SlideShare a Scