Downloaded 33 times
Uploaded byDan Gaston
Bioc4700 2014 Guest Lecture
The document discusses protein evolution, function, and human health. It provides an overview of why protein evolution matters for scientific curiosity, understanding disease, and more. It then covers major topics in protein evolution including processes like mutation and selection, as well as how protein function and structure impact evolution. Finally, it discusses practical applications like identifying disease-causing genes and mutations through an evolutionary lens.
More Related Content
Similar to Bioc4700 2014 Guest Lecture
Bioc4700 2014 Guest Lecture
- 1. PROTEIN EVOLUTION Function andHuman Health Daniel Gaston, PhD October 30th, 2014
- 2. WHY DO WECARE? whydoes all of this evolution stuff matter anyway?
- 3. Why it matters •Pure scientific curiosity • Knowledge is intrinsically valuable, regardless of applications • Critical for truly understanding function • Translating research/knowledge between model organisms • Evolution shapes population genetics • Critical for understanding how mutations cause disease
- 4. Why it matters •Ecology, ecological interactions, diversity • Antibiotic resistance • Microbiome • Cancer
- 5. Major Groups ofOrganisms Bacteria Archaea Eukaryotes
- 6. Major Groups ofOrganisms Bacteria Archaea Eukaryotes
- 7. Major Groups ofOrganisms Bacteria Archaea Eukaryotes
- 8. Major Groups ofEukaryotes You are here
- 9. A Brief Historyof Life on Earth Time 4.5B: Origin of the Earth 3 – 4B: Origin of Life 2.7B: Bacteria 1.5B: Eukaryotes 1B: Animals
- 10. Definitions • Homology • Descentfrom a common ancestor • All or nothing, no such thing as percent homology • Divergence • Change in two sequences over time, after splitting from a common ancestor • Convergence • Similarity due to independent evolutionary events • On the amino acid level: rare and difficult to prove
- 11.
- 12. Two Groups ofProcesses • Mutation • Provides raw material of evolution • Many different processes and mechanisms • Happens within individuals • Selection and Drift • Happens within populations of organisms • Affect the frequency if mutations within organisms over time
- 13. AGTCCAAGGCCTTAA -------------> AGTTCAAGGCCTTAA pointmutation CCTTA AGTCCAAGGCCTTAA insertion -------------> AGTCCAAGGCCTTACCTTAA AAGG ------------->AGTCCAAGGCCTTAA deletion AGTCC-CCTTAA AGTCCAAGGCCTTAA ` inversion AGTCCAAGGCCTTAA + GGTCCTGGAATTCAG AGTCCAAGGCC -------------> AGTCCCCTTCCTTAA -------------> translocation + AGTCCAAGGCC GGTCCTGGAATTCAGTTAA --------------> duplication AGTCCAAGGCCAGTCCAAGGCC AAGG AGTCCAAGGCCTTAA ---------------> AGTCCAAAGGCTTAA recombination AGGC
- 14. Exon1 Exon 2Exon 3 Domain 1 Domain 2 Exon1Exon 2 Exon 3 Domain 2 Domain A Exon Shuffling
- 15. Genomic Scale Mutations Gene1 Gene 2 Gene 3
- 16. Genomic Scale Mutations Gene1 Gene 2Gene 1a
- 17. Mutational Processes • Arisegenerally as unrepaired mismatches during DNA replication • Some repair processes introduce mutation • Chemical processes change non-replicating DNA • Multi-cellularity buffers from all acquired (somatic) mutations being hereditary • Humans: • de novo mutation rate of 1.2 x 10-8/nucleotide/generation • ~70 per child • Majority of paternal origin
- 18. SELECTION AND DRIFT Polmorphismsand Populations, Oh My!
- 19. Mutations, Polymorphisms, Substitutions •Mutations: Appear in individuals within a population • Sometimes in human genetics used to specifically describe pathogenic or disease causing variation • Polymorphism: An unfixed mutation of varying frequency within a population • In human genetics generally used to describe functionally neutral/benign variation. Often must have a frequency of >5% • Substitution: A fixed mutation. All individuals within a population have the mutation • Most often used when comparing one or more species
- 20. Selection and Drift •Fitness • Measured in terms of the number of offspring that survive to themselves reproduce • Positive Selection • Rare • Mutation confers some fitness advantage • Negative Selection • Frequent • Mutation confers a fitness disadvantage • Neutral • Mutation has little to no impact on fitness • Most frequent
- 21.
- 22. Genetic Drift inAction
- 23. Examples of PositiveSelection • MHC Genes • Balancing selection: favours diversity at loci • Many genes involved in metabolism and digestion • Accelerated evolution over last ~10,000 years • Adaptation to Agriculture • Human adaptations to high altitide • EPAS1, PPARA, EGLN1 (Tibetans) • CBARA1, VAV3, ARNT2, THRB (Ethiopian Highlanders) • EGLN1 (Andean Peruvians)
- 24. Mutation at theCodon Level Synonymous (Silent) Mutation: Codon still codes for the same amino acid Non-Synonymous Mutation: Codon now codes for a different amino acid (missense), premature stop codon (nonsense), or alters a start codon
- 25. PROTEIN FUNCTION AND STRUCTURE Impactson Evolution
- 26. Evolutionary Rates andConstraints • Evolution is only partially random • Mutations (quasi-random, non-uniform distribution of possibilities) • Drift (Random) • Selection (Non-random) • Evolutionary rate at the protein level is the number of fixed amino acid substitutions over evolutionary time • Measured between one or more species-level comparisons
- 27. Evolutionary Rates andConstraints • Different proteins have different overall rates of evolution • Functional necessity • Structural necessity • Number of protein-protein interactions • Different regions within a protein have different rates of evolution • Functional constraint • Structural constraint
- 28. Evolutionary Rates andConstraints
- 29. All Eukaryotes siterates (63 taxa) mapped on Lobster Enolase low rates blue high rates red
- 30. Site rate categories1 and 2 (slowest sites)
- 31. Site rates Categories3 and 4
- 32. Site rates Categories5 and 6
- 33. Site rates Categories7 and 8 (fastest sites)
- 34. Evolutionary Rate: Structure/Function Relationship •Pattern of evolution is that rates are slowest near the centre, fastest on exterior • Distance to catalytic centre • Hydrophobic packing of the interior • Spatial/size constraints in interior • More loops and alpha-helices on exterior • How does this change for structural proteins like tubulin or actin?
- 35.
- 36. Identifying Disease CausingGenes • Lynch Syndrome • Autosomal dominant cancer syndrome • Defective mismatch repair • Increased risk of many cancers, particularly colorectal
- 37. Identifying the Geneusing Evolutionary Reasoning • Inactivation of genes known to be involved in mismatch repair in E. coli and yeast lead to ‘mutator’ phenotype • Microsatellite instability observed • Searched for homologous genes in humans based on Microsatellite instability • Identified MLH1 and MSH2 • Sequenced genes in Lynch syndrome patients and identified mutations
- 38. Identifying Likely PathogenicMutations • Needle in a stack of needles (Exome and Genome Sequencing) • Individual humans ~70 new mutations • Can be hundreds to thousands of shared variants between small numbers of individuals in a family
- 39. Evolutionary Profile ofPathogenic Mutations • Highly conserved amino acids more likely to be functionally important • Highly conserved genes more likely to be indispensable • Conservation alone can be misleading • Factor in evolutionary history and relatedness of species being compared • Best tools use many sources of information and high-level machine learning
- 40. Exome Sequencing forDisease: Gastric Cancer
- 41. o Older ageof diagnosis o Often diagnosed at later stages as symptoms similar to many common diseases o 3rd leading cause of cancer death worldwide: 730,000 deaths per year
- 42. o 90% ofcases are sporadic o Most cases of familial clustering due to shared environmental factors o 60% of hereditary cases caused by mutations in the gene CDH1
- 43. Genomic Regions Number of Exomes Number of Variants<5% Allele Frequency in Regions of Interest Number With Medium or High Impact All Affected 3 14 0 Siblings Only 2 9550 525 All Variants in Exome Variants in Shared Regions Variant Frequency in Population Variant Impact Candidates
- 44.
- 45. Functional Divergence • Duplicatedgenes (paralogs) • Can diverge in function as well as sequence Gene 1 Gene 2Gene 1a
- 46. Types of FunctionalDivergence • Subfunctionalization • Specialize and retain only a subset of ancestral function • Neofunctionalization • Gain a new function, lose ancestral • Subneofunctionalization • Specialize and elaborate
- 47. Functional Divergence andProtein Families
- 48. Functional Divergence andProtein Families
- 49.
- 50.
- 51. Glyceraldehyde-3-Phosphate Dehydrogenase NAD+ NADH +Pi +H+ NAD+NADH + Pi + H+ Cytosol: Glycolysis Glyceraldehyde-3-Phosphate 1,3-Biphosphate
- 52. Glyceraldehyde-3-Phosphate Dehydrogenase NADP+ NADPH +Pi +H+ NADP+NADPH +Pi +H+ Glyceraldehyde-3-Phosphate 1,3-Biphosphate Plastid: Calvin Cycle
- 54.
- 55. Divergent and ConvergentEvolution in GAPDH • Many sites predicted to be functionally divergent • 69 in the green group (GapA/B) • 26 in GapC1 • 20 in both GapC1 and GapA/B
- 56.