SlideShare a Scribd company logo
1 of 28
The Open HeliSphere ™  project True open source from the inventors of True Single Molecule Sequencing (tSMS ™) .  Aaron Kitzmiller BOSC 2008
Agenda ,[object Object],[object Object],[object Object],[object Object]
Single Molecule Sequencing by Synthesis Hybridize Primer 1 ~1/um 2 T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
Extend ‘ G’ Single Molecule Sequencing by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
Wash SM Sequence  by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
Image SM Sequence  by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
Cleave SM Sequence  by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
Flow Cell Imaging ,[object Object],[object Object],[object Object],[object Object],[object Object],Flow Cell 25 Channels (1.6 x 90 mm)‏ ~12 x 12 cm Flow cell volume = 180 µL
Raw data collection - C - A G C T - - C T - G - T A - C T - G - - A G - - A -  - - - A - C - A G C - - G - - - G - T - G - - - - - - - G  X C T A G C T A G C T A G C T A G C T A G C T A G C T A G  - C - A - C T - - C - - G C - A - - T - - C - A - - T - G  - - - A G - - A - - T - - C - A - - T - - - - A - C T - -  - - - - G - T A - - T - G - - - - - T A - - T A G - - - -
HeliScope and HeliSphere
Helicos and Open Source ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Open HeliSphere project ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Open HeliSphere project ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Bioinformatics Pipeline for Digital Gene Expression
SRF file processing ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
SMS file ,[object Object],[object Object],[object Object],read_iterator<read_record> rit(smsfile); read_record read;   //query the SMS file for desired flowcell/channel rit.select_channel(flowcell,channel);   //iterate over result set, default out format to ostream is fasta while(!rit.end()){ read = *rit; outf << read; rit++; } outf.close();
Pipeline configuration ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
DGE analysis ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
IndexDP 10mer word Template length 15, weight 10 w/sub ,[object Object],[object Object],[object Object],[object Object],ACGT AC G TA CCCGTA AAG ACGT AC A TA CCCGTA TTTACTTTACGT ACGTACATA CCCGTA AAG ACGTACATA CCCGTA TTTACTTTACGT
IndexDP ,[object Object],[object Object],[object Object],[object Object],[object Object]
QC analysis  ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Length distributions (yeast DGE experiment)‏ Raw:  Unfiltered reads, 6mer and above Filtered :  Quality score filter, AT < 0.9, BAO dinuc<0.7, trim leading Ts, length >= 20, alignment against BAO, P102 Aligned :  Normalized score >= 4 Company confidential
Error rates and alignments (yeast DGE experiment)‏ Error-rates were assessed using samples of alignments with normalized alignment score ≥4  to a high-expresser (YLR110C/CCW12)‏ 6.55% 0.44% 4.72% 1.39% Total Sub Del Ins GACGT-TATG G GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A C CGTGCTAAACAATCC Reference GACGT-TATG A GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A T CGTGCTAAACAATCC Consensus --------------------------------------------------------------------------- TGATGGTAGTAACGATGATGACGAAGA-TAA  CCCGCTG--A T CGTGCTAAACA-TC Reads GACGT-TATG A GTGATGGTAGTAACGATGATGA-GAAGA  GC-A T CGTGCTAAACA-TCC A-GTATATG A GTGATGGTAGTAACGATGATGACGAAGAATA  A T CGTGCTAAACAATCC GACGT-TATG A GTGATGGTAGTAACGATGATGACGA  AATGTAGACCCGCTGC-A T CGTGCTAAACAATCC ACGT-TATG A GTGATG-TAGTAACGATGATGACGAAGA-TAA GACGT-TATG A GT  ACGAAGA-TAATGTAGACCCGCTGCTA T CGT-CTA  GACGT-TATG A GTGATG-TA  GA-TAATGTAGACCTGC-GC-A T CGTGCTAAACAA  GACGT-TATG A GTGATG  GA-TAAT-TAGACCCGCTG--A T CGTG-TAA-CAA  GACGT-TATG A GTGATGGTAGTAACGATGATGACG
Acknowledgments  ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Original research shouldn’t start with copies
Hybrid development model Source code  repository Read-only source  code subset User-owned  packages Secure sync Company firewall
Typical closed source development Source code  repository Company firewall
Typical open source project Source code  repository Direct commit Checkout Submit patch via email
HeliScope and HeliSphere

More Related Content

What's hot

The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181Mahmoud Samir Fayed
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesGenome Reference Consortium
 
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...NMS Labs
 
PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...ISA Interchange
 
The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185Mahmoud Samir Fayed
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesGenome Reference Consortium
 
The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189Mahmoud Samir Fayed
 

What's hot (11)

The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome Assemblies
 
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
 
Gene Sequences
 Gene Sequences Gene Sequences
Gene Sequences
 
PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...
 
