Immunofluorescence : Immunofluorescence is a powerful technique that utilizes fluorescent-labeled antibodies to detect specific target antigens..
Fluorescein is a dye which emits greenish fluorescence under UV light. It can be tagged to immunoglobulin molecules.
This technique is sometimes used to make viral plaques more readily visible to the human eye.
Immunofluorescent labeled tissue sections are studied using a fluorescence microscope.
Immunofluorescence : Immunofluorescence is a powerful technique that utilizes fluorescent-labeled antibodies to detect specific target antigens..
Fluorescein is a dye which emits greenish fluorescence under UV light. It can be tagged to immunoglobulin molecules.
This technique is sometimes used to make viral plaques more readily visible to the human eye.
Immunofluorescent labeled tissue sections are studied using a fluorescence microscope.
Direct
Passive
Reverse Passive
Agglutination Inhibition
Coagglutination
Agglutination tests can be done :
On slides
In tubes
In microtritation plates
-Difference between precipitation and agglutination reaction.
Isolation and identification of salmonella &e.coliNoman Ch
This presentation is made by concerning three books. The data used in this is mainly revolve about poultry point of view.
REFERENCE
Isolation and identification of avian pathogen(AAAP)
TPHA is abbreviation of treponema pallidum hemagglutination assay to treponemal test for the serologic diagnosis of syphilis, a sexually transmitted infection caused by a Spirochetes, Treponema pallidum.
Based on the principle of passive haemagglutination, this test detects anti-treponemal antibodies (IgG and IgM antibodies) in serum or CSF.
TPHA is a good primary screening test for syphilis at all stages beyond the early primary stage.
The lecture was presented to the students of Saudi board of Community Medicine to help them know about the various serological methods applicable in the diagnosis of infectious diseases in general with attention upon the specificity and sensitivity of various diagnostic modalities. The lecture covers the basic principles of each test and the clinical applications with the advantages and disadvantages of each.
Microbiology of E coli giving basic of Escherichia coli, its morphology, cultural and biochemical characteristics, Antigenic character, pathogenesis, laboratory diagnosis, prevention and control
ELISA use an enzyme to detect the binding of antigen (Ag) antibody (Ab). • The enzyme converts a colorless substrate (chromogen) to a colored product, indicating the presence of Ag:Ab binding. • An ELISA can be used to detect either the presence of antigens or antibodies in a sample depending how the test is designed
Direct
Passive
Reverse Passive
Agglutination Inhibition
Coagglutination
Agglutination tests can be done :
On slides
In tubes
In microtritation plates
-Difference between precipitation and agglutination reaction.
Isolation and identification of salmonella &e.coliNoman Ch
This presentation is made by concerning three books. The data used in this is mainly revolve about poultry point of view.
REFERENCE
Isolation and identification of avian pathogen(AAAP)
TPHA is abbreviation of treponema pallidum hemagglutination assay to treponemal test for the serologic diagnosis of syphilis, a sexually transmitted infection caused by a Spirochetes, Treponema pallidum.
Based on the principle of passive haemagglutination, this test detects anti-treponemal antibodies (IgG and IgM antibodies) in serum or CSF.
TPHA is a good primary screening test for syphilis at all stages beyond the early primary stage.
The lecture was presented to the students of Saudi board of Community Medicine to help them know about the various serological methods applicable in the diagnosis of infectious diseases in general with attention upon the specificity and sensitivity of various diagnostic modalities. The lecture covers the basic principles of each test and the clinical applications with the advantages and disadvantages of each.
Microbiology of E coli giving basic of Escherichia coli, its morphology, cultural and biochemical characteristics, Antigenic character, pathogenesis, laboratory diagnosis, prevention and control
ELISA use an enzyme to detect the binding of antigen (Ag) antibody (Ab). • The enzyme converts a colorless substrate (chromogen) to a colored product, indicating the presence of Ag:Ab binding. • An ELISA can be used to detect either the presence of antigens or antibodies in a sample depending how the test is designed
जादू है उनकी हर एक बात मैं, याद बहुत आती है दिन और रात मैं , कल जब देखा था सपना मैने रात मैं, तब भी उनका ही हाथ था मेरा हाथ मैं .
- via bkb.ai/shayari
दिखावे की मोहब्बत तो जमाने को हैं हमसे पर,
ये दिल तो वहाँ बिकेगा जहाँ ज़ज्बातो की कदर होगी।
- via bkb.ai/shayari
कम से कम अपने बाल तो बाँध लिया करो ।
कमबख्त..
बेवजह मौसम बदल दिया करते हैं ।
- via bkb.ai/shayari
Jab Koi Khayal Dil Se Takrata Hai,Dil Na Chahkar Bhi Khamosh Rah Jata Hai,Koi Sab Kuchh Kahkar Pyar Jatata Hai,Koi Kuchh Na Kahkar Bhi Sab Bool Jata Hai.
- via bkb.ai/shayari
Immunological diagnosis of parasitic infectionRaghwendra sah
This slide is just made for the students who want note and don't get access to the book which cost more. So, hope you all will get information about the immunological diagnosis of parasitic infection.
