Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Sequenciamento de DNA


Published on

Published in: Technology

Sequenciamento de DNA

  1. 1. Seqüenciamento
  2. 2. 1977: Walter Gilbert e Frederick Sanger seqüenciamento de DNA Nobel 1980 “ pelas contribui ções na determinação de seqüências de ácidos nucleicos ”
  3. 4. Procedimento enzimático (Sanger, 1977) A posição das bases é determinada pelo tamanho dos fragmentos obtidos através de reações de polimerização na presença de dideoxinucleotídeos .
  16. 17. Dideoxinucleotídeo di deoxinucleotídeo O - O - P - P - P - O - CH 2 - O - O O O BASE - O - - O - H 3' 2' H O - O - P - P - P - O - CH 2 - O - O O O BASE - O - - O - H 3' 2' H deoxinucleotídeo O - O - P - P - P - O - CH 2 - O - O O O BASE - O - - O - OH 3' 2' H O - O - P - P - P - O - CH 2 - O - O O O BASE - O - - O - 3' 2' H
  17. 18. Seqüenciamento de DNA
  18. 19. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||| 5’ 3’ ATGCTTC 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C
  19. 20. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC 5’ 3’
  20. 21. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC TG 5’
  21. 22. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC TGGCAGATCT 5’
  22. 23. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC TGGCAGATCT 5’
  23. 24. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC TGGCAGA T 5’
  24. 25. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC TGGCAGA T 5’
  25. 26. Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||| 5’ 3’ A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C ATGCTTC TGGCAGA T 5’
  29. 30. Seqüenciamento de DNA G A T C <ul><li>molde </li></ul><ul><li>polimerase </li></ul><ul><li>d N TPs </li></ul><ul><li>dd G TPs </li></ul><ul><li>dd A TPs </li></ul><ul><li>dd T TPs </li></ul><ul><li>dd C TPs </li></ul>
  30. 31. Nucleotídeos Radioativos
  33. 36. Gel inteiro
  34. 37. Gel e cromatograma
  35. 42. Procedimento químico (Maxam & Gilbert, 1977) separação das fitas DNA marcado na extremidade 5' reações parciais de clivagens específicas 5' 5' 5' T G A C G C T G A T gel desnaturante de poliacrilamida (uréia 8 M) G A+G T+C C T G A C G C T G A T 5' 8 pb 5 pb 2 pb e l e t r o f o r e s e
  36. 43. Seqüenciamento de DNA
  37. 44. Seqüenciamento de DNA 1996, tese de mestrado: 2000, tese de doutorado:
  38. 45. “ Novas metodologias promissoras” (2001) <ul><li>Seqüenciamento por hibridização </li></ul><ul><ul><li>Khrapko et al. (1989). FEBS Lett. 256 : 118-122 </li></ul></ul><ul><ul><li> </li></ul></ul><ul><li>Seqüenciamento paralelo de assinaturas baseado em ligação e corte (MPSS) </li></ul><ul><ul><li>Brenner et al. (2000). Nature Biot. 18 : 630 - 634 </li></ul></ul><ul><ul><li> </li></ul></ul><ul><li>Pirosseqüenciamento </li></ul><ul><ul><li>Ronaghi et al. (1996). Anal. Biochem. 242 : 84–89. </li></ul></ul><ul><ul><li> </li></ul></ul>Genome Research 11 : 3–11 (2001).
  39. 46. Advanced Sequencing Technology Awards 2005 (NHGRI) <ul><li>Droplet-Based Digital Microfluidic Genome Sequencing </li></ul><ul><li>Single-Molecule DNA Sequencing with Engineered Nanopores </li></ul><ul><li>Electronic Sequencing in Nanopores </li></ul><ul><li>Real-Time DNA Sequencing </li></ul><ul><li>Massively Parallel Cloning and Sequencing of DNA </li></ul><ul><li>Modulating Nucleotide Size in DNA for Detection by Nanopore </li></ul><ul><li>Haplotype Sequencing via Single Molecule Hybridization </li></ul><ul><li>Sequencing a DNA Molecule using a Synthetic Nanopore </li></ul><ul><li>Real-time Multiplex Single-Molecule DNA Sequencing </li></ul><ul><li>Bead-Based Polony Sequencing </li></ul><ul><li>Ultra High Throughput DNA Sequencing System Based on Two-Dimensional Monolith Multi-Capillary Arrays and Nanoliter Reaction Volume </li></ul><ul><li>$100,000 Genome Using Integrated Microfluidic CE </li></ul>
  40. 47. Genome Sequencer 20 System Roche Applied Science 454 Life Sciences Genome sequencing in microfabricated high-density picolitre reactors. Nature 437 , 376-380 (15 September 2005) The apparatus (…) is able to sequence 25 million bases, at 99% or better accuracy, in one 4-hour run. (…) shotgun sequencing and de novo assembly of the Mycoplasma genitalium [580 Mb] genome with 96% coverage at 99.96% accuracy in one run of the machine.
  41. 48. Pirosseqüenciamento ATP + Luciferina + O 2 AMP + PPi + Oxiluciferina + CO 2 + Luz Luciferase PPi + APS SO 4 + ATP ATP Sulforilase DNA n + Nucleot ídeo DNA n+1 + PPi Polimerase
  42. 49. Pirosseqüenciamento
  43. 50. Pirosseqüenciamento
  44. 51. Pirosseqüenciamento Genome Sequencer 20 System fragmentação ligação dos adaptadores reação de PCR em gotículas
  45. 52. Pirosseqüenciamento Genome Sequencer 20 System