The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185
 
ABGT 2016 Workshop Schneider
ABGT 2016 Workshop SchneiderABGT 2016 Workshop Schneider
ABGT 2016 Workshop Schneider
 
cloning
cloningcloning
cloning
 
Cloning
CloningCloning
Cloning
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome Assemblies
 
The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189
 

Viewers also liked

Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008bosc_2008
 
The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,PARIS
 
Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008bosc_2008
 
DESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADORDESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADORMauro Bolagay
 
Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008bosc_2008
 
Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008bosc_2008
 

Viewers also liked (8)

Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008
 
The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,
 
Malaga
MalagaMalaga
Malaga
 
Mulheres de jogadores de futebol
Mulheres de jogadores de futebolMulheres de jogadores de futebol
Mulheres de jogadores de futebol
 
Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008
 
DESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADORDESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADOR
 
Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008
 
Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008
 

Similar to Kitzmiller Openhelisphereproject Bosc2008

WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisationWEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisationQuality Assistance s.a.
 
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...Lawrence kok
 
PPePR Overview Web2 Ireland
PPePR Overview Web2 IrelandPPePR Overview Web2 Ireland
PPePR Overview Web2 IrelandLiam Ó Móráin
 
Langmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomicsLangmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomicsBOSC 2010
 
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem MandalH2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem MandalSri Ambati
 
Sequenciamento de DNA
Sequenciamento de DNASequenciamento de DNA
Sequenciamento de DNAfelipes
 
Simulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in theSimulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in theIAEME Publication
 
Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009bosc
 
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...The Hive
 
Xt 2000i cell counter Autoanalyser
Xt 2000i  cell counter AutoanalyserXt 2000i  cell counter Autoanalyser
Xt 2000i cell counter Autoanalyserbabu3151
 
Analyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARNAnalyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARNAmanda Summers
 
AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)
AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)
AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)Amazon Web Services Korea
 

Similar to Kitzmiller Openhelisphereproject Bosc2008 (20)

In silico analysis for unknown data
In silico analysis for unknown dataIn silico analysis for unknown data
In silico analysis for unknown data
 
cloning
cloningcloning
cloning
 
C:\fakepath\cloning
C:\fakepath\cloningC:\fakepath\cloning
C:\fakepath\cloning
 
Cloning
CloningCloning
Cloning
 
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisationWEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
 
Similarity
SimilaritySimilarity
Similarity
 
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
 
Selection analysis using HyPhy
Selection analysis using HyPhySelection analysis using HyPhy
Selection analysis using HyPhy
 
PPePR Overview Web2 Ireland
PPePR Overview Web2 IrelandPPePR Overview Web2 Ireland
PPePR Overview Web2 Ireland
 
Langmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomicsLangmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomics
 
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem MandalH2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
 
Poster Pubblicazione
Poster PubblicazionePoster Pubblicazione
Poster Pubblicazione
 
Sequenciamento de DNA
Sequenciamento de DNASequenciamento de DNA
Sequenciamento de DNA
 
Simulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in theSimulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in the
 
Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009
 
SPgen: A Benchmark Generator for Spatial Link Discovery Tools
SPgen: A Benchmark Generator for Spatial Link Discovery ToolsSPgen: A Benchmark Generator for Spatial Link Discovery Tools
SPgen: A Benchmark Generator for Spatial Link Discovery Tools
 
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
 
Xt 2000i cell counter Autoanalyser
Xt 2000i  cell counter AutoanalyserXt 2000i  cell counter Autoanalyser
Xt 2000i cell counter Autoanalyser
 
Analyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARNAnalyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARN
 
AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)
AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)
AWS re:Invent 2017 주요 신규 서비스 분야별 요약 - 윤석찬 (AWS테크에반젤리스트)
 

More from bosc_2008

Lee Apollo Bosc2008
Lee Apollo Bosc2008Lee Apollo Bosc2008
Lee Apollo Bosc2008bosc_2008
 
Kallio Chipster Bosc2008
Kallio Chipster Bosc2008Kallio Chipster Bosc2008
Kallio Chipster Bosc2008bosc_2008
 
Introduction Bosc2008
Introduction Bosc2008Introduction Bosc2008
Introduction Bosc2008bosc_2008
 
Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008bosc_2008
 
Faga C Map Bosc2008
Faga C Map Bosc2008Faga C Map Bosc2008
Faga C Map Bosc2008bosc_2008
 
Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008bosc_2008
 
Greene Bosc2008
Greene Bosc2008Greene Bosc2008
Greene Bosc2008bosc_2008
 
Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008bosc_2008
 
Gordon Semantic Web 2008
Gordon Semantic Web 2008Gordon Semantic Web 2008
Gordon Semantic Web 2008bosc_2008
 
Menager Mobyle Bosc2008
Menager Mobyle Bosc2008Menager Mobyle Bosc2008
Menager Mobyle Bosc2008bosc_2008
 
Haider Embrace Bosc2008
Haider Embrace Bosc2008Haider Embrace Bosc2008
Haider Embrace Bosc2008bosc_2008
 
Antao Biopython Bosc2008
Antao Biopython Bosc2008Antao Biopython Bosc2008
Antao Biopython Bosc2008bosc_2008
 
Banks Genographer Bosc2008
Banks Genographer Bosc2008Banks Genographer Bosc2008
Banks Genographer Bosc2008bosc_2008
 
Wilson Make Bosc2008
Wilson Make Bosc2008Wilson Make Bosc2008
Wilson Make Bosc2008bosc_2008
 
Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008bosc_2008
 
O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008bosc_2008
 

More from bosc_2008 (16)

Lee Apollo Bosc2008
Lee Apollo Bosc2008Lee Apollo Bosc2008
Lee Apollo Bosc2008
 
Kallio Chipster Bosc2008
Kallio Chipster Bosc2008Kallio Chipster Bosc2008
Kallio Chipster Bosc2008
 
Introduction Bosc2008
Introduction Bosc2008Introduction Bosc2008
Introduction Bosc2008
 
Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008
 
Faga C Map Bosc2008
Faga C Map Bosc2008Faga C Map Bosc2008
Faga C Map Bosc2008
 
Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008
 
Greene Bosc2008
Greene Bosc2008Greene Bosc2008
Greene Bosc2008
 
Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008
 
Gordon Semantic Web 2008
Gordon Semantic Web 2008Gordon Semantic Web 2008
Gordon Semantic Web 2008
 
Menager Mobyle Bosc2008
Menager Mobyle Bosc2008Menager Mobyle Bosc2008
Menager Mobyle Bosc2008
 
Haider Embrace Bosc2008
Haider Embrace Bosc2008Haider Embrace Bosc2008
Haider Embrace Bosc2008
 
Antao Biopython Bosc2008
Antao Biopython Bosc2008Antao Biopython Bosc2008
Antao Biopython Bosc2008
 
Banks Genographer Bosc2008
Banks Genographer Bosc2008Banks Genographer Bosc2008
Banks Genographer Bosc2008
 
Wilson Make Bosc2008
Wilson Make Bosc2008Wilson Make Bosc2008
Wilson Make Bosc2008
 
Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008
 
O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008
 

Recently uploaded

ADP Passwordless Journey Case Study.pptx
ADP Passwordless Journey Case Study.pptxADP Passwordless Journey Case Study.pptx
ADP Passwordless Journey Case Study.pptxFIDO Alliance
 
Introduction to FIDO Authentication and Passkeys.pptx
Introduction to FIDO Authentication and Passkeys.pptxIntroduction to FIDO Authentication and Passkeys.pptx
Introduction to FIDO Authentication and Passkeys.pptxFIDO Alliance
 
Event-Driven Architecture Masterclass: Challenges in Stream Processing
Event-Driven Architecture Masterclass: Challenges in Stream ProcessingEvent-Driven Architecture Masterclass: Challenges in Stream Processing
Event-Driven Architecture Masterclass: Challenges in Stream ProcessingScyllaDB
 
Portal Kombat : extension du réseau de propagande russe
Portal Kombat : extension du réseau de propagande russePortal Kombat : extension du réseau de propagande russe
Portal Kombat : extension du réseau de propagande russe中 央社
 
AI mind or machine power point presentation
AI mind or machine power point presentationAI mind or machine power point presentation
AI mind or machine power point presentationyogeshlabana357357
 
Google I/O Extended 2024 Warsaw
Google I/O Extended 2024 WarsawGoogle I/O Extended 2024 Warsaw
Google I/O Extended 2024 WarsawGDSC PJATK
 
Simplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdf
Simplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdfSimplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdf
Simplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdfFIDO Alliance
 
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdfLinux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdfFIDO Alliance
 
Hyatt driving innovation and exceptional customer experiences with FIDO passw...
Hyatt driving innovation and exceptional customer experiences with FIDO passw...Hyatt driving innovation and exceptional customer experiences with FIDO passw...
Hyatt driving innovation and exceptional customer experiences with FIDO passw...FIDO Alliance
 
Intro in Product Management - Коротко про професію продакт менеджера
Intro in Product Management - Коротко про професію продакт менеджераIntro in Product Management - Коротко про професію продакт менеджера
Intro in Product Management - Коротко про професію продакт менеджераMark Opanasiuk
 
Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...
Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...
Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...FIDO Alliance
 
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...marcuskenyatta275
 
WebRTC and SIP not just audio and video @ OpenSIPS 2024
WebRTC and SIP not just audio and video @ OpenSIPS 2024WebRTC and SIP not just audio and video @ OpenSIPS 2024
WebRTC and SIP not just audio and video @ OpenSIPS 2024Lorenzo Miniero
 
Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...
Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...
Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...panagenda
 
Your enemies use GenAI too - staying ahead of fraud with Neo4j
Your enemies use GenAI too - staying ahead of fraud with Neo4jYour enemies use GenAI too - staying ahead of fraud with Neo4j
Your enemies use GenAI too - staying ahead of fraud with Neo4jNeo4j
 
ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...
ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...
ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...FIDO Alliance
 
Collecting & Temporal Analysis of Behavioral Web Data - Tales From The Inside
Collecting & Temporal Analysis of Behavioral Web Data - Tales From The InsideCollecting & Temporal Analysis of Behavioral Web Data - Tales From The Inside
Collecting & Temporal Analysis of Behavioral Web Data - Tales From The InsideStefan Dietze
 
Long journey of Ruby Standard library at RubyKaigi 2024
Long journey of Ruby Standard library at RubyKaigi 2024Long journey of Ruby Standard library at RubyKaigi 2024
Long journey of Ruby Standard library at RubyKaigi 2024Hiroshi SHIBATA
 
Structuring Teams and Portfolios for Success
Structuring Teams and Portfolios for SuccessStructuring Teams and Portfolios for Success
Structuring Teams and Portfolios for SuccessUXDXConf
 

Recently uploaded (20)

ADP Passwordless Journey Case Study.pptx
ADP Passwordless Journey Case Study.pptxADP Passwordless Journey Case Study.pptx
ADP Passwordless Journey Case Study.pptx
 
Introduction to FIDO Authentication and Passkeys.pptx
Introduction to FIDO Authentication and Passkeys.pptxIntroduction to FIDO Authentication and Passkeys.pptx
Introduction to FIDO Authentication and Passkeys.pptx
 
Event-Driven Architecture Masterclass: Challenges in Stream Processing
Event-Driven Architecture Masterclass: Challenges in Stream ProcessingEvent-Driven Architecture Masterclass: Challenges in Stream Processing
Event-Driven Architecture Masterclass: Challenges in Stream Processing
 
Overview of Hyperledger Foundation
Overview of Hyperledger FoundationOverview of Hyperledger Foundation
Overview of Hyperledger Foundation
 
Portal Kombat : extension du réseau de propagande russe
Portal Kombat : extension du réseau de propagande russePortal Kombat : extension du réseau de propagande russe
Portal Kombat : extension du réseau de propagande russe
 
AI mind or machine power point presentation
AI mind or machine power point presentationAI mind or machine power point presentation
AI mind or machine power point presentation
 
Google I/O Extended 2024 Warsaw
Google I/O Extended 2024 WarsawGoogle I/O Extended 2024 Warsaw
Google I/O Extended 2024 Warsaw
 
Simplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdf
Simplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdfSimplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdf
Simplified FDO Manufacturing Flow with TPMs _ Liam at Infineon.pdf
 
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdfLinux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
 
Hyatt driving innovation and exceptional customer experiences with FIDO passw...
Hyatt driving innovation and exceptional customer experiences with FIDO passw...Hyatt driving innovation and exceptional customer experiences with FIDO passw...
Hyatt driving innovation and exceptional customer experiences with FIDO passw...
 
Intro in Product Management - Коротко про професію продакт менеджера
Intro in Product Management - Коротко про професію продакт менеджераIntro in Product Management - Коротко про професію продакт менеджера
Intro in Product Management - Коротко про професію продакт менеджера
 
Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...
Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...
Secure Zero Touch enabled Edge compute with Dell NativeEdge via FDO _ Brad at...
 
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
 
WebRTC and SIP not just audio and video @ OpenSIPS 2024
WebRTC and SIP not just audio and video @ OpenSIPS 2024WebRTC and SIP not just audio and video @ OpenSIPS 2024
WebRTC and SIP not just audio and video @ OpenSIPS 2024
 
Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...
Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...
Easier, Faster, and More Powerful – Alles Neu macht der Mai -Wir durchleuchte...
 
