bacillus amyloliquefaciens 5'GGATCC
3'CCTAGG
5'---G GATCC---3'
3'---CCTAG G---5'
HindIII Haemophilusinfluenzae 5'AAGCTT 5'---A AGCTT---3'