The presentation is extracted from the thesis talking about
1. The presence of Bcc organisms in the clinical infections of animals.
2. Ultrasound gels as a potential source of pathogens, especially Bcc.
3. Multidrug resistance in BCCs.
4. Lack of regulatory guidelines in Indian Pharmacopeia as existing in USP.
The presentation summarises important methods and protocols of Clinical Microbiology. It may be useful to learners of Clinical microbiology at the undergraduate label. The presentation describes the procedures for collecting clinical samples, transport, and testing. It also describes the different methods of antimicrobial susceptibility testing and standards.
This master's seminar presentation speaks about the role of bacteriophage in the management of different plant diseases.
It deals with the history and discovery of bacteriophages up to current research studies and usage.
The presentation summarises important methods and protocols of Clinical Microbiology. It may be useful to learners of Clinical microbiology at the undergraduate label. The presentation describes the procedures for collecting clinical samples, transport, and testing. It also describes the different methods of antimicrobial susceptibility testing and standards.
This master's seminar presentation speaks about the role of bacteriophage in the management of different plant diseases.
It deals with the history and discovery of bacteriophages up to current research studies and usage.
Comparative antimicrobial activity of aspirin, paracetamol, flunixin meglumin...Bhoj Raj Singh
• Some of the tested drugs (NSAIDs including aspirin, diclofenac, meloxicam & flunixin meglumine) possess broad-spectrum antimicrobial activity but not in therapeutically achievable non-toxic concentrations in the body. Paracetamol was the least effective as antimicrobial similar to pheniramine maleate.
• A few of the NSAIDs may be evaluated as topical use antimicrobials (aspirin, diclofenac & flunixin) being microbial growth inhibitors at 0.128% concentration, similar levels of antimicrobial drugs including antibiotics are often used in topical antiseptic preparations (gels/ ointments/creams/powders/ lotions).
• Studies should be conducted on synergism/ antagonism of NSAIDs with commonly used antibiotics and herbal antimicrobials so that antimicrobial potential of NSAIDs can be therapeutically utilized.
• Susceptibility of bacteria to NSAIDs may be an aid in the differentiation of a few bacteria like Klebsiella and Raoultella; Enterococcus and Streptococcus (meloxicam); Bacillus and Paenibacillus (Diclofenac). However, multicentric studies on a greater number of strains are essential to establish the difference.
Isolation, Characterization, and Antibiotics Resistance Profile of Staphyloco...AdeyemiKayode2
Isolation, Characterization, and Antibiotics Resistance Profile of Staphylococci from Indoor Air of the Students’ Halls of Residence at the Obafemi Awolowo University, Ile Ife, Nigeria.
Title:
Local Genes, for Local Bacteria: Global spread of Campylobacter lineages and emergence of novel regional sequence types
Abstract.
Campylobacter remains the most common cause of bacterial diarrhoeal disease worldwide, with particularly high incidence in low- and middle-income countries (LMICs). Population genomics studies have identified common lineages (sequence types) responsible for human disease and Infection source reservoirs have been identified and analysed in developed countries (e.g., poultry), however little is known about the risk factors and transmission routes in LMICs. Risk factors such as household crowding, poor sanitation, consumption of contaminated water and cohabitation with animals, all constitute potential transmission risks, but their relative importance is unknown. Signatures of adaptation can be detected in Campylobacter genomes and by using sequence data from human clinical isolates and putative source reservoirs we are able to probabilistically attribute the source of infection to model transmission networks. Recent studies in Egypt, Vietnam, and Peru provide evidence of recent acquisition and spread between hosts and identify novel lineages with high levels of antimicrobial resistance. Genomic variation of isolates from humans, animals, and food in LMICs may indicate differences in source, survival, transmission, or virulence (compared to the high income countries). By using a global outlook, differences in the core and accessory genome may explain some of the differences we observe in the global epidemiology of campylobacteriosis.
Heavy metals, particularly silver and mercury, have a variety of applications in controlling microbial population. Ps. aeruginosa is a high intrinsic resistant to antibiotics and heavy metals including Copper Sulfate, Silver Sulfate, Mercury chloride, Lead nitrate, Zinc sulfate, Cadmium sulfate, and Nickel sulfate.
Brucellosis is an important re-emerging zoonosis with a worldwide distribution, in India was recognised first in 1942.
It is still an uncontrolled serious public health problem in many developing countries including India. Brucellosis in India is yet a very common but often neglected disease.
Issues in Veterinary Disease Diagnosis.pptxBhoj Raj Singh
Diagnosis of a disease or a problem is the first step towards solution/ treatment/ control/ prevention.
Diagnosis is successfully. important to determine Prevalence (True prevalence, apparent prevalence) and Incidence of the disease to estimate the disease burden so that prevention and control measures can be planned and implemented.
However, in few years with the invasion of pharmaco-politics in disease control the term got vitiated.
Epidemiological Approaches for Evaluation of diagnostic tests.pptxBhoj Raj Singh
Diagnosis of a disease or a problem is the first step towards solution/ treatment. Clinical Diagnosis or Provisional Diagnosis is the first step in diagnosis and is done after a physical examination of the patient by a clinician. Clinical diagnosis may or may not be true and to reach Final diagnosis Laboratory Investigations using gross and microscopic pathological observations and determining the disease indicators are required. The diagnostic tests may be Non-dichotomous Diagnostic Tests (when continuous values are given by the test in a range starting from sub-normal to above-normal range) and Dichotomous Diagnostic Tests (when results are given either plus or minus, disease or no-disease). To make non- Dichotomous diagnostic test a Dichotomous one you need to establish the cut-off values based on reference values or Gold Standard test readings or with the use of Receiver operator characteristic (ROC) curves, Precision-Recall Curves, Likelihood Ratios, etc., and finally establishing statistical agreement (using Kappa values, Level of Agreement, χ2 Statistics) between the true diagnosis and laboratory diagnosis. Thereafter, the Accuracy, Precision, Bias, Sensitivity, Specificity, Positive Predictive value, and Negative Predictive value, of a diagnostic test are established for use in clinical practice. Diagnostic tests are also used to determine Prevalence (True prevalence, apparent prevalence) and Incidence of the disease to estimate the disease burden so that control measures can be implemented. There are several Phases in the development and use of a diagnostic assay starting from conceptualization of the diagnostic test, development and evaluation to determine flaws in diagnostic test use and Interpretation influencers. This presentation mainly deals with the epidemiological evaluation procedures for diagnostic tests.
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...Bhoj Raj Singh
The importance of learning about medicines’ and vaccines’ efficacy or effectiveness trials is not only necessary to those who are developing, producing or marketing these pharmaceutical products but to the users also because: The Emergency approval of Covid-19 vaccines and many other medicines in last few years has created so much fuss to understand the reality. The lesson learnt from Covid-19 vaccine(s) by vaccine production, marketing, vaccination and finally the revenue earned by vaccine developers and producers, and political gain by politicians, is proving deleterious to the society as several vaccine(s), useless or scarcely proven safe and useful, are going to infest and some have already infested the market (the health industry). So reading this presentation may be useful to you so that you may question the authorities if any is engaged in bluffing you. The presentation talks briefly about Prevention trials, Screening trials, Treatment trials, Feasibility studies, Pilot studies, Phases in clinical trial, Multi-arm multi-stage (MAMS) trials, Global Clinical Trials, Vaccine efficacy, Vaccine safety, Emergency Use Authorization (EUA), Serious Adverse Events (SAE), SEA rules, The Vaccine Adverse Event Reporting System (VAERS), Vaccine Safety Datalink (VSD), The Advisory Committee on Immunization Practices (ACIP), Clinical Immunization Safety Assessment (CISA), CDSCO Rules Governing Clinical Trials, Schedule Y, The Ethics Committee, Empowered Committee on Animal Health, Tracking Vaccine Quality, Pre-clinical and Clinical data, Proof of Concept, Biological License Application (BLA) and Clinical hold.
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...Bhoj Raj Singh
This presentation of my lecture, to Epidemiology students, briefs about different methods for differentiating or finding similarities among isolates of pathogens required establishing causal associations in epidemiological disease diagnosis.
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...Bhoj Raj Singh
This presentation briefly describes the Antigenic, genetic and biological diversity amongst pathogens, and their origin and emergence. It also discusses with their association with different forms associated with a disease/ outbreak. The presentation also enlists diversity in strains causing some common diseases of livestock in India.
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...Bhoj Raj Singh
Nowadays vaccination is often reported as the cause of disease outbreaks. To ward off this misconception (vaccines are made to save the masses not to risk their lives)or to understand vaccination failures, it is necessary to understand the difference between a field strain causing the disease and a vaccine strain having attenuated virulence. This presentation talks about DIVA and DISA vaccines too.
Lumpy skin disease (LSD) Globally and in India.pptxBhoj Raj Singh
LSD has emerged as a dairy industry devastating disease in India in the last four years. First noticed in Orrisa and is now present all over India. Recurring outbreaks are now noticed in Rajasthan, Uttarakhand and other states indicating that the disease is becoming endemic in India.
Molecular determinants of pathogenicity and virulence among pathogens.pptxBhoj Raj Singh
The presentation discusses the pathogenicity and virulence of pathogens, their determinants and their interaction with the host. It talks briefly about pathogenicity, virulence, adhesions, invasions, toxins, disease, pathogenesis, pathogenicity islands (PAIs), intracellular, extracellular, bacteria, virus, fungi, prion, metazoan worms, protozoa, tuberculosis, E. coli, Salmonella, Yersinia, Mycobacterium, cytotoxins, enterotoxins, exotoxins, neurotoxins, endotoxins, in-silico, in-Vitro, in-vivo, immunohistology, haemagglutinins, spike proteins, integrins, and phagolysosomes.
Molecular epidemiology and Disease causation.pptxBhoj Raj Singh
This short presentation describes molecular epidemiology, differentiate it from genetic epidemiology, and also deals with ascertaining the cause of disease.
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...Bhoj Raj Singh
The presentation relates to my three research proposals, aimed at Protection of Holy cow, rejected at ICAR-ICAR-Indian Veterinary Research Institute, Izatnagar-243 122, India, in last five years
Clinical evaluation of newly advocated therapies for brucellosis in cattle and buffaloes. Duration: September 2019 to August 2021
A cross-sectional survey of Holy Cow Infectious Problems in Gaushalas (Gaushalas are protective shelters for stray cows in India). Duration: September 2022-August 2024
Explorative study on Epidemiological determinants associated with a drastic reduction in Milk Production of Dairy Animals with reference to communicable diseases. Duration: September 2022-August 2024
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...Bhoj Raj Singh
This presentation is for
• Introspection by all authorities before criticizing Veterinarians for an increase in AMR & to Doyens of Veterinary Science sitting mum when Vets are criticized!
• To realize that DAHD and State Animal/ Livestock Departments are:
– Fake data masters!
A realization to Doyens of Veterinary Science that they are:
– Spineless when their voice is the most needed!
– Don’t understand epidemiology to the least and make minimal attempts to improve Epidemiological understanding in veterinarians!
– The real negative thinkers!
– Suffering from an inferiority complex!
– Real killers of the holy cow!
– Interested to develop the best vet doctors but creating butchers!
– Real anti-nationals!
They talk of one health without understanding it!
– Much more!!!
Causes of Disease and Preserving Health in Different systems of Medicine.pptxBhoj Raj Singh
This presentation deals with concepts of disease causation and methods used for the alleviation of those causes to ensure health. It has briefed the causes of diseases according to Ayurvedic medicine, Unani medicine, Siddham medicine, Naturopathy, Homeopathy, Chinese medicine, Touch therapy- Reiki, Mantra therapy, and Allopathy. It also summarizes the treatments and practices in different systems of medicine. DOI: 10.13140/RG.2.2.30883.22569
AMR challenges in human from animal foods- Facts and Myths.pptxBhoj Raj Singh
This presentation talks about ÄMR: A public health threat, a “silent pandemic”.
Infections caused by Antimicrobial-drug-resistant (AMR) pathogens caused >1.27 million deaths worldwide in 2019 (low level or no surveillance) and increasing year after year which may be > million in coming decades. Covid-19 caused ~6.8 million deaths in >3 years but now the pandemic is ending but the AMR pandemic has no timeline for its ending. Many deaths are also attributed to AMR pathogens.
More antibiotic use (irrespective of the sector) = More AMR.
This presentation also talks about ways and means to mitigate the AMR pandemic. 1. Stopping the blame game. All are equally responsible for the emergence of AMR, the share of developed and educated communities is much more than poor and un-educated communities.
2. Working together: On-Line Real-Time AST Data Sharing Platform for different diagnostic and research laboratories doing AST routinely.
3. Implementing not only antibiotic veterinary and medical stewardship but antimicrobial production and distribution stewardship too.
4. Educating for Environmental health not only human, plant, and animal health.
5. AMR's solution is not in searching for alternatives to antibiotics but in establishing environmental harmony.
6. More emphasis on AMR epidemiology than on AMR microbiology and pharmacology.
7. Development of understanding that bacteria and other microbes are more essential for life on earth than the human race. Microbes can live without humans, but humans can’t without microbes.
Global-Health is of prime importance than economic growth/ greediness.
Herbal antimicrobials are considered as an important alternative to antibiotic and probable tools to mitigate emerging antimicrobial-drug-resistance (AMR). However, it is difficult to accept that microbes may not adapt to herbal antimicrobials as rapidly as to antibiotics. This is now well documented that herbal antimicrobial resistance is also common among common pathogenic microbes and genes are now known to encode herbal drug-resistance too. This lecture gives description how resistance to conventional antimicrobials impacts susceptibility of microbes for herbal antimicrobials. Lecture Scheduled on 21st February 2023, In: Antimicrobial Resistance (AMR) in Foodborne pathogens” sponsored under the ICAR-NAHEP-CAAST project by the MAFSU, Mumbai Veterinary College, at the Division of Veterinary Public Health, ICAR-IVRI from 20th February to 25th February, 2023.
There are hundreds of diseases of livestock and pet animals that can be printed through properly used quality vaccines. This presentation summarises different types of vaccines used by veterinarians to control/ prevent diseases. The presentation enlists the vaccine-preventable diseases of pets and livestock, and also the different vaccines used.
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptxBhoj Raj Singh
This presentation summarises major problems of Animal Disease Control Programs ongoing in India. India is a hyperendemic country for many animal diseases and zoonotic diseases. Every year billions of rupees are spent on disease control, surveillance, monitoring, and vaccination against vaccine-preventable diseases. However, due to the failure of most animal disease control programs for one or other reasons India directly losses about 20 and 25 thousand crores annually due to endemicity of FMD & brucellosis, respectively. The presentation identifies problems at different levels of different ongoing disease control programs in India. The non-availability of authentic disease data and flaws in vaccine quality control are the biggest problems.
Animal Disease Control Programs in India.pptBhoj Raj Singh
India is a hyperendemic country for many animal diseases and zoonotic diseases. Every year billions of rupees are spent on disease control, surveillance, monitoring, and vaccination against vaccine-preventable diseases. However, due to the failure of most animal disease control programs for one or other reasons India directly losses about 20 and 25 thousand crores annually due to endemicity of FMD & brucellosis, respectively. The presentation describes the pros and cons of different ongoing disease control programs going on in India.
Control and Eradication of Animal diseases.pptxBhoj Raj Singh
The presentation details different methods and terminologies used in disease management. It briefs about different types of disease control programs run at global, regional, and national levels. It also tells about the success and failure of different disease control programs. The presentation also briefed about methods of disease control.
Vaccines in India- Problems and solutions.pptxBhoj Raj Singh
Vaccines and Vaccine Quality, is a very sensitive topic, especially in India where quality matters little over quantity. There are numerous problems with no or little will to solve the vaccine quality riddle. Patriotism and truth have become obsolete traits in front of greed for power.
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
micro teaching on communication m.sc nursing.pdfAnurag Sharma
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
Adv. biopharm. APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMSAkankshaAshtankar
MIP 201T & MPH 202T
ADVANCED BIOPHARMACEUTICS & PHARMACOKINETICS : UNIT 5
APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMS By - AKANKSHA ASHTANKAR
Basavarajeeyam is a Sreshta Sangraha grantha (Compiled book ), written by Neelkanta kotturu Basavaraja Virachita. It contains 25 Prakaranas, First 24 Chapters related to Rogas& 25th to Rasadravyas.
Basavarajeeyam is an important text for ayurvedic physician belonging to andhra pradehs. It is a popular compendium in various parts of our country as well as in andhra pradesh. The content of the text was presented in sanskrit and telugu language (Bilingual). One of the most famous book in ayurvedic pharmaceutics and therapeutics. This book contains 25 chapters called as prakaranas. Many rasaoushadis were explained, pioneer of dhatu druti, nadi pareeksha, mutra pareeksha etc. Belongs to the period of 15-16 century. New diseases like upadamsha, phiranga rogas are explained.
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists Saeid Safari
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from clinical samples of animals and associated environment
1. Epidemiological characterisation of Burkholderia
cepacia complex (Bcc) from clinical samples of
animals and associated environment
Work done by
Karthikeyan R
P-2206
Veterinary Public Health and Epidemiology
Thesis seminar
1
Guide/Mentor
Dr. Bhoj Raj Singh
Principal Scientist and Head,
Division of Epidemiology
3. Introduction
Burkholderia cepacia complex - One of the top 10 important antimicrobial resistant organisms
Emerging opportunistic pathogenic bacterial group – causing plethora of infections in humans
(Einarsson et al., 2019)
Major reason for nosocomial infections in immunocompromised patients (Bender et al., 2022)
Bcc is also a multidrug-resistant organism, intrinsically resistant to polymyxins, aminoglycosides,
first- and second-generation cephalosporins and antipseudomonal penicillins(Gautam et al., 2009)
3
4. Introduction
• Burkholderia cepacia complex contains a cluster of Gram-negative, oxidase-
positive, rod-shaped, non-glucose fermenting aerobic organisms
• Risk Group 2/ Biosafety Level 2 pathogen (Tavares et al., 2020)
• In environment, besides soil, Bcc can also survive and proliferate in water
bodies, lakes, rivers, sea water, drinking water, distilled water and liquids
containing small amount of nutrients (Eberl et al., 2016)
• Interestingly, B. cepacia and B. contaminans, are commonly grown from International Space Station's (ISS)
potable water dispensers (PWD) highlighting the importance of this complex group (O’Rourke et al., 2020)
4
5. • Currently, the genus includes 127 validated
species
• Burkholderia cepacia complex - closely clustered
phylogenetically related species (n=24) in the
genus
• However, numerous novel species are being
studied to be included in the Bcc classification
(Cunningham-Oakes et al., 2021)
Class: Betaproteobacteria
Order: Burkholderiales
Family: Burkholderiaceae
Genus: Burkholderia
Taxonomy
classification
5
Burkholderia
sensu lato
Burkholderia
sensu stricto
6. S. NO Species name
(Genomovars)
Natural environment Clinical Environment Chromo
somes
(assem
blies)
Plas
mids
Median
GC %
Median
genome
size (Mb)
Year of
description
1 B. ambifaria (VII) Rhizosphere, soil Cystic fibrosis (CF) (rare) 3 (86) 5 66.79 7.52 2001
2 B. anthina (VIII) Rhizosphere, soil CF (rare) 3 (32) 2 66.6 7.60 2002
3 B. arboris Rhizosphere, soil, water CF, non-CF 3 (6) - 66.8 8.27 2008
4 B. cenocepacia (III) Rhizosphere, soil, water, CF, non-CF 3 (497) 3 66.92 8.05 2003
5 B. cepacia (I) Rhizosphere, soil, water CF, medical solutions 3 (243) 2 66.60 8.60 1950
6 B. contaminans Soil, Water CF, hospital equipment, Non-CF 3 (93) 3 65.90 9.26 2009
7 B. diffusa Soil, Water CF, hospital equipment, Non-CF 3 (20) - 66.4 6.91 2008
8 B. dolosa (VI) Maize rhizosphere, plant CF 3 (26) - 67.04 6.40 2004
9 B. lata Soil, water, flower CF, non-CF 3 (19) - 66.26 8.67 2009
10 B. latens No report CF patients 3 (9) 1 66.50 6.49 2008
11 B. metallica No report CF 3 (10) - 66.9 7.62 2008
12 B. multivorans (II) Rhizosphere, soil, water CF, Chronic Granulomatous
disease, non-CF
3 (426) 2 66.69 7.00 1997
Bcc species
6
7. Bcc species
S. No Species name
(Genomovars)
Natural
environment
Clinical
Environment
Chromosomes
(assemblies)
Plas
mids
Median
GC%
Median
Genome
size (Mb)
Year of
description
15 B. pyrrocinia (IX) Rhizosphere, soil,
water, plant
CF, non-CF (rare) 3 (15) 1 66.47 7.96 2002
16 B. seminalis Rice rhizosphere CF, nosocomial
infection
3 (16) - 67.40 7.55 2008
17 B. stabilis (IV) Rhizosphere CF (rare), hospital
equipment
3 (12) 1 66.4 8.50 2000
18 B. stagnalis - - 3 (105) - 67.70 7.51 2015
19 B. territorri - - 3 (38) - 66.50 6.88 2015
20 B. ubonensis Soil Nosocomial infection 3 (309) 1 67.31 7.18 2000
21 B. vietnamiensis (V) Rhizosphere, soil,
water, animals
CF 3 (133) 5 66.84 6.93 1995
22 B. puraquae Agricultural Soil Hospital settings - (2) - 66.6 8.08 2018
23 B. catarinensis Soils - - (1) - 66.46 8.12 2017
24 B. aenigmatica 3 (8) 1 9.3 2017 7
8. Friend and Foe
• From 1971 – 2019, Bcc was associated with 111 nosocomial
outbreaks worldwide with 2390 affected patients and 240
fatalities (Hafliger et al., 2020)
• In 53.2% of reports (82 outbreaks with known causes),
outbreaks were caused by medical preparations
Spectrum of infection
• Bloodstream infections,
• Pneumonia,
• Urinary tract infections,
• Septic arthritis
• Peritonitis, etc.,
Predisposing factors in Bcc infections
• Host - immune suppression, clinical co-morbidities
• Environmental - prolonged hospital stay, central venous
access, exposure to medical devices (Rastogi et al., 2019) 8
(Mahenthiralingal et al., 2005)
9. Objectionable
microorganisms
• Bcc – feared contamination risk in water based pharmaceutical and personal care products
(Tavares et al., 2020)
• Major contaminants – sterile (Eg. IV fluids, drug vials, nebulizer solutions) and non sterile (Eg.
Ultrasound gels, nasal sprays, hand sanitizers, mouthwash)
(Jimenez et al., 2015)
• Numerous nosocomial outbreaks registered in last 2 decades has been reported
• Indicator/specified organism for nonsterile drug products (USP 60, 2019)
• Pharmaceutical products recalls –
• USFDA – 1998 to 2006 – 22% nonsterile products recalls
• 2004 to 2011 – 34% recalls due to Burkholderia cepacia (Sutton et al., 2012)
• Caused 3% of European recalls from 2005 to 2018 of non-sterile non-food products
(Cunningham-Oakes et al., 2019)
9
10. Reports of Bcc clinical
infections in animals
Disease Species Organism References
Pneumonia Horse Burkholderia cepacia Collobert et al., 1995
Vegetative
endocarditis
Horse Burkholderia cepacia
(Pseudomonas cepacia)
Travers and Van den
berg, 1995
Diarrhoea SPF piglets Burkholderia cepacia Shyu et al., 1996
Subclinical mastitis
outbreak
Sheep Burkholderia cepacia
genomovar III (7),
Burkholderia vietnamiensis
Berriatua et al., 2000
Nose Horse Burkholderia cepacia Boguta et al., 2002
visceral and
cutaneous abscesses
Ewes (4) Burkholderia cepacia Al Dughaym, 2004
Neurological signs African Grey
Parrot
Burkholderia cepacia AKKOC et al., 2008
10
11. Reports of Bcc clinical
infections in animals
Disease Species Organism References
Pneumonia Snakes Burkholderia cepacia Santos et al., 2008
Various clinical
infections
Dog, cat,
horse, cattle
Burkholderia cepacia complex Attili et al., 2013
Deep Pyoderma Dogs (6) Burkholderia cepacia complex Banovic et al., 2015
Deep pyoderma Dogs (4) Burkholderia cepacia complex Cain et al., 2018
Respiratory infection Snakes (1) Burkholderia cepacia Purbantoro et al.,
2018
Cellulitis Cats (5) Burkholderia cepacia
complex
Wong et al., 2018
Penile prolapse Stallion Burkholderia cepacia Complex Łagowski et al., 2020
11
12. Molecular Detection
• BCC bacteria can undergo selective pressure to survive in chronic patients causing the loss of their
typical phenotypic characteristics (Oderiz et al., 2011)
• Though molecular targets for identification are not reliable when used individually, a multi-target
approach is essential to improve the identification of Bcc (Ragupathi and Veeraraghavan, 2019)
• Some of the reported molecular targets are hisA, rpsU, recA and 16SrRNA
Biotyper (Bruker Daltonics)
• More recently - MALDI-TOF MS has been introduced as a key
diagnostic approach in many clinical laboratories (Gautam et al., 2016)
12
13. Molecular typing methods
• For discrimination and population analysis of
the Bcc, different molecular methods are applied
• PFGE and MLST were most common employed
methods to study the clonal association among
isolates (Angrup et al., 2022)
Typing methods References
Multilocus enzyme electrophoresis Johnson et al., 1994
PCR-ribotyping, AP-PCR and ERIC-
PCR
Liu et al., 1995
Random-amplified polymorphic DNA
(RAPD)
Mahenthiralingam et al.,
1996
Multilocus restriction typing (MLRT) Coenye and LiPuma, 2002
BOX-PCR Coenye et al., 2002
Single locus recA gene-specific
restriction-fragment length
polymorphisms (RFLP)
Cunha et al., 2003
rep-PCR Coenye and LiPuma, 2003
Multilocus sequence typing Baldwin et al., 2005
Multilocus variable-number tandem-
repeat analysis (MLVA)
Segonds et al., 2015
SNaPBcen assay Eusebio et al., 2013
Pulse field gel electrophoresis (PFGE) Yamagishi et al., 2013
13
14. Research gaps
• Significance of Burkholderia cepacia complex (Bcc) organisms in causation of
infections in animals is not established, particularly in India.
• Role of environment as source of infection in animals is not well documented
“if you don't look, you don't find”
14
15. Objectives
• To study the occurrence of Burkholderia cepacia complex (Bcc) organisms in clinical
samples of animals and associated environment
• Phenotypic characterisation of antimicrobial resistance and biofilm formation among
Bcc isolates
• To study the genetic relatedness among Bcc isolates for epidemiological inferences
15
17. AAU,
Gujarat
Nature of the
sample
No of
samples
Clinical samples 23
Environment 6
Post-mortem 0
Total 29
IVRI,
Bareilly
Nature of the
sample
No of
samples
Clinical samples 192
Environment 40
Post-mortem 32
Total 264
Private
clinic,
Bengaluru
Nature of the
sample
No of
samples
Clinical samples 6
Environment 0
Post-mortem 0
Total 6
MVC,
Chennai
Nature of the
sample
No of
samples
Clinical samples 172
Environment 32
Post-mortem 0
Total 204
Nature of infection Samples
Clinical infections
(Topical/Systemic)
395
Environment 84
Post-mortem 32
Total 511
Summary of
sample collection
17
19. Isolation and
identification
Gram-negative, oxidase-positive, non-haemolytic,
non-lactose fermenting colonies suspected as Bcc
Samples
collected
Isolation
Biochemical
Characterization
Molecular
confirmation
Inoculation of samples on to Burkholderia cepacia selective agar
(BCSA), 5% sheep blood agar and MacConkey agar
01
Testing on TSI and for motility, gelatinase, urease, ornithine, lysine
decarboxylases, utilization of malonate & citrate as carbon source
(Vandamme and Eberl, 2015)
02
Confirmation of isolates by Burkholderia genus-specific and Bcc
specific recA gene PCR
03
Confirmation by MALDI
TOF (Bruker Biotyper)
19
Partial sequencing
of recA gene
20. Primers used
in the study
Epidemiological markers detection
Primer name Primer sequence Remarks References
BCRS1 TGACCGCCGAGAAGAGCAA recA-complex specific -
1043bp fragment Mahenthiralingam et al.,
2000
BCRS2 CTCTTCTTCGTCCATCGCCTC
cblA1 5' - GCAGCTGTAGTGAACACG - 3'
cable pilin subunit gene -
237 bp
Tomich and Mohr, 2004
cblA2 5' - TCTGACCGATCGACAGCG - 3'
BCESM1 5' - CCACGGACGTGACTAACA - 3'
BCESM epidemic marker -
1418 bp
Baldwin et al., 2004
BCESM2 5' - CGTCCATCCGAACACGAT - 3'
Primer name Primer sequence Remarks References
gro1 5' - CTGGAAGACATCGCGATC - 3'
Burkholderia genus specific -
139 bp Cain et al., 2018
gro2 5' - GTCGATGATCGTCGTGTT - 3'
BCRN3 5' - GTCGCAGGCGCTGCGCAA - 3' recA – genus specific –
395 bp
Mahenthiralingam et al.,
2000
BCRN4 5' - GCGCAGCGCCTGCGACAT - 3'
hisAFor 5' - AGGACCCGGCGGCGAT - 3' histidine synthase based-
442
Identifies 17 Bcc species Papaleo et al., 2010
hisARev 5' - TGCAGCATCCCGTCGCG - 3'
recA typing
Genus and complex confirmation
20
21. Antibiotic
susceptibility assay ABST was performed with Kirby–Bauer disk diffusion test
using commercially available disks (HiMedia, Mumbai)
Disk diffusion assay (CLSI, 2020)
S.No Antimicrobials
1. Ticarcillin-Clavulanate
(75/10 mcg)
2. Ceftazidime (30 mcg)
3. Meropenem (10 mcg)
4. Minocycline (30 mcg)
5. Levofloxacin (5 mcg)
6. Sulfamethoxazole –
Trimethoprim(23.75/1.25
mcg)
7. Chloramphenicol (50 mcg)
S.No Antimicrobials S.No Antimicrobials
1. Ampicillin (10 mcg) 11. Colistin (10 mcg)
2. Amoxicillin (30 mcg) 12. Trimethoprim (30 mcg)
3. Amoxicillin+clavulanic acid
(20/10 mcg) 13. Imipenem (10 mcg)
4. Piperacillin (100 mcg) 14. EDTA
5. Piperacillin+tazobactam
(100/10 mcg) 15. Ertapenem (10 mcg)
6. Cefotaxime (30 mcg) 16. Amikacin (30 mcg)
7. cefotaxime+clavulanic acid
(30/10 mcg) 17. Kanamycin (30 mcg)
8. Ceftriaxone (30 mcg) 18. Streptomycin (300 mcg)
9. Cefepime (30 mcg) 19. Spectinomycin (100 mcg)
10.
S.
No
Antimicrobials
1.
Tetracycline (30 mcg)
2. Doxycycline (10 mcg)
3. Gatifloxacin (5 mcg)
4. Azithromycin
5. Erythromycin (15 mcg)
6. Ciprofloxacin (5 mcg)
7. Fusidic acid (30 mcg)
CLSI antibiotics
Intrinsic resistant antibiotics
Other class antibiotics
Isolates at log
phase adjusted
to 0.5 McFarland
standard
Streaked on the
MHA plate with
sterile cotton
swab.
Placed the
antibiotic discs
on the MHA
plate
Incubated the
plate at 37°C for
24 hours
Reading the zone
of inhibition
(diameter)
21
22. MIC was performed with Microbroth dilution Method
Minimum Inhibitory Concentration (MIC) assay (CLSI, 2020)
S.No Antimicrobials
1. Ceftazidime
2. Meropenem
3. Minocycline
4. Levofloxacin
5. Sulfamethoxazole –
Trimethoprim
6. Chloramphenicol
CLSI antibiotics
Wells 1 2 3 4 5 6 7 8 9 10 11 12
Antibiotics
(µg/mL)
128 64 32 16 8 4 2 1 0.5 0.25 GC MC
*GC - Growth control, BC – Broth control
Stock solutions of the
antibiotics prepared
and stored at -20°C
Working solution of
antibiotics prepared
with Muller Hinton
broth
100µL of MH broth
added to all wells in
96 well plates
100µL of antibiotic
solution added to
first well
Serial dilution of the
antibiotics till 10th
well
Add 2µL of culture
to all wells till 11th
well
Incubate the plate at
37°C for 24 hours
Antibiotic
susceptibility assay
22
23. Biofilm formation assay
Microtiter plate method
Stepanovic et al., 1999;
Hassan et al., 2019
Isolates inoculated in
TSB broth and
incubated at 37°c for
24 hours.
Cultures adjusted for
the 0.5 McFarland
standard
200µL of bacterial
suspension
inoculated in 96 well
plate
Incubated for 37°c for
24 hours.
Only broth - used as
negative control.
Content aspirated
and plates washed
three times with
250µL of sterile PBS
by vigorous shaking.
200µL of 99%
methanol added to
the well for fixation
and kept in room
temperature for 15
minutes.
Wells emptied and
left outside for drying
Staining carried out
with 200µL of 1%
crystal violet and
kept for 5 minutes.
Stain removed by
aspiration and the
excess stain was
rinsed off
Plates air dried. 160
µL of 33% glacial
acetic acid was added
to the wells and
measured OD at 570
nm.
Biofilm ability Comparison with OD Classification
Non adherent OD ≤ ODc 0
Weakly ODc < OD ≤ 2x ODc +
Moderately 2x ODc < OD ≤ 4x ODc ++
Strongly adherent 4x ODc < OD +++
Stress
Conditions
pH 5.8 6.7 7.4 8
CO2 5% CO2
Oxygen
levels
Microaerophilic
Anaerobic
Dynamic RPM 100
Biofilm formation under stress conditions
23
24. Efflux pump activity assay
- Ethidium Bromide Cart
wheel method
Isolates inoculated in TSB
broth and incubated at 37°c
for 24 hours.
Tryptic soy agar with
increasing concentrations
of ethidium bromide
(EtBr).
(1mg/L, 2mg/L and 3mg/L)
Isolates adjusted for the
0.5 McFarland standard
and streaked on the EtBr
plate with sterile cotton
swab.
Incubated for 37°c for 24
hours.
E. coli DH5α was used as
negative control.
Examined the plate under
UV gel imaging system
Martins et al., 2013
No efflux:
fluorescent growth
Active efflux:
no fluorescence
24
25. Multilocus sequence
typing (MLST)
Next generation
sequencing of Bcc
isolates (n=4)
Quality check,
trimming and
assembly of the
sequences
Submission of
assemblies to
NCBI database
NCBI Accessions
JANHBG000000000 - CPS
JANLBR000000000 – EDVCC3
JANLBS000000000 - BN1
JANLBT000000000 - IVRISURG
Analysed the
assemblies for MLST
sequences and
submitted to PubMLST
database
25
26. Pulsed field gel
electrophoresis (PFGE)
Day
1
• Cell suspension
(1.00±0.05 MacFarland
standard)
• Plug molds preparation
(cell suspension + 2%
low melting point (LMP)
agarose + Proteinase K
(20mg/ml) to prepare the
agar-cell suspension
• Cell lysis (incubated in
the water bath (55°C) for
3 hours)
• Plugs washing (2+6
Distilled water and TE
buffer)
Day
2
• Restriction digestion
• plugs were cut (size: 3×5 mm, pre-
digestion Restriction digestion (
200µL of restriction mixture
contains 178µL of sterile NFW, 20
µL restriction buffer, 1 µl of BSA
and 1 µL of enzyme XbaI (50 U/µL)
and incubated at 37°C for 3 hours.
• Running the PFGE
• 1% agarose gel, initial pulse time
of 2 s and a final pulse time of 28 s
for 20 hours angle 120o. current
gradient 6V/cm, and buffer was
maintained at 14°C
Day
3
• Staining the gel with
EtBr 500 ml of distilled
water containing 50 µl (10
mg/mL) for 40 minutes.
Washing the gel with
distilled water for 2-3
times
• Imaging the result under
UV gel doc system
• Analysis of image with
BIONUMERICS software.
• Similarity index by dice
coefficient with 1.5%
band tolerance. Cluster
analysis of the isolates
was performed UPGMA.
Drevinek et al., 2005; Ribot et al., 2006
26
28. Descriptive analysis
– animal samples
Clinical isolates details No of isolates Location Species identified
Post mortem lung swab
(pneumonia) of Sheep
1 IVRI Burkholderia cenocepacia
Canine nasal swab suspected for
Canine Distemper
1 IVRI Burkholderia cenocepacia
Nature of infection Samples Positive Isolation
rate (%)
Clinical infections
(Topical/Systemic)
395 1 0.25
Environment 84 0 0
Post-mortem 32 1 3.1
Total 511 2 0.39
Other species of bacteria identified
from the animal samples having
similar growth and biochemical
characters
• Bordatella parapertusis
• Achromobacter xylosoxidans
• Acinetobacter bereziniae
• Pseudomonas promysalinigenes
• Chryseobacterium rhizoplanae
• Pandorae apista
• Elizabethkingia anophelis
28
29. Descriptive analysis –
Ultrasound gels
56
7
63
29
3
32
0
20
40
60
80
Opened bottles Unopened bottles Total
Bcc from ultrasound gels
No of samples No of positive isolates
51.7%
42.8%
50.5%
45
9
5 4
20
7
1
4
0
5
10
15
20
25
30
35
40
45
50
Govt.
dispensaries/vet.
hospitals
Private vet clinics Human hospitals Research purposes
No of samples Number of positive isolates
44.4%
77.7%
No of isolates
No of samples
Bcc isolates distribution from Ultrasound gel
samples of different states
29
30. Burkholderia cenocepacia
44.1% (15/34)
Burkholderia
cenocepacia
(From animals)
5.8% (2/34)
Burkholderia
cepacia
29.4% (10/34)
Burkholderia
pseudomultivorans
17.6% (6/34)
Burkholderia contaminans
2.9% (1/34)
Distribution of Bcc
species
• Apart from Bcc species, the presence of
organisms like Burkholderia gladioli,
Pandorae apista, Stenotrophomonas
maltophilia, Achromobacter xylosoxidans
and Ochrabacterium intermedium was
also confirmed in the USGs.
• B. cepacia - the most commonly (71.4%)
isolated species within Bcc complex in
USGs. (Angrup et al., 2020)
• B. cenocepacia is the dominant and virulent
species of Bcc all over the world, which is
responsible for nosocomial infections and
is an important pathogen in cystic fibrosis
patients (Drevinek and Mahenthiralingam,
2010; Vial et al., 2011; Parkins and Floto,
2015). 30
31. Bcc outbreaks through
ultrasound gels
• From 1993 -2019, 14 Bcc outbreaks has been reported worldwide.
• Can occur through contamination via both intrinsic & extrinsic sources. (Viderman et al., 2020)
• In eight of the outbreaks, intrinsic contamination of the gel i.e., contamination from the
manufacturing site (Angrup et al., 2020)
• Presence of multiple Bcc species from single ultrasound gel samples are reported in polyclonal
outbreaks (Nannini et al., 2015; Dogra et al., 2021)
• Bcc is more often associated with contamination at manufacturers site (57.1%) in comparison to
extrinsic contamination (28.5%) (Albrich et al., 2008; Häfliger et al., 2020)
• Members of Bcc frequently contaminate ultrasound gel as it degrades the stabilizing agents i.e.,
parabens (phydroxybenzoic acid esters) used in the gel (Hutchinson et al., 2004)
31
32. Bcc outbreaks through
ultrasound gels
• Bacteremia and urinary tract infection (UTI) in immunocompromised patients especially in
intensive care units (ICUs) are the major outcomes of the outbreaks (Paul et al., 2016)
• Contaminated US gels provide access to sterile site in case of breach and use of invasive procedure.
• Many institutions purchase bulk containers of gel and dispense in small squeezy bottles (250- 500 ml).
• Manufacturing and expiry dates are also not mentioned on these bottles.
• These bottles are re-warmed and used.
• Hospital outbreaks of Pseudomonas aeruginosa (Chittick et al., 2013), Methicillin susceptible S.
aureus (Weist et al., 2000), Mycobacterium massiliense (Cheng et al., 2016) are also reported
through contaminated ultrasound gel.
• Seriousness of USG-mediated Bcc infections can be understood by the fact that an outbreak of Bcc
infections initiated through contaminated gels could last for 6 months (Abdelfattah et al., 2018)
32
34. Isolation and
identification
• Bcc species may require 2-3 days of incubation before colonies are seen on selective media.
• But after subculturing, the incubation time may take 24 hours.
• On MacConkey agar, Bcc colonies usually become dark pink to red due to oxidation of the lactose
after 4-7 days of incubation (Li Puma et al., 2015)
• Pigmentation can occur on general or on chemically defined growth media but is no universal
character of Burkholderia (Mavrodi et al., 2010)
• Pigmented strains can be subdivided into two types on the basis of their pigmentation:
• - yellow on glucose yeast extract peptone agar and
• -various shades of brown, red, violet, and purple (Morris and Roberts, 1959)
• Phenazine compounds - nitrogen-containing colored aromatic secondary metabolites
(Karuppiah et al., 2016)
34
35. PCR confirmation of
genus and complex
Gene
target
Function Accession number
groE Genus specific OP221242
recA Complex specific ON7202255
hisA To distinguish 17
Bcc species
OP244819
hisA – 410 bp
groE– 190 bp
100 bp
ladder
L3
recA – 395 bp
100 bp
ladder 12 13 14 15 16 17 18 19 20 21
1 2 3 4 5 6 7 8 9 10 11 22 23 24 25 26 27 28 29 30 31 32 33 34 N
12 13 14 15 16 17 18 19 20 21
1 2 3 4 5 6 7 8 9 10 11 22 23 24 25 L 26 27 28 29 30 31 32 33 34 N
• For species level identification
within Bcc hisA or recA sequencing
are reliable
(Ragupathi and Veeraraghavan, 2019)
35
36. Epidemiological
marker’s detection
Gene
target
Function Accession
number
cblA Cable pilin major subunit OP221240
esmR BCSEM Epidemic marker OP2212240
BCSEM 1418 bp
100 bp
ladder
cblA 237 bp
ladder
500bp
1000bp
L1 L2 L3 L4
Isolate ID recA typing Source cblA BCSEM
DRSW2D B. cenocepacia Ultrasound gel - -
USGMAT B.Cenocepacia Ultrasound gel - +
BVCM B. cenocepacia Ultrasound gel - +
BO1 B. cepacia Ultrasound gel - -
BN5 B. cepacia Ultrasound gel + -
OUSG B. cenocepacia Ultrasound gel - -
IVRISURG B. cenocepacia Ultrasound gel - -
IVRIGYN B. cenocepacia Ultrasound gel - -
SurgLAC B. contaminans Ultrasound gel - -
68BANGAD B. cepacia Ultrasound gel - -
IVRILPM B. cepacia Ultrasound gel - -
ECGSACM B. cenocepacia Ultrasound gel - -
PBJGD B. cepacia Sheep lung swab - +
USGNCRD B. cepacia Ultrasound gel + -
JABVCMC B. cepacia Canine nasal swab - +
DRSGB B. cepacia Ultrasound gel - -
USGPANT B. cepacia Ultrasound gel + -
USGKha B. cepacia Ultrasound gel - -
NUSG B. pseudomultivorans Ultrasound gel - -
ECGSAC B. pseudomultivorans Ultrasound gel - +
DRSW1D B. pseudomultivorans Ultrasound gel - +
BN1 B. pseudomultivorans Ultrasound gel - -
SDVCC3 B. pseudomultivorans Ultrasound gel - -
EUVCC3 B. pseudomultivorans Ultrasound gel - -
USGG B. pseudomultivorans Ultrasound gel - -
KK B. cenocepacia Ultrasound gel + +
CPS B. cenocepacia Ultrasound gel + +
IVRIVPT B. cenocepacia Ultrasound gel - +
DRSHB B. cenocepacia Ultrasound gel - +
BO3 B. cenocepacia Ultrasound gel + +
USGHIM B. cepacia Ultrasound gel + -
USGK B. cepacia Ultrasound gel - -
GDVCC3 B. cenocepacia Ultrasound gel - -
USGO B. cenocepacia Ultrasound gel - -
Total 7 11 36
37. • Many virulence factors are characterized in the Bcc, appear not to be unique because of its
homology to the other species.
• Two exclusive markers, cable pili and BCESM, had been of particular interest.
• Cable (cbl) pilus encoded by cable pilin subunit gene (cblA) mediates adherence to mucus
glycoproteins and enhances adherence to epithelial cells.
• B. cepacia epidemic strain marker” (BCESM) was identified in seven epidemic strains of the
bacteria but was not present in nonepidemic strains (Mahenthiralingam et al., 1997)
• Both are reported to be present in the highly virulent and having role in transmissibility of
Burkholderia cenocepacia epidemic clone named ET12 (Graindorge et al., 2010)
• Neither ‘marker’ is an accurate indicator of transmissibility or virulence because of its presence
in many different strains of Bcc (Govan et al., 2007)
• But due to their adaptation to challenging environments and rapid mutations, these strains
could become virulent (Depoorter et al., 2016)
Epidemiological
marker detection
37
38. recA typing MALDI-TOF
Accession
number Place State Strain Source
On subjecting to the MALDI-TOF analysis, all 100% and 85% isolates
were identified up to genus and species level, respectively.