Your enemies use GenAI too - staying ahead of fraud with Neo4j
Your enemies use GenAI too - staying ahead of fraud with Neo4jYour enemies use GenAI too - staying ahead of fraud with Neo4j
Your enemies use GenAI too - staying ahead of fraud with Neo4j
 
ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...
ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...
ASRock Industrial FDO Solutions in Action for Industrial Edge AI _ Kenny at A...
 
Collecting & Temporal Analysis of Behavioral Web Data - Tales From The Inside
Collecting & Temporal Analysis of Behavioral Web Data - Tales From The InsideCollecting & Temporal Analysis of Behavioral Web Data - Tales From The Inside
Collecting & Temporal Analysis of Behavioral Web Data - Tales From The Inside
 
Long journey of Ruby Standard library at RubyKaigi 2024
Long journey of Ruby Standard library at RubyKaigi 2024Long journey of Ruby Standard library at RubyKaigi 2024
Long journey of Ruby Standard library at RubyKaigi 2024
 
Structuring Teams and Portfolios for Success
Structuring Teams and Portfolios for SuccessStructuring Teams and Portfolios for Success
Structuring Teams and Portfolios for Success
 

Kitzmiller Openhelisphereproject Bosc2008

  • 1. The Open HeliSphere ™ project True open source from the inventors of True Single Molecule Sequencing (tSMS ™) . Aaron Kitzmiller BOSC 2008
  • 2.
  • 3. Single Molecule Sequencing by Synthesis Hybridize Primer 1 ~1/um 2 T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
  • 4. Extend ‘ G’ Single Molecule Sequencing by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
  • 5. Wash SM Sequence by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
  • 6. Image SM Sequence by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
  • 7. Cleave SM Sequence by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
  • 8.
  • 9. Raw data collection - C - A G C T - - C T - G - T A - C T - G - - A G - - A - - - - A - C - A G C - - G - - - G - T - G - - - - - - - G X C T A G C T A G C T A G C T A G C T A G C T A G C T A G - C - A - C T - - C - - G C - A - - T - - C - A - - T - G - - - A G - - A - - T - - C - A - - T - - - - A - C T - - - - - - G - T A - - T - G - - - - - T A - - T A G - - - -
  • 11.
  • 12.
  • 13.
  • 14. Bioinformatics Pipeline for Digital Gene Expression
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.
  • 21.
  • 22. Length distributions (yeast DGE experiment)‏ Raw: Unfiltered reads, 6mer and above Filtered : Quality score filter, AT < 0.9, BAO dinuc<0.7, trim leading Ts, length >= 20, alignment against BAO, P102 Aligned : Normalized score >= 4 Company confidential
  • 23. Error rates and alignments (yeast DGE experiment)‏ Error-rates were assessed using samples of alignments with normalized alignment score ≥4 to a high-expresser (YLR110C/CCW12)‏ 6.55% 0.44% 4.72% 1.39% Total Sub Del Ins GACGT-TATG G GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A C CGTGCTAAACAATCC Reference GACGT-TATG A GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A T CGTGCTAAACAATCC Consensus --------------------------------------------------------------------------- TGATGGTAGTAACGATGATGACGAAGA-TAA CCCGCTG--A T CGTGCTAAACA-TC Reads GACGT-TATG A GTGATGGTAGTAACGATGATGA-GAAGA GC-A T CGTGCTAAACA-TCC A-GTATATG A GTGATGGTAGTAACGATGATGACGAAGAATA A T CGTGCTAAACAATCC GACGT-TATG A GTGATGGTAGTAACGATGATGACGA AATGTAGACCCGCTGC-A T CGTGCTAAACAATCC ACGT-TATG A GTGATG-TAGTAACGATGATGACGAAGA-TAA GACGT-TATG A GT ACGAAGA-TAATGTAGACCCGCTGCTA T CGT-CTA GACGT-TATG A GTGATG-TA GA-TAATGTAGACCTGC-GC-A T CGTGCTAAACAA GACGT-TATG A GTGATG GA-TAAT-TAGACCCGCTG--A T CGTG-TAA-CAA GACGT-TATG A GTGATGGTAGTAACGATGATGACG
  • 24.
  • 25. Hybrid development model Source code repository Read-only source code subset User-owned packages Secure sync Company firewall
  • 26. Typical closed source development Source code repository Company firewall
  • 27. Typical open source project Source code repository Direct commit Checkout Submit patch via email