The two most commonly used methods to analyze data from real-time, quantitative PCR experiments are absolute quantification and relative quantification. Absolute quantification determines the input copy number, usually by relating the PCR signal to a standard curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2−ΔΔCT method is a convenient way to analyze the relative changes in gene expression from real-time quantitative PCR experiments. The purpose of this report is to present the derivation, assumptions, and applications of the 2−ΔΔCT method. In addition, we present the derivation and applications of two variations of the 2−ΔΔCT method that may be useful in the analysis of real-time, quantitative PCR data.
The advent of the polymerase chain reaction (PCR) radically transformed biological science from the time it was first discovered (Mullis, 1990). For the first time, it allowed for specific detection and production of large amounts of DNA. PCR-based strategies have propelled huge scientific endeavors such as the Human Genome Project. The technique is currently widely used by clinicians and researchers to diagnose diseases, clone and sequence genes, and carry out sophisticated quantitative and genomic studies in a rapid and very sensitive manner. One of the most important medical applications of the classical PCR method is the detection of pathogens. In addition, the PCR assay is used in forensic medicine to identify criminals. Because of its widespread use, it is important to understand the basic principles of PCR and how its use can be modified to provide for sophisticated analysis of genes and the genome
Polymerase chain reaction introduction
Material and methods with detailed information .
Application of PCR in different fields.
Disadvantages of traditional PCR in simple way.
Video link for better understanding the PCR method.
The advent of the polymerase chain reaction (PCR) radically transformed biological science from the time it was first discovered (Mullis, 1990). For the first time, it allowed for specific detection and production of large amounts of DNA. PCR-based strategies have propelled huge scientific endeavors such as the Human Genome Project. The technique is currently widely used by clinicians and researchers to diagnose diseases, clone and sequence genes, and carry out sophisticated quantitative and genomic studies in a rapid and very sensitive manner. One of the most important medical applications of the classical PCR method is the detection of pathogens. In addition, the PCR assay is used in forensic medicine to identify criminals. Because of its widespread use, it is important to understand the basic principles of PCR and how its use can be modified to provide for sophisticated analysis of genes and the genome
Polymerase chain reaction introduction
Material and methods with detailed information .
Application of PCR in different fields.
Disadvantages of traditional PCR in simple way.
Video link for better understanding the PCR method.
b pharmacy
pharmaceutical biotechnology
Polymerase chain reaction
History
Purpose
Components of PCR
Steps of PCR
Denaturation of DNA template
Annealing of primers
Extension of ds DNA molecules
Reaction Condition & Experimental Protocol
General PCR Protocol
Application
What is PCR
Basic Requirements
Types of PCR
Asymmetric PCR
Applications of PCR
Advantages of PCR
Limitations of PCR
DNA Template
Primers
Taq polymerase
Deoxynucleoside
triphosphates(dNTPs)
Buffer solution
Divalent cations(eg.Mg2+ )
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...QIAGEN
This slidedeck introduces the concepts of real-time PCR and how to conduct a real-time PCR assay. The topics that are covered include an overview of real-time PCR chemistries, protocols, quantification methods, real-time PCR applications and factors for success.
PCR is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested.
Cell-free amplification for synthesizing multiple identical copies (billions) of any DNA of interest.
Basic tool for the molecular biologist.
The purpose of a PCR is to make a huge number of copies of a gene. As a result, it now becomes possible to analyze and characterize DNA fragments found in minute quantities in places like a drop of blood at a crime scene or a cell from an extinct dinosaur.
Like Xerox machine for gene copying.
PCR explained in simple terms - A T G & C of PCR - Question and answers PCRajithnandanam
www.technologyinscience.blogspot.com
PCR - polymerase chain reaction explained in simple question answer format. Type in your doubts on PCR in the comment.
It is called “polymerase” because the only enzyme used in this reaction is DNA polymerase.
It is called “chain” because the products of the first reaction become substrates of the following one, and so on.
b pharmacy
pharmaceutical biotechnology
Polymerase chain reaction
History
Purpose
Components of PCR
Steps of PCR
Denaturation of DNA template
Annealing of primers
Extension of ds DNA molecules
Reaction Condition & Experimental Protocol
General PCR Protocol
Application
What is PCR
Basic Requirements
Types of PCR
Asymmetric PCR
Applications of PCR
Advantages of PCR
Limitations of PCR
DNA Template
Primers
Taq polymerase
Deoxynucleoside
triphosphates(dNTPs)
Buffer solution
Divalent cations(eg.Mg2+ )
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...QIAGEN
This slidedeck introduces the concepts of real-time PCR and how to conduct a real-time PCR assay. The topics that are covered include an overview of real-time PCR chemistries, protocols, quantification methods, real-time PCR applications and factors for success.
PCR is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested.
Cell-free amplification for synthesizing multiple identical copies (billions) of any DNA of interest.
Basic tool for the molecular biologist.
The purpose of a PCR is to make a huge number of copies of a gene. As a result, it now becomes possible to analyze and characterize DNA fragments found in minute quantities in places like a drop of blood at a crime scene or a cell from an extinct dinosaur.
Like Xerox machine for gene copying.
PCR explained in simple terms - A T G & C of PCR - Question and answers PCRajithnandanam
www.technologyinscience.blogspot.com
PCR - polymerase chain reaction explained in simple question answer format. Type in your doubts on PCR in the comment.
It is called “polymerase” because the only enzyme used in this reaction is DNA polymerase.
It is called “chain” because the products of the first reaction become substrates of the following one, and so on.
What is PCR?
History of PCR
Components of PCR
Principles of PCR
Basic Requirements
Instrumentation
PCR Programme
Advantages of PCR
Applications of PCR
Conclusion
References
PCR is a method for amplifying a specific sequence of DNA from a complex mixture, without the lengthy process of cloning.
It does require the knowledge of some DNA sequence information which flanks the fragment of DNA to be amplified (target DNA).
Modeling DNA Amplification by Polymerase Chain Reaction (PCR)Danielle Snowflack
The objective of this lesson is for students to gain hands-on experience of the principles and practice of Polymerase Chain Reaction (PCR). At the completion of this activity, students should understand the process by which PCR amplifies DNA.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
How to Make a Field invisible in Odoo 17Celine George
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
The Roman Empire A Historical Colossus.pdfkaushalkr1407
The Roman Empire, a vast and enduring power, stands as one of history's most remarkable civilizations, leaving an indelible imprint on the world. It emerged from the Roman Republic, transitioning into an imperial powerhouse under the leadership of Augustus Caesar in 27 BCE. This transformation marked the beginning of an era defined by unprecedented territorial expansion, architectural marvels, and profound cultural influence.
The empire's roots lie in the city of Rome, founded, according to legend, by Romulus in 753 BCE. Over centuries, Rome evolved from a small settlement to a formidable republic, characterized by a complex political system with elected officials and checks on power. However, internal strife, class conflicts, and military ambitions paved the way for the end of the Republic. Julius Caesar’s dictatorship and subsequent assassination in 44 BCE created a power vacuum, leading to a civil war. Octavian, later Augustus, emerged victorious, heralding the Roman Empire’s birth.
Under Augustus, the empire experienced the Pax Romana, a 200-year period of relative peace and stability. Augustus reformed the military, established efficient administrative systems, and initiated grand construction projects. The empire's borders expanded, encompassing territories from Britain to Egypt and from Spain to the Euphrates. Roman legions, renowned for their discipline and engineering prowess, secured and maintained these vast territories, building roads, fortifications, and cities that facilitated control and integration.
The Roman Empire’s society was hierarchical, with a rigid class system. At the top were the patricians, wealthy elites who held significant political power. Below them were the plebeians, free citizens with limited political influence, and the vast numbers of slaves who formed the backbone of the economy. The family unit was central, governed by the paterfamilias, the male head who held absolute authority.
Culturally, the Romans were eclectic, absorbing and adapting elements from the civilizations they encountered, particularly the Greeks. Roman art, literature, and philosophy reflected this synthesis, creating a rich cultural tapestry. Latin, the Roman language, became the lingua franca of the Western world, influencing numerous modern languages.
Roman architecture and engineering achievements were monumental. They perfected the arch, vault, and dome, constructing enduring structures like the Colosseum, Pantheon, and aqueducts. These engineering marvels not only showcased Roman ingenuity but also served practical purposes, from public entertainment to water supply.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
6. Primer
3’
5’
5’
3’
Primer Anneals &
DNA Polymerase Adds
Deoxynucleoside triphosphates
37°C
Extension
New DNA strand
is created
Sequencing is performed by DNA replication
8. What if DNA extension could be terminated
at a known nucleotide using a mixture of
normal bases and termination bases
TACGTACGTACGTGT
ATGCATGCATGC????????????????????????????????????
3’ 5’
5’
Primer
DNA
Pol.
A
TACGTACGTACGTGT CG
ATGCATGCATGC????????????????????????????????????
3’ 5’
5’
Primer
A
DNA
Pol.
A
Normal base gets
incorporated
By probability termination will occur
at every “A”
16. Deoxynucleoside triphosphates
Deoxy adenosine triphosphate (dATP)
Deoxy guanosine triphosphate (dGTP)
Deoxy thymidine triphosphate (dTTP)
Deoxy cytidine triphosphate (dCTP)
Chain
Termination
3’
5’
DNA
Polymerase
Lacks a 3’ hydroxyl group.
Acts as a terminator because,
once incorporated, no other
nucelotide can be added.
X3’
5’
DNA
Polymerase
Dideoxynucleoside triphosphates
Dideoxy adenosine triphosphate (ddATP)
Dideoxy guanosine triphosphate (ddGTP)
Dideoxy thymidine triphosphate (ddTTP)
Dideoxy cytidine triphosphate (ddCTP)
Chain
Extension
17. PhD 1943
Cambridge University
Nobel Prize In Chemistry 1958
Amino acid sequence of insulin
Nobel Prize In Chemistry 1980
Sequenced the first genome, phage Φ-X174, by hand
using a method that he developed.Frederick Sanger
The Sanger Dideoxy sequencing method
was the foundation for the discovery of
PCR.
21. Why not do Sanger
sequencing at a single
base pair?
Kary B. Mullis
5’-TACGTACGTACGA
*GGAGTCCGGAATG-3’
CCTCAGGCCTTAC-5’+
ddTTP ddCTPddGTPddATP
22. First step to a Nobel Prize:
As you think, ignore obvious
problems.
23. Kary wanted to use total genomic DNA, but he
forgot the primer would likely mis-pair and ruin
his experiment. In “misguided puttering”, Kary
kept thinking!
CCTCAGGCCTTAC-5’
CCTCAGGCCTTAC-5’
CCTCAGGCCTTAC-5’
CCTCAGGCCTTAC-5’
25. What if I use two
primers for
confirmation?
+
ddTTP ddCTPddGTPddATP
3’-ATGCATGCATGCT
*CCTCAGGCCTTAC-5’
5’-GAATTCTACGTACGTACGAF-long
5’-TACGTACGTACGA
*GGAGTCCGGAATG-3’
CCTCAGGCCTTAC-5’
R-short
27. What about stray
nucleotide
triphosphates?
+
ddTTP ddCTPddGTPddATP
3’-ATGCATGCATGCT
*CCTCAGGCCTTAC-5’
5’-GAATTCTACGTACGTACGAF-long
5’-TACGTACGTACGA
*GGAGTCCGGAATG-3’
CCTCAGGCCTTAC-5’
R-short
dNTP
dNTP
28. I can destroy stray
dNTPs with alkaline
phosphatase!
But, bacterial alkaline phosphatase
will remain because it cannot
be heat killed. It will destroy the
ddNTP’s (not true).
29. Second step to a Nobel Prize:
Make up problems that
do not exist and try
to solve them.
30. I can deplete nucleotides
by adding polymerase
first without ddNTP’s
3’-ATGCATGCATGCT
*CCTCAGGCCTTAC-5’
5’-GAATTCTACGTACGTACGAF-long
5’-TACGTACGTACGA
*GGAGTCCGGAATG-3’
CCTCAGGCCTTAC-5’
R-short
dNTP
dNTP
31. Denature and anneal primers
Polymerase extension
DNA replicated!
Anderson Valley
Third step to a Nobel Prize.
Recognize PCR when
you find it.
1 Copy
2 Copies!
33. Final step to a Nobel Prize:
Try to get someone
to listen to you.
34. “…no one was particularly enthusiastic about it.”
1984 annual Cetus Scientific Meeting…..”nobody
seemed to be interested in my poster….” “People would
glance at it and keep walking.”
At first, people did not get it.
Then Joshua Lederberg (also a Nobel
Laureate) said:
“Why didn’t I think of that?”
38. Loci for Type 2 Diabetes and Triglyceride Levels
GCAGCTCACCTCCAGCTTTAGTTTTC[C/T]CATGACAGTAAGTCTATTACCCTCC
Risk allele
39. First, you need to select primers for PCR
• No, you do not need a computer program to select
primers.
• I prefer 24 bp long and end on G or C
• Others prefer 20 bp long and end on A or T
• Try to have at least 50% G’s +C’s to ensure
reasonable annealing temperature
That’s about it. Do not waste too much time selecting
primers.
48. Old School “Perkin Elmer 2400” PCR Thermocycler
Hot bonnet prevents condensation.
49. Mineral Oil
Sample
If your thermocycler does not have a hot bonnet
or if you will need to open the hot bonnet to
remove or modify a reaction, use mineral
oil.
50. Runs on antifreeze and refrigerant
Paper towels to adsorb leaking
orange-colored antifreeze.
54. New Thermocyclers = Peltier Cooling & Gradient Blocks
Peltier effect
It occurs when a current is passed through two
dissimilar metals or semiconductors (n-type and p-
type) that are connected to each other at two
junctions (Peltier junctions). The current drives a
transfer of heat from one junction to the other: one
junction cools off while the other heats up; as a
result, the effect is often used for thermoelectric
cooling. This effect was observed in 1834 by
Jean Peltier.
58. RT-PCR is like any other PCR except
it uses cDNA as a template.
59. How do you make cDNA?
cDNA can be created
from RNA using
RNA-dependent DNA
polymerase
(reverse transcriptase)
60. How do you make cDNA?
mRNA AAAAAAAAAAAA5’- -3’
TTTTTTTTTTTT-5’
mRNA AAAAAAAAAAAA5’- -3’
TTTTTTTTTTTT-5’cDNA
Reverse transcriptase Oligo (dT) Primer
Template For PCR
3’-
3’-
61. RT-PCR measures the presence
of cDNA corresponding to
its respective RNA.
RT-PCR is, therefore, used to indirectly
estimate RNA abundance which
MAY indicate the level of gene expression.
62. Major Points
• Sequencing and PCR both use DNA polymerase and
replicate DNA (PCR uses TAQ DNA polymerase).
• Kary Mullis discovered PCR while thinking about
a possible dideoxy sequencing experiment.
• Half of a Nobel discovery is finding it, the other half is
realizing what you have found.
• RT-PCR is used to estimate gene expression