Cohen’s kappa (k) statistics, found substantial agreement (0.63) between
recA typing and MALDI-TOF (p<.05)
recA typing
MALDI TOF results
38
39. recA typing
MALDI TOF results
• Our observations corroborated with previous reports, the MALDI-TOF analysis identified 100% of Bcc isolates
at the genus level, but at the species level accuracy was
• 76.9% (Fehlberg et al., 2013), 76% (De Dios et al., 2016)
• 90.9% (Tseng et al., 2014),
• 82% (Gautam et al., 2017)
• 40-60% - B. cenocepacia, 0% - B. cepacia (Wong et al., 2020)
• 94.3% of B. cenocepacia (Volpato et al., 2022)
• Can be overcome by combining with recA gene sequencing (Payne et al., 2005; De Volder et al., 2021)
• B. contaminans , B. pseudomultivorans lacking reference spectra on the Bruker Daltonics Biotyper system.
• MALDI-TOF could be a rapid and promising tool for the identification of BCC species, but an increased number
of spectra are needed in its database (De Dios et al., 2016)
39
43. Antibiotic Susceptibility
assay– Disk Diffusion Test
• Resistance determinants identified are encoded by the chromosomes of the respective organisms
(Rhodes and Schweizer, 2016)
• Bcc have chromosomal genes that require mutational changes before leading to resistance.
• Intrinsic resistance implies the presence of resistance mechanisms in natural or wild-type strains
that result in phenotypic resistance for all or nearly all strains.
• Environmental Bcc strains lacking mutations do not express resistance mechanisms, resulting in
low MICs to many antimicrobial agents, whereas clinical strains that express resistance genes,
have high MIC values to these same antimicrobial agents.
• Insufficient clinical evidence to confirm whether strains that test susceptible in vitro, despite the
presence of resistance mechanisms, will respond in vivo.
• Therefore, intrinsic resistance cannot be confirmed. (CLSI, 2020)
@
43
45. Antibiotic Susceptibility
assay– Disk Diffusion Test
• Antimicrobial susceptibility pattern of the Bcc isolates was found almost similar in comparison to
other studies with some differences.
• Trimethoprim-sulfamethoxazole (TMP-SMX), Levofloxacin, Meropenem, and ceftazidime can
be considered for treatment options in Bcc infections (El Chakhtoura et al., 2017)
• >95% and 85% of BCC isolates were susceptible to TMP-SMX (Chang et al., 2021; Rahman et al., 2022)
• Drug intolerance is major limitations for the TMP-SMX as therapeutic options (Tamma et al., 2018)
• Agents that were reported as susceptible in vitro did not successfully eradicate Bcc from the
bloodstream of this patient (Shalini et al., 2012; Omar et al., 2017)
• In vitro resistance to ceftazidime in Bcc isolates has been reported at approximately 10%
• Studies have reported the combination of avibactam with ceftazidime to over come the ceftazidime
resistance (Papp-Wallace et al., 2017)
• So, the combination of antibiotics is highly recommended for the treatment of Bcc
45
47. Ethidium bromide cartwheel assay
efflux pump detection
Isolate Id 1mg/L 2mg/L 3mg/L
IVRISURG + + +
CPS + + +
DRSW1D + + +
KK + + +
SurgLAC + + +
IVRIVPT + + +
1 mg/L 2 mg/L 3 mg/L
• Six isolates showed the efflux pump activity
• Relation between presence of efflux pumps and drug resistant patterns could not be established
• Reason could be resistance in Bcc are mediated not only by efflux pumps but also through different
mechanisms like restrictive porins, target mutations, and altered DNA gyrase (Podnecky et al., 2015)
• Association of over-expression of specific genes in high resistant isolates also be considered
(Martins et al., 2013; O’Regan et al., 2009)
47
50. Biofilm assay –
Microtiter Plate method
• Most Burkholderia strains can grow with as little as 0.1% oxygen
• It was studied that, under micro-oxic conditions (0.5–5% O2, i.e., conditions that mimic those
encountered in CF lung infection), B. cenocepacia produced denser biofilms (Pessi et al., 2013)
• Through transcriptomic profiling, revealed an unexpected ability of Burkholderia to persist in the
absence of oxygen and identified a novel lxa locus, which is present only in some strains, as key
determinant of this important ecophysiological trait (Sass et al., 2013)
• Observation corresponds with the ability of Burkholderia to grow in biofilms and lungs of CF
patients where oxygen was limiting, and anaerobic bacteria prevail
(Peeters et al., 2010; Tunney et al., 2008)
• Elevated CO2 levels (5% CO2) enhanced formation of biofilm with statistical significance
• Changes in pH values had no influence for all tested isolates
• Dynamic stress reduced ability of biofilm formation (Malešević et al., 2017)
50
51. Multilocus Sequence Typing
(MLST)
MLST
id
isolate species
genomo
var
Location atpD gltB gyrB recA lepA phaC trpB ST
No of
Isolates
in ST
clonal
complex
4549 CPS
Burkholderia
cenocepacia IIIA Bareilly, UP 16 11 1219 143 11 6 79 2055 2 NA
4550 IVRI_SURG
Burkholderia
pseudomultivorans Bareilly, UP 158 271 305 250 112 125 149 2069 New ST NA
4551 BN1
Burkholderia
cenocepacia IIIA Bengaluru, KA 15 11 187 143 11 6 79 232 2 31
4552 EDVCC3
Burkholderia
cenocepacia IIIB Anand, GJ 67 146 1323 49 102 117 9 2070
New ST
NA
4553 Surg_LAC
Burkholderia
contaminans V Chennai, TN 64 80 76 89 105 97 70 102 43 NA
https://pubmlst.org/organisms/burkholderia-cepacia-complex
• Due to limited resources, MLST analysis could be performed for only five of the BCC isolates
• Belonged to 3 species of Bcc. Two new STs were assigned.
• Isolate “EDVCC3” identified as genomovar IIIB, previously reported as the highly transmissible
genomovar responsible for outbreaks in CF and non-CF patients (Vandamme et al., 2003; Blatter et al., 2019)
NA – Not assigned
51
52. Relatedness of sequence
types from hospital
environment
Country Isolate Species Year ST Source
41 STs
• IPCU-A,B isolates having novel genomic island named as BcenGI15, which encodes putative
pathogenicity-associated genes.
• Mobile nature - BcenGI15 has an ability to actively excise from the genome and forming an
extrachromosomal circular form
• BcenGI15 was also present in the genome of a clinical isolate named Burkholderia
pseudomallei strain EY1 suggesting its interspecies existence (Patil et al., 2017)52
53. Strain Source
Species Year ST
Relatedness of sequence
types from India
55 STs
• A new ST 2069 reported in this study sharing the same clade to the ST 1362 reported from India in an
outbreak of Bcc in Paediatric intensive care unit (ICU) through ultrasound gel (Solaimalai et al., 2019)
53
54. Relatedness of same
sequence types reported
previously
• Glyphosate (Herbicide)-resistant Burkholderia cenocepacia isolates from a commercial Roundup ®
solution
• Tolerate high levels of glyphosate because the herbicide is not taken up by the bacteria.