Become an ELISA (enzyme-linked immunosorbent assay) expert! This guide includes critical review of principles, from sample preparation to data analysis, step-by-step protocols, troubleshooting tips, and more. Learn how to generate reproducible, high quality data in your ELISA tests. Slide contents include:
1. ELISA principles review
2. History of ELISA
3. General ELISA Procedure
4. Explanation of ELISA Types:
A. Direct ELISA
B. Indirect ELISA
C. Sandwich ELISA
D. Competitive ELISA
5. ELISA Data Interpretation
6. Sample Preparation for:
A. Cell Culture Supernatants
B. Cell Extracts
C. Conditioned Media
D. Tissue Extract
7. Recommended Protocols for:
A. Reagent Preparation:
1. Standard Solutions
2. Biotinylated Antibody
3. Avidin-Biotin-Peroxidase (ABC)
B. Sandwich ELISA:
1. Capture Antibody Coating
2. Blocking
3. Reagent Preparation
4. Sample (Antigen) Incubation
5. Biotinylated Antibody Incubation
6. ABC Incubation
7. Substrate Preparation
8. Signal Detection
9. Data Analysis
C. Indirect ELISA:
1. Antigen Coating
2. Blocking
3. Reagent Preparation
4. Primary Antibody Incubation
5. Secondary Antibody Incubation
6. Substrate Preparation
7. Signal Detection
8. Data Analysis
D. Direct ELISA:
1. Antigen Coating
2. Blocking
3. Reagent Preparation
4. Primary Antibody Incubation
5. Substrate Preparation
6. Signal Detection
7. Data Analysis
E. Competitive ELISA:
1. Antigen Coating
2. Blocking
3. Reagent Preparation
4. Sample (Antigen) Incubation
5. Primary Antibody Incubation
6. Secondary Antibody Incubation
7. Substrate Preparation
8. Signal Detection
9. Data Analysis
8. High Sensitivity Boster ELISA Kits
9. Cytokine Related ELISA Kits
10. Customer Testimonials
11. Additional Technical Resources
Feel free to contact support@bosterbio.com with any questions. Get better results with Boster!
Issues in Veterinary Disease Diagnosis.pptxBhoj Raj Singh
Diagnosis of a disease or a problem is the first step towards solution/ treatment/ control/ prevention.
Diagnosis is successfully. important to determine Prevalence (True prevalence, apparent prevalence) and Incidence of the disease to estimate the disease burden so that prevention and control measures can be planned and implemented.
However, in few years with the invasion of pharmaco-politics in disease control the term got vitiated.
Epidemiological Approaches for Evaluation of diagnostic tests.pptxBhoj Raj Singh
Diagnosis of a disease or a problem is the first step towards solution/ treatment. Clinical Diagnosis or Provisional Diagnosis is the first step in diagnosis and is done after a physical examination of the patient by a clinician. Clinical diagnosis may or may not be true and to reach Final diagnosis Laboratory Investigations using gross and microscopic pathological observations and determining the disease indicators are required. The diagnostic tests may be Non-dichotomous Diagnostic Tests (when continuous values are given by the test in a range starting from sub-normal to above-normal range) and Dichotomous Diagnostic Tests (when results are given either plus or minus, disease or no-disease). To make non- Dichotomous diagnostic test a Dichotomous one you need to establish the cut-off values based on reference values or Gold Standard test readings or with the use of Receiver operator characteristic (ROC) curves, Precision-Recall Curves, Likelihood Ratios, etc., and finally establishing statistical agreement (using Kappa values, Level of Agreement, χ2 Statistics) between the true diagnosis and laboratory diagnosis. Thereafter, the Accuracy, Precision, Bias, Sensitivity, Specificity, Positive Predictive value, and Negative Predictive value, of a diagnostic test are established for use in clinical practice. Diagnostic tests are also used to determine Prevalence (True prevalence, apparent prevalence) and Incidence of the disease to estimate the disease burden so that control measures can be implemented. There are several Phases in the development and use of a diagnostic assay starting from conceptualization of the diagnostic test, development and evaluation to determine flaws in diagnostic test use and Interpretation influencers. This presentation mainly deals with the epidemiological evaluation procedures for diagnostic tests.
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...Bhoj Raj Singh
The importance of learning about medicines’ and vaccines’ efficacy or effectiveness trials is not only necessary to those who are developing, producing or marketing these pharmaceutical products but to the users also because: The Emergency approval of Covid-19 vaccines and many other medicines in last few years has created so much fuss to understand the reality. The lesson learnt from Covid-19 vaccine(s) by vaccine production, marketing, vaccination and finally the revenue earned by vaccine developers and producers, and political gain by politicians, is proving deleterious to the society as several vaccine(s), useless or scarcely proven safe and useful, are going to infest and some have already infested the market (the health industry). So reading this presentation may be useful to you so that you may question the authorities if any is engaged in bluffing you. The presentation talks briefly about Prevention trials, Screening trials, Treatment trials, Feasibility studies, Pilot studies, Phases in clinical trial, Multi-arm multi-stage (MAMS) trials, Global Clinical Trials, Vaccine efficacy, Vaccine safety, Emergency Use Authorization (EUA), Serious Adverse Events (SAE), SEA rules, The Vaccine Adverse Event Reporting System (VAERS), Vaccine Safety Datalink (VSD), The Advisory Committee on Immunization Practices (ACIP), Clinical Immunization Safety Assessment (CISA), CDSCO Rules Governing Clinical Trials, Schedule Y, The Ethics Committee, Empowered Committee on Animal Health, Tracking Vaccine Quality, Pre-clinical and Clinical data, Proof of Concept, Biological License Application (BLA) and Clinical hold.
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...Bhoj Raj Singh
This presentation of my lecture, to Epidemiology students, briefs about different methods for differentiating or finding similarities among isolates of pathogens required establishing causal associations in epidemiological disease diagnosis.
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...Bhoj Raj Singh
This presentation briefly describes the Antigenic, genetic and biological diversity amongst pathogens, and their origin and emergence. It also discusses with their association with different forms associated with a disease/ outbreak. The presentation also enlists diversity in strains causing some common diseases of livestock in India.
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...Bhoj Raj Singh
Nowadays vaccination is often reported as the cause of disease outbreaks. To ward off this misconception (vaccines are made to save the masses not to risk their lives)or to understand vaccination failures, it is necessary to understand the difference between a field strain causing the disease and a vaccine strain having attenuated virulence. This presentation talks about DIVA and DISA vaccines too.
Lumpy skin disease (LSD) Globally and in India.pptxBhoj Raj Singh
LSD has emerged as a dairy industry devastating disease in India in the last four years. First noticed in Orrisa and is now present all over India. Recurring outbreaks are now noticed in Rajasthan, Uttarakhand and other states indicating that the disease is becoming endemic in India.
Molecular determinants of pathogenicity and virulence among pathogens.pptxBhoj Raj Singh
The presentation discusses the pathogenicity and virulence of pathogens, their determinants and their interaction with the host. It talks briefly about pathogenicity, virulence, adhesions, invasions, toxins, disease, pathogenesis, pathogenicity islands (PAIs), intracellular, extracellular, bacteria, virus, fungi, prion, metazoan worms, protozoa, tuberculosis, E. coli, Salmonella, Yersinia, Mycobacterium, cytotoxins, enterotoxins, exotoxins, neurotoxins, endotoxins, in-silico, in-Vitro, in-vivo, immunohistology, haemagglutinins, spike proteins, integrins, and phagolysosomes.
Molecular epidemiology and Disease causation.pptxBhoj Raj Singh
This short presentation describes molecular epidemiology, differentiate it from genetic epidemiology, and also deals with ascertaining the cause of disease.
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...Bhoj Raj Singh
The presentation relates to my three research proposals, aimed at Protection of Holy cow, rejected at ICAR-ICAR-Indian Veterinary Research Institute, Izatnagar-243 122, India, in last five years
Clinical evaluation of newly advocated therapies for brucellosis in cattle and buffaloes. Duration: September 2019 to August 2021
A cross-sectional survey of Holy Cow Infectious Problems in Gaushalas (Gaushalas are protective shelters for stray cows in India). Duration: September 2022-August 2024
Explorative study on Epidemiological determinants associated with a drastic reduction in Milk Production of Dairy Animals with reference to communicable diseases. Duration: September 2022-August 2024
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...Bhoj Raj Singh
This presentation is for
• Introspection by all authorities before criticizing Veterinarians for an increase in AMR & to Doyens of Veterinary Science sitting mum when Vets are criticized!
• To realize that DAHD and State Animal/ Livestock Departments are:
– Fake data masters!
A realization to Doyens of Veterinary Science that they are:
– Spineless when their voice is the most needed!
– Don’t understand epidemiology to the least and make minimal attempts to improve Epidemiological understanding in veterinarians!
– The real negative thinkers!
– Suffering from an inferiority complex!
– Real killers of the holy cow!
– Interested to develop the best vet doctors but creating butchers!
– Real anti-nationals!
They talk of one health without understanding it!
– Much more!!!
Causes of Disease and Preserving Health in Different systems of Medicine.pptxBhoj Raj Singh
This presentation deals with concepts of disease causation and methods used for the alleviation of those causes to ensure health. It has briefed the causes of diseases according to Ayurvedic medicine, Unani medicine, Siddham medicine, Naturopathy, Homeopathy, Chinese medicine, Touch therapy- Reiki, Mantra therapy, and Allopathy. It also summarizes the treatments and practices in different systems of medicine. DOI: 10.13140/RG.2.2.30883.22569
AMR challenges in human from animal foods- Facts and Myths.pptxBhoj Raj Singh
This presentation talks about ÄMR: A public health threat, a “silent pandemic”.
Infections caused by Antimicrobial-drug-resistant (AMR) pathogens caused >1.27 million deaths worldwide in 2019 (low level or no surveillance) and increasing year after year which may be > million in coming decades. Covid-19 caused ~6.8 million deaths in >3 years but now the pandemic is ending but the AMR pandemic has no timeline for its ending. Many deaths are also attributed to AMR pathogens.
More antibiotic use (irrespective of the sector) = More AMR.
This presentation also talks about ways and means to mitigate the AMR pandemic. 1. Stopping the blame game. All are equally responsible for the emergence of AMR, the share of developed and educated communities is much more than poor and un-educated communities.
2. Working together: On-Line Real-Time AST Data Sharing Platform for different diagnostic and research laboratories doing AST routinely.
3. Implementing not only antibiotic veterinary and medical stewardship but antimicrobial production and distribution stewardship too.
4. Educating for Environmental health not only human, plant, and animal health.
5. AMR's solution is not in searching for alternatives to antibiotics but in establishing environmental harmony.
6. More emphasis on AMR epidemiology than on AMR microbiology and pharmacology.
7. Development of understanding that bacteria and other microbes are more essential for life on earth than the human race. Microbes can live without humans, but humans can’t without microbes.
Global-Health is of prime importance than economic growth/ greediness.
Herbal antimicrobials are considered as an important alternative to antibiotic and probable tools to mitigate emerging antimicrobial-drug-resistance (AMR). However, it is difficult to accept that microbes may not adapt to herbal antimicrobials as rapidly as to antibiotics. This is now well documented that herbal antimicrobial resistance is also common among common pathogenic microbes and genes are now known to encode herbal drug-resistance too. This lecture gives description how resistance to conventional antimicrobials impacts susceptibility of microbes for herbal antimicrobials. Lecture Scheduled on 21st February 2023, In: Antimicrobial Resistance (AMR) in Foodborne pathogens” sponsored under the ICAR-NAHEP-CAAST project by the MAFSU, Mumbai Veterinary College, at the Division of Veterinary Public Health, ICAR-IVRI from 20th February to 25th February, 2023.
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...Bhoj Raj Singh
The presentation is extracted from the thesis talking about
1. The presence of Bcc organisms in the clinical infections of animals.
2. Ultrasound gels as a potential source of pathogens, especially Bcc.
3. Multidrug resistance in BCCs.
4. Lack of regulatory guidelines in Indian Pharmacopeia as existing in USP.
There are hundreds of diseases of livestock and pet animals that can be printed through properly used quality vaccines. This presentation summarises different types of vaccines used by veterinarians to control/ prevent diseases. The presentation enlists the vaccine-preventable diseases of pets and livestock, and also the different vaccines used.
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptxBhoj Raj Singh
This presentation summarises major problems of Animal Disease Control Programs ongoing in India. India is a hyperendemic country for many animal diseases and zoonotic diseases. Every year billions of rupees are spent on disease control, surveillance, monitoring, and vaccination against vaccine-preventable diseases. However, due to the failure of most animal disease control programs for one or other reasons India directly losses about 20 and 25 thousand crores annually due to endemicity of FMD & brucellosis, respectively. The presentation identifies problems at different levels of different ongoing disease control programs in India. The non-availability of authentic disease data and flaws in vaccine quality control are the biggest problems.
Animal Disease Control Programs in India.pptBhoj Raj Singh
India is a hyperendemic country for many animal diseases and zoonotic diseases. Every year billions of rupees are spent on disease control, surveillance, monitoring, and vaccination against vaccine-preventable diseases. However, due to the failure of most animal disease control programs for one or other reasons India directly losses about 20 and 25 thousand crores annually due to endemicity of FMD & brucellosis, respectively. The presentation describes the pros and cons of different ongoing disease control programs going on in India.
Control and Eradication of Animal diseases.pptxBhoj Raj Singh
The presentation details different methods and terminologies used in disease management. It briefs about different types of disease control programs run at global, regional, and national levels. It also tells about the success and failure of different disease control programs. The presentation also briefed about methods of disease control.
The presentation summarises important methods and protocols of Clinical Microbiology. It may be useful to learners of Clinical microbiology at the undergraduate label. The presentation describes the procedures for collecting clinical samples, transport, and testing. It also describes the different methods of antimicrobial susceptibility testing and standards.
Lung Cancer: Artificial Intelligence, Synergetics, Complex System Analysis, S...Oleg Kshivets
RESULTS: Overall life span (LS) was 2252.1±1742.5 days and cumulative 5-year survival (5YS) reached 73.2%, 10 years – 64.8%, 20 years – 42.5%. 513 LCP lived more than 5 years (LS=3124.6±1525.6 days), 148 LCP – more than 10 years (LS=5054.4±1504.1 days).199 LCP died because of LC (LS=562.7±374.5 days). 5YS of LCP after bi/lobectomies was significantly superior in comparison with LCP after pneumonectomies (78.1% vs.63.7%, P=0.00001 by log-rank test). AT significantly improved 5YS (66.3% vs. 34.8%) (P=0.00000 by log-rank test) only for LCP with N1-2. Cox modeling displayed that 5YS of LCP significantly depended on: phase transition (PT) early-invasive LC in terms of synergetics, PT N0—N12, cell ratio factors (ratio between cancer cells- CC and blood cells subpopulations), G1-3, histology, glucose, AT, blood cell circuit, prothrombin index, heparin tolerance, recalcification time (P=0.000-0.038). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and PT early-invasive LC (rank=1), PT N0—N12 (rank=2), thrombocytes/CC (3), erythrocytes/CC (4), eosinophils/CC (5), healthy cells/CC (6), lymphocytes/CC (7), segmented neutrophils/CC (8), stick neutrophils/CC (9), monocytes/CC (10); leucocytes/CC (11). Correct prediction of 5YS was 100% by neural networks computing (area under ROC curve=1.0; error=0.0).
CONCLUSIONS: 5YS of LCP after radical procedures significantly depended on: 1) PT early-invasive cancer; 2) PT N0--N12; 3) cell ratio factors; 4) blood cell circuit; 5) biochemical factors; 6) hemostasis system; 7) AT; 8) LC characteristics; 9) LC cell dynamics; 10) surgery type: lobectomy/pneumonectomy; 11) anthropometric data. Optimal diagnosis and treatment strategies for LC are: 1) screening and early detection of LC; 2) availability of experienced thoracic surgeons because of complexity of radical procedures; 3) aggressive en block surgery and adequate lymph node dissection for completeness; 4) precise prediction; 5) adjuvant chemoimmunoradiotherapy for LCP with unfavorable prognosis.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
These lecture slides, by Dr Sidra Arshad, offer a quick overview of physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar leads (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
Prix Galien International 2024 Forum ProgramLevi Shapiro
June 20, 2024, Prix Galien International and Jerusalem Ethics Forum in ROME. Detailed agenda including panels:
- ADVANCES IN CARDIOLOGY: A NEW PARADIGM IS COMING
- WOMEN’S HEALTH: FERTILITY PRESERVATION
- WHAT’S NEW IN THE TREATMENT OF INFECTIOUS,
ONCOLOGICAL AND INFLAMMATORY SKIN DISEASES?
- ARTIFICIAL INTELLIGENCE AND ETHICS
- GENE THERAPY
- BEYOND BORDERS: GLOBAL INITIATIVES FOR DEMOCRATIZING LIFE SCIENCE TECHNOLOGIES AND PROMOTING ACCESS TO HEALTHCARE
- ETHICAL CHALLENGES IN LIFE SCIENCES
- Prix Galien International Awards Ceremony
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
Acute scrotum is a general term referring to an emergency condition affecting the contents or the wall of the scrotum.
There are a number of conditions that present acutely, predominantly with pain and/or swelling
A careful and detailed history and examination, and in some cases, investigations allow differentiation between these diagnoses. A prompt diagnosis is essential as the patient may require urgent surgical intervention
Testicular torsion refers to twisting of the spermatic cord, causing ischaemia of the testicle.
Testicular torsion results from inadequate fixation of the testis to the tunica vaginalis producing ischemia from reduced arterial inflow and venous outflow obstruction.
The prevalence of testicular torsion in adult patients hospitalized with acute scrotal pain is approximately 25 to 50 percent
Advances in diagnosis of salmonellosis and characterization of salmonella
1. Advances in Diagnosis of
Salmonellosis and
Characterization of Salmonella
Dr. Bhoj R singh, Principal Scientist (VM)
I/C Epidemiology; Centre for Animal Disease Research and Diagnosis
Indian Veterinary Research Institute, Izatnagar-243122, Bareilly, UP, India.
TeleFax +91-581-2302188
2. Why we need early diagnosis for salmonellosis ?
• Early diagnosis means nipping the problem in bud, which
is of utmost significance because:
• Any level of Salmonella leads to decreased production.
• Treatment of Sick Animals is expensive and uneconomic
in poultry industry.
• Death of animals means loss of money and product.
• Outbreak of salmonellosis results in public backlash and
decreased sales of the associated food.
• Increased work force is required to control the outbreak.
• Sampling and testing costs a lot.
• Extra record keeping is necessary for certification and
validation.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
3. Method Accuracy Detection limit
cfu/ml
Analysis time
in hours
Ease of
handling
Standard high 1-10 48-120 Complex
Modified
conventional
High 10-100 24-60 Complex
Impedimetry Good 105
-106
24-60 Easy
Immunological high 105
-106
48-60 Intermediate
DNA probes high 103
-105
22-60 Intermediate
PCR high 102
-103
22-24 Intermediate
Real time PCR high 102
-103
2-15 Intermediate
Different methods of Salmonella Detection and their sensitivity
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
4. Salmonella Antibody detection
• Whole blood agglutination test
• Rapid plate agglutination test (RPAT)
• Standard tube agglutination test (STAT)
• Passive haemagglutination test (PHAT)
• Antiglobulin test (AGT)
• Radioimmunoassay (RIA)
• Counter immuno-electrophoresis (CIE) &
• ELISA
• dot-ELISA
• AGPT
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
5. Enzyme-linked immunosorbent assays for Salmonella Enteritidis
and other Salmonella serovars
Two main basic systems are available for detection of IgG (IgY) specific for S. Enteritidis: the
indirect ELISA and the competitive ‘sandwich type’ ELISA
The indirect ELISA involves the use of a detecting antigen coated on to the wells of a
microtitre plate. After the application of a blocking reagent to reduce nonspecific binding, test
samples are applied to the wells. Specifically bound antibody in the sample is detected by an
antibody/enzyme conjugate. A variety of antigens, including LPS, flagella, SEF14 fimbriae,
Salmonella cytotoxin I, outer membrane proteins and cruder antigen preparations have been
used.
The competitive sandwich ELISA employs a specific reagent - a monoclonal antibody
(MAb) - for coating antigen to wells. This is then followed by a pure or crude antigen
preparation. Test samples are applied followed by conjugated MAb, which will not bind to the
antigen if the sample contained specific antibodies. The assay time can be shortened by
adding both test sample and conjugate together. MAbs have been prepared for LPS, flagella
and SEF14 for S. Enteritidis.
There are advantages and disadvantages to both systems. The indirect assay is simpler and
reagents are available for all Salmonella serotypes of chickens, turkeys, ducks and
mammalian hosts. The competitive ELISA can be applied to all animal species and in
general shows higher specificity. However, reagents are not available commercially for all
serotypes. There are also some affinity problems and it may be less sensitive than the
indirect assays. In the field, both systems have produced false-positive reactions.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
6. Salmonella cytotoxin I based ELISA
(Genus specific)
• Indirect ELISA (I-ELISA) is performed to determine Salmonella cytotoxin-I specific
antibodies to asses the infections with Salmonella irrespective of infecting serovars of
the pathogens involved. Cytotoxin I has been reported in all pathogenic strains of
Salmonella serovars (Singh and Sharma, 2000). Cytotoxin I antigens is prepared (Singh
and Sharma, 1999) using a known cytotoxigenic reference culture of S. Weltevreden (S-13
and reference anti cytotoxin (Singh and Sharma, 2000) is used.
• To determine Salmonella cytotoxin I (SCI-I) antibodies in serum samples, ELISA plates are
coated with anticytotoxin (dog) and then plates are washed thrice with PBST (Phosphate
buffer saline with 0.05% Tween-20). Remaining sites are blocked with 300µl freshly
prepared 5% (w/v) skim milk. After overnight incubation at 370
C, plates are washed with
PBST thrice. Then to the wells of ELISA plates, 100µl antigen prepared at the
concentration of 10 μg protein/well in 1M Tris is added into the wells and incubated for 2 h
at 370
C. Wells are emptied and washed with PBST and to each well , a 100 µl of diluted (1:
200 in PBS with 0.1% BSA) test serum is applied in triplicate and incubated for 2 h at 370
C
as above. Wells are emptied and washed as earlier and to each well, a 100µl of suitably
diluted (1:5000 in PBS with 0.1% BSA) anti IgG (against the test animal) HRPO conjugate is
added and incubated for 2 h at 370
C, plates are washed thrice with PBST and then
apply100µl of freshly prepared substrate (Orthophenyline diamine) to each well made in
citrate phosphate buffer (pH 4.6, 0.1M) and plates are incubated for 20 min at 370
C in dark.
The reaction is stopped with100µl of IM H2SO4 in each well. O.D. of each well is read at 492
nm with ELISA reader. Serum titre is calculated as
• Average test OD – Average Negative control OD
• ELISA titre = ————————————————————— ×100
Average Negative control O.D.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
8. Salmonella cytotoxin-I based AGPT (Genus specific)
P P
P
N
N N
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
9. Widal’s Test
• Common antigens used in Widal’s test
• Bacteria `O` Antigens `H` Antigens
• Typhi 9,12 (Vi) d
• Paratyphi A 1,2,12 a
• Paratyphi B 1,4,12 b
• Paratyphi C 6,7 (Vi) c
• `O` antigens- 1,2,4,6,7,9,12
• Capsular antigen- Vi;
• `H` antigens- a,b,c,d
• Diagnostic titres:- H- 1 : 20; O- 1:50, and Vi- 1:5.
• Incubation for tests:- H- 50o
C for 2 hr then RT for >3 hrs.
• O- 37o
C for 2-4 hrs then RT overnight.
• Vi- 37o
C or RT overnight.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
10. Commercially available test kits
• TEK-ELISA (Organon Teknika, Cambridge UK)
• IFR-ELISA (Wyatt et al. 1995)
• Report-EIA & TECRA Salmonella Visual A (Wilson et al. 1990)
• Dulcitol-1-phosphate dehydrogenase (DPD) mab based kit (Tian et
al. 1996)
• Cytotoxin-1-antibodies based Salmonella detection protocol (Singh
et al. 2000)
• Chekit-S-enteritidis (ELISA) kit (Baumgartner et al. 1993)
• Polymyxin cloth enzyme immunoassay (Blais et al. 1997)
• 1-2 Test (Bio-control, Bothel, USA)
• Single step Salmonella (SSS) by Ampcor, Camden USA
• Iso-Grid ® of Dynal, Oslo
• Vi-TEK & Vi ELISA (Sharma et al. 1997)
• Meat Juice ELISA kit (Steinbach et al. 1999)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
11. Factors affecting serological diagnosis
• Useful to identify infected flocks/herds rather than to identify infected individuals.
• Serologically positive reactors may no longer be infected with Salmonella
organisms, similarly, actively excreting Salmonellae may be serologically negative.
• Newborn animals are immunologically immature and do not respond serologically.
• Chickens and neonates may also acquire Salmonella antibodies passively from
their parents without having any active infection.
• Following Salmonella infections, immunoglobulin concentrations may be so high
that it may cause prozone phenomenon.
• Necessitates differentiation between vaccine response & actual infection.
• The effect of antibiotic therapy on the serological response remains unclear.
• More than 2500 different Salmonella serovars exist. It is not easy to select an
antigen and test used.
• Serological cross-reactions between different serovars could not be conclusive
about causative serovar.
• In poultry, egg yolk may be tested for immunoglobulins to Salmonella and eggs
may provide a method to screen flocks.
• Require readymade standard antigen: you need it from outside
• Require bleeding
• Sample are fragile and lost in transit
• Sera sample may be having unknown pathogens of much more hazardous
disease for which we have never thought; Ebola, Marburg, Avian influenza,
hepatitis B, HIV
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
12. Antigen identification
• Isolation
• Electrical Impedance measurement
• Antigen Capture Immunoassays
• PCR (Saiki et al. 1985 reported First PCR)
• Capillary PCR
• Multiplex PCR
• RT-PCR
Draw backs:
• Different routes of excretion of the pathogen from
host-difficult to decide the right kind of sample to be
collected.
• Irregularity in presence of antigen in host during
disease process- antigen is present or excreted only
for short time, and in different stages.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
13. Samples
• Samples should not originate from birds or eggs that
have recently been treated with antimicrobial drugs.
They can be swabs or aseptically collected samples from
affected tissues, or intestinal and cloacal contents. Other
materials to sample include eggs, eggshell surfaces,
embryos, faecal droppings and hatcher debris, especially
fluff, dust and broken eggshells.
• The nature and quantity of the sample will depend on
whether it is taken from live poultry or carcasses, and
whether lesions or faecal contamination are present.
In case of delay, samples should be stored at 0-4°C.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
14. Steps in isolation of Salmonella
For faecal and tissue samples
• Pre-enrichment (1:10 in Buffered Peptone Water), at 35-37o
C for 18-24 hours.
• Selective enrichment broth (Tetrathionate broth, Rappaport Vassiliadis medium,
Selenite cystine medium; RV is much better, at room temp).
• Plating after 24 hour and 48 hr: on Hektoen Enteric agar with novobiocin (HEN) or
Brilliant green agar with novobiocin (BGN) or Xylose lysine citrate agar (XLT-4).
• If negative, transfer 0.1 ml to 10 ml RV after 120 hour and incubate at 37o
C for 24-48
hour and then plate as above.
• Pick up suspected colonies after 24 hour of plating on to Motility Indole Lysine (MIL)
stabs and triple sugar iron agar (TSI) slants.
• Serological confirmation.
For blood cultures: 10 ml of blood should be added to enrichment media and incubated
at 37o
C and plated daily for up to 11 days. Addition of liquoid or bile in enrichment
interferes with bactericidal action of blood and improves the Salmonella detection.
Medium of choice is 0.5 % Taurocholate or ox bile broth. Blood clots give better
results and require lesser medium. I.e. for clot from 10 ml blood 50 ml ox bile broth.
Draw backs: Take long time
Ineffective when antibiotic treatment is on
Different methods of isolation for different serovars
Intermittent excretion
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
15. Differentiation of Salmonella species and subspecies
Characters Dulcitol Lactose Sorbitol Mucate D-Tartarate Citrate Malo
nate
ONP
G
S. bongori + - + + - + - +
S. enterica ssp.
enterica
+ - + + + + - -
S. enterica ssp.
arizonae
- (-) + + - + + +
S. enterica ssp.
diarizonae
- (+) + D (-) + + +
S. enterica ssp.
houtenae
- - + - D + - -
S. enterica ssp.
indica
D (-) - + + (+) - d
S. enterica ssp.
salamae
+ + + + d + + (-)
D, delayed; ( ), variable
Other common tests are:- Indole –ve, MR +ve, VP –ve, Urease –ve, nitrate reduction +ve, Phenylalanine –ve, glucose +ve, salicin –ve, adonitol –ve,
inositol D, raffinose –ve, erythritol, esculin -ve, sucrose –ve, oxidase –ve, H2
S +(-), gelatinase –ve, lysine, ornithine +ve, arginine +ve, KCN –ve,
alginate –ve.
Common confusion occurs with Citrobacter which are lysine –ve and melibiose fermenter, a few Enterobacter may also cause some problems, they
are also usually –ve in lysine (gregoviae and aerogenes + but are + for melibiose) and for H2
S and +ve for ONPG test.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
16. Differentiation of common Salmonella serovars
Characters H2
S Lysine Ornithine D-
tartrate
Gas in
glucose
Dulcitol Maltose Rhamnose Sorbitol
Choleraesuis D + + (+) + - + + (+)
Paratyphi A - - + - + + + + +
Typhi + + + + - - + - +
Gallinarum + + - + - + + - -
Pullorum + + + - + - - + (-)
Common Sal + + + + + + + + +
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
17. Common Non-isolation Techniques
Impedance/ conductance assays
Malthus assay:- based on antibiotic added pre-enrichment followed by
selenite based enrichment and then measuring impedance in two
cells one containing trimethylamine oxide (TMAO) and dulcitol,
another cell contain lysine. Salmonella converts TMAO to TMA
(trimethylamine). The test yields 12% false negatives and 10% false
positives
BacTrac 4100 system: based on impedance splitting method
measures impedance of medium and the electrode (M and E value
respectively). Pre-enrichment is followed by novobiocin containing
RV broth enrichment and then taking M and E value for next 22 h at
40o
C. It yields 7.4% false negatives and 4.9% false positives.
Other systems are RABIT and BACTOMETER.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
18. Other methods
Antigen capture immunoassays: Sensitivity is 103
to 106
cfu per ml and most of the commercially available
ones are serovar specific.
Commercially available systems are:
PATHSTICK, EIAFOSS, VIDAS SLM, TECRA OPUS
DIPSTICKS, DYANA Beads, Magna Beads and VICAM
beads (serovar specific).
• Genus specific Antigen Capture ELISA based on
Salmonella cytotoxin-I (Singh and Sharma, 2000)
• FAT (Singh and Sharma, 2000)
• Biken test (Singh and Sharma, 2000)
Identification of antigen with these method is less sensitive
due to requirement of large number of antigen particles
in the clinical samples.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
20. Salmonella cytotoxin-I based Biken test
(Genus specific)
N
N
P
P
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
21. Serobact Salmonella Test
A simple one step latex slide agglutination test for both
clinical and food laboratories. Serobact Salmonella is a
rapid latex slide agglutination test for the identification
of Salmonella from selective enrichment broths.
Serobact latex technology is more sensitive than direct
agglutination methods and the use of Serobact
Salmonella early presumptive identification of
Salmonella spp. saving about 24 hours than using
conventional techniques.
The test exploit Polyvalent H antisera prepared against a
comprehensive range of Salmonella flagella antigens is
coated onto latex particles.
False Positive: Specificity 97.2%. Predictive negative value 100%
False Negative: Sensitivity 100%. Predictive positive value 98.2%
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
22. REVEAL for Salmonella
The test can handle one or several samples concurrently.
Contents of the sample are wicked through the pad to a
specimen reaction zone containing colloidal gold-
labeled antibodies specific to Salmonella. Reactive
Salmonella combine with the gold-labeled antibodies
and migrate through the support until they encounter a
binding reagent zone which includes a second antibody
specific to Salmonella. When this occurs, a line appears
in the test window indicating a positive result. The rest
of the sample continues to migrate until it encounters a
second binding reagent zone. This results in the
formation of a line in the control window.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
23. Transia Card Salmonella
This test is used directly on an enrichment
broth. It is on a sandwich - type,
immunochromatographic reaction using
highly- specific antibodies immobilised onto
a membrane and conjugated to a dye. This
allows the detection of all Salmonella
serotypes present in sample. It is based on
lipopolysaccharide (LPS) detection
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
24. Genus specific PCR- primers• 1. Product 163bp
P1- : TTATTAGGATCGCGCCAGGC
P2 : AAAGAATAACCGTTGTTCAC
• 2. inv product 284 bp (Oliveira et al., 2002)
139 : GTGAAATTATCGCCACGTTCGGGCAA
141 : TCATCGCACCGTCAAAGGAACC
• 3. Random genomic product 429 bp
ST 11: AGCCAACCATTGCTAAATTGGCGCA
ST 15 : GGTAGAAATTCCCAGCGGGTACT
• 4. Hin H2 flagellin gene (236 bp)
Hin 1750 L : CTAGTGCAAATTGTGACCGCA
Hin 1750 R : CCCCATCGCGCTACTGGTATC
• 5. H-li flagellin gene (173 bp)
H-li 1788 : AGCCTCGGCTACTGGTCTTG
H-li1789 R : CCGCAGCAAGAGTCACCTCA
• 6. GVV PQ fimbriae agf, product (261 bp)
TAF 3 : TCCGGCCCGGACTCAACG
TAF 4 : CAGCGCGGCGTTATACCG
• 7. inv A and inv gene (457 bp product)
S1: TGCTACAAGCATGAAATGG
S2: AAACTGGACCACGGTGACAA
• 8. Spv A gene based 450 bp product.
382: CAGACCACCAGTCCGGCAC
383: CAGTCAATGCTCTCTCGCTG
• 9. hisJ gene (Cohen et al. 1994) 496 bp product
Cohen 1: ACT GGC GTT ATC CCT TTC TCT GGT G
Cohen 2: ATC TTG TCC TGC CCC TGG TAA GAG A
• 10. invA product (Ferretti, et al., 2001) of 389 bp
Sal F GCTGCGCGCGAACGGCGAAG
Sal R TCCCGGCAGAGTTCCCATT
• 11. Fli-Typ 620 bp.
F CGGTGTTGCCCAGGTTGGTAAT
R ACTGGTAAAGATGGCT
• 12. A0 488 bp
AO1 GATACTGCTGAACGTAGAAGG
AO2 GCGTAAATCAGCATCTGCAGTAGC
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
26. Multiplex PCR for Salmonella in faeces
Amplifies 491 bp product for inv (chromosomal) gene segment,
795 bp product for spvA gene segment on virulence plasmid
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
27. Various probes for Salmonella genus
1. Random chromosomal fragemnt
• TS11: GTCACGGAAGAAGAGAAATCCGTACG Tsen et al. 1991
• TS21: TACATCGTAAAGCACCATCGCAATA
• TS31: AGACCACTGACCCAGCCTAATCAA
2. Random chromosomal fragment
• ST15 rev: GAGTACCCGCTGGGAATTTCTAC Olsen et al. 1995
• InvA gene S3: CTGGTTGATTTCCTGATCGC Stone et al. 1994
3. IS200 is not present in S. Agona, S. Arizonae, S. Dar-es-Salam, S.
Panama, S. Infantis, S. Virchow and S. I.9, 12 : Z. Detection limit for S.
Typhi is 103-4 cfu/ml. In IS 200 a tandem repeat of 0.3 kb I used for
cross hybridization (Gilbert et al. 1990). Colorimetric single phase
hybridization assay (CdorDNAH) can detect Salmonella by use of 16S
and 23 S rRNA based probes but it can not detect S. subspp. V. and
gave 7% false positive due to cross reaction with Citrobacter freundii
(Curiale et al. 1990) and detection limit is 108-109cfu/ml. It is produced
by Genetrack (earlier used radiolabelled probe but now enzyme
labelled probes are used) AOAC approved (Flowors et al., 1987).
Specificity and sensitivity of non-radioactive rRNA based
oligonucleotide probs are comparable with culture method and results
are given usually in 48 hr.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
28. Salmonella BAX System (Automated PCR)
Time to Perform: 1-hour-to-1-day
An automated system to quickly and accurately.
The BAX system cycler/detector is used to load the
prepared samples. In less than four hours, computer-
generated results are clearly displayed on the screen. A
single tablet of integrated PCR reagents combines
sample and control primers, plus reagents that overcome
inhibition in chocolate and other challenging food types.
There is no need to run a separate control. Process up to
96 samples in one batch. BAX for screening Salmonella
can work with even the most difficult samples.
Specificity 98%; Sensitivity 98%
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
29. Commercial probe based tests
• Gene-Trak Salmonella Microwell and tube
assays: Test is based on microtiter colorimetric
absorbance reading. The DNA hybridization test
employs Salmonella-specific DNA probes which
are directly labeled with horseradish peroxidase.
A colorimetric endpoint is then used for the
detection of Salmonella in food samples
following broth culture enrichment.
• Sensitivity: 1-5 CFU/25g. Testing time: 1.5 hours
(after 40 to 48 hour enrichment).
• Tests per kit: Up to 98
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
30. Real time PCR
Quantitative real-time polymerase chain reaction (PCR) provides an accurate
method for determination of levels of specific DNA and RNA sequences in
tissue and clinical samples. It is based on detection of a fluorescent signal
produced proportionally during amplification of a PCR product. Data
acquisition and analysis by real-time PCR is short due to automation. DNA
and RNA can be quantified using this detection system without laborious
post-PCR processing.
The key to the detection is estimation of fluorescence emitted either from
fluorescent probes, primers or dyes binding to dsDNA. A probe (ie, TaqMan)
is designed to anneal to the target sequence between the traditional forward
and reverse primers. The probe is labeled at the 5' end with a reporter
fluorochrome (usually 6-carboxyfluorescein [6-FAM]) and a quencher
fluorochrome (6-carboxy-tetramethyl-rhodamine [TAMRA]) added at any T
position or at the 3' end.3 The probe is designed to have a higher Tm than
the primers, and during the extension phase, the probe must be 100%
hybridized for success of the assay. As long as both fluorochromes are on
the probe, the quencher molecule stops all fluorescence by the reporter.
However, as Taq polymerase extends the primer, the intrinsic 5' to 3'
nuclease activity of Taq degrades the probe, releasing the reporter
fluorochrome. The amount of fluorescence released during the amplification
cycle is proportional to the amount of product generated in each cycle.
Although, primers originally designed for end-point PCR, works well for real
time PCR, needs standardization to have adequate specificity or sensitivity.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
31. Sources:
Chen S, Yee A, Griffiths M, et al. Int J Food Microbiol 1997;35:239-250.
Eyigor AA, and Tayfun K, Carli B. Avian Diseases: Vol. 47, No. 2, pp. 380–386
Some primers and probes used in RT-PCR of Salmonella: Although same probes
and primers can be used for diagnosis with RT-PCR as used otherwise in PCR, some
people have tried other probes and primers too
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
32. Characterization of Salmonella isolates
Virulence markers
• In vitro tests-
– Conventional &
– Molecular
• In vivo tests-
– Conventional &
– New biomodels
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
33. Conventional in vitro tests
Congo red dye binding assay
P
N
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
34. Conventional in vitro tests
DNase test
P
P
P
P
P
P
P
N
N
N
N
N
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
35. Conventional in vitro tests
Rings around mercuric chloride disk
Golden hallo around acriflavine
disks,
Ring around crystal violet disk
(All three are believed to be plasmid
mediated characterts)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
36. Effect of plasmid curing on golden hallo reaction around acrifalavine disk
Original A14 strain
A14 strain after curing
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
37. Detection of Haemolysins
Haemolysis of washed goat RBCs by S. Paratyphi E436 (A), E44b (B) and S. Typhi, E206(C), (D)
E345 strains. After incubation at 37O
C for 24 hours.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
38. Haemolysis of washed goat RBCs by S. Gallinarum S54 (A), and B haemolytic strains
of Streptococcus aureus (B, C, D). After incubation at 37O
C for 24 hours.
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
39. Molecular in vitro tests
• Virulence plasmid detection by isolation of plasmid
– Detection by PCR
– Detection by Probes
• Detection of stn gene for enterotoxin, hly/ sly gene for haemolysins
– cytolysin gene (sly A)
Sal L 1 AGG AGA TGA AAT TGG AAT CGC CA
Sal L 2 TGC CCC TGC ACC TCA ATC GTG AG
stm-O1 CGC AGG TTC TGA ATG CGG AA
STM-O2 TAA TAC CTG CTG TAG CAA GG
– Detection of stn (Product size 617 bp) gene for enterotoxin, hly/ sly gene for haemolysins etc.
Stn-1 5’ TTG TGT CGC TAT, CAC TGG CAA CC 3’
STN-2 5’ ATT CGT AAC CCG CTC TCG TCC 3’
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
41. Plasmid profiling
(Many different kinds of plasmids are there in Salmonella strains)
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
42. Conventional in vivo models
Mouse model
Retention
of urine in
chronic
salmonell
osis
Loss of
hair,
necrosis of
tail
Control
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
43. Conventional in vivo models
• 12 day old chick embryo inoculation
Healthy Intra-allantoic S. Gallinarum
inoculated on 12th
day
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
44. Conventional in vivo models
Rabbit ligated ileal loop assay
Inoculated with cytotoxic enterotoxin
Inoculated with cytotonic
enterotoxin
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
45. Conventional in vivo models
Vasopermeability factor test assay
Dermonecrosis associated with Salmonella cytotoxin Red zone associated with Salmonella enterotoxin
Negative
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar
46. New in vivo models
Germinating maize seed model
Inoculated with non-pathogenic rough S. Typhimurium
Inoculated with pathogenic S. Typhimurium
BR Singh, i/c Epidemiology , CADRAD, IVRI, Izatnagar