• B. cenocepacia showed increased resistance to a variety of antibiotics (Hertel et al., 2021)
• ST-102 - globally distributed ST
54
Strain Source Species Year ST CC
Country
55. Population structure
analysis BURST analysis
Groups:
group: 1
ST FrequencySLV DLV SAT
232 3 2 17 13
2055 3 1 15 16
Singletons:
ST Frequency
102 43
2069 1
2070 1
Group 1
Minimum spanning tree analysis of allelic data
55
57. Genetic relatedness by
PFGE
• All the isolates produced approximately 20 – 25 fragments of DNA
• Band patterns of all the isolates were compared with dendrogram for their genetic relatedness
57
58. Isolate ID Location State recA typing Source cblA BCSEM
DRSW2D Gadag Karnataka B. cenocepacia Ultrasound gel
USGMAT Mathura Uttar Pradesh B.cenocepacia Ultrasound gel +
BVCM Mumbai Maharastra B. cenocepacia Ultrasound gel +
BO1 Bengaluru Karnataka B. cepacia Ultrasound gel
BN5 Bengaluru Karnataka B. cepacia Ultrasound gel +
OUSG Bareilly Uttar Pradesh B. cenocepacia Ultrasound gel
DRSW1D Gadag Karnataka B. cenocepacia Ultrasound gel +
IVRIGYN Bareilly Uttar Pradesh B. cenocepacia Ultrasound gel
SurgLAC Chennai Tamil Nadu B. contaminans Ultrasound gel
68BANGAD Bengaluru Karnataka B. cepacia Ultrasound gel
IVRILPM Bareilly Uttar Pradesh B. cepacia Ultrasound gel
ECGSACM Orathanadu Tamil nadu B. cenocepacia Ultrasound gel
PBJGD Bareilly Uttar Pradesh B. cepacia Sheep lung swab +
USGNCRD Gurgaon Haryana B. cepacia Ultrasound gel +
JABVCMC Bareilly Uttar Pradesh B. cepacia Canine nasal swab +
DRSGB Gadag Karnataka B. cepacia Ultrasound gel
USGPANT Pantnagar Uttarakhand B. cepacia Ultrasound gel +
USGKha Khanapara Assam B. cepacia Ultrasound gel
NUSG Chennai Tamil Nadu B. pseudomultivorans Ultrasound gel
ECGSAC Chennai Tamil Nadu B. pseudomultivorans Ultrasound gel +
USGG Gannavaram Andhra Pradesh B. pseudomultivorans Ultrasound gel
SDVCC3 Anand Gujarat B. pseudomultivorans Ultrasound gel
GDVCC3 Anand Gujarat B. pseudomultivorans Ultrasound gel
IVRISURG Bareilly Uttar Pradesh B. pseudomultivorans Ultrasound gel
BO3 Bengaluru Karnataka B. pseudomultivorans Ultrasound gel
BN1 Bengaluru Karnataka B. cenocepacia Ultrasound gel + +
CPS Bareilly Uttar Pradesh B. cenocepacia Ultrasound gel + +
IVRIVPT Bareilly Uttar Pradesh B. cenocepacia Ultrasound gel +
DRSHB Gadag Karnataka B. cenocepacia Ultrasound gel +
KK Ludhiana Punjab B. cenocepacia Ultrasound gel + +
USGHIM Palampur Himachal Pradesh B. cepacia Ultrasound gel +
USGK Sulthan Bathery Kerala B. cepacia Ultrasound gel
EDVCC3 Anand Gujarat B. cenocepacia Ultrasound gel
USGO Jabalpur Madhya Pradesh B. cenocepacia Ultrasound gel
100%
100%
100%
100%
58
59. • High diversity among the isolates were found and it suggests the circulation of different clones
in the ultrasound gels.
• Interestingly, two different isolates “BO1” and “BO3” are isolated from the opened boxes and
isolates “BN1” and “BN5” were isolated from the unopened boxes of the same veterinary care
centre. It suggests both intrinsic and extrinsic contamination.
• Bcc has been reported to contaminate USGs intrinsically at the manufacturing sites (Nannini et al.,
2015), extrinsically from the environment (Silmon et al., 2019; Solaimalai et al., 2019) or both
(Ghazal et al., 2006).
• Moreover, they belong to three different species (Burkholderia cepacia, Burkholderia cenocepcia
and Burkholderia pseudomultivorans) in recA typing.
• It suggests the co-existence of different species of Bcc.
Genetic relatedness by
PFGE
59
60. Genomic
characterisation
Isolate ID Species identified Size (bp) GC
content
(%)
Number of
Coding
Sequences
Number
of RNAs
Number of phages
identified
Intact Incomplete
EDVCC3 Burkholderia
cenocepacia
7,396,142 67.0 7446 60 5
CPS Burkholderia
cenocepacia
8,232,662 66.8 8435 61 8
BN1 Burkholderia
cenocepacia
8,407,503 66.7 8655 97 4
IVRISURG Burkholderia
pseudomultivorans
7,629,535 67.5 7599 61 1
BO1 Burkholderia
pseudomultivorans
7,779,386 67.3 7737 60 1
60
61. Discussion
Pharmaceutical products produced in India are imported by many countries
In a microbiological quality study from Tanzania, it was found that local products were less
contaminated than imported products which are generally from India (Myemba et al., 2022)
So, the contamination of the pharmaceutical products might be the reservoirs of Bcc and
could easily get disseminated between continents/countries.
Lack of monitoring of nosocomial infections especially in developing countries often
restricted the outbreaks reports of Bcc in one hospital (Du et al., 2021)
Attempts have been made to overcome the contamination by adding 0.5% chlorhexidine and 70%
ethyl alcohol (Okere et al., 2019)
61
62. Summary
• In this study, we isolated the Burkholderia cenocepacia (17), Burkholderia cepacia (10),
Burkholderia pseudomultivorans (6), Burkholderia contaminans (1) species
• From animals – 2 Burkholderia cenocepacia isolates were isolated
• From Ultrasound gels – 32 Bcc isolates identified
• MALDI-TOF could be a rapid identification tool, but the resolution upto species level could be
substantiated by recA sequencing for Bcc.
• Co-trimoxazole, levofloxacin, Meropenem and ceftazidime can be considered for treatment options
of Bcc infections
• Stress conditions could change the ability of the biofilm characteristics of Bcc isolates
• With MLST, two new STs (2069, 2070) of Bcc was identified. Circulation of epidemiologically
important STs in the ultrasound gels.
• High diversity among the isolates were found in PFGE analysis and it suggests the circulation of
different clones in the ultrasound gels.
62
63. Presence of Bcc organisms in the clinical infections of animals
is rare.
Ultrasound gels should be noticed as a potential source of pathogens,
especially Bcc.
Bcc are multidrug resistant, the appropriate identification of the pathogen
prior to the treatment with suitable antibiotics will greatly help the
response.
01
02
03
It is highly recommended to have stringent regulatory guidelines need to
be established in Indian Pharmacopeia as in USP.
The safety of medical products is of high value.
04
Conclusion
63
64. 01
Pathogenicity studies – Cell lines, Animal studies,
Galleria mellonella, Artificial sputum medium (ASM)
02
Different diagnostic methods can be developed for the accurate
identification of the Bcc species
03
Ingredients of the ultrasound gels can be examined in detail for this long-term
survival of the bacteria
04
Through phylogenomic analysis to reclassification of the genus can help as agricultural
inoculants, biocontrol agents, or bioremediation without the safety restrictions faced by
the opportunistic species
05
Combination of clinical, epidemiological, microbiological investigations
Future perspectives
65. 65
Acknowledgments
1. Dr Mudit Chandra, AP, GADVASU, Ludhiana – MALDI-TOF analysis
2. Dr Prakash Koringa, AP, AAU, Gujarat – Whole genome sequencing
3. Dr Sandeep Ghatak, PS, ICAR – RCNEHR, Meghalaya – PFGE experiment
4. Dr Porteen, AP, MVC, Chennai – Initial sample processing
5. Seniors, Juniors and Colleagues for sample collection
6. Student advisory committee (SAC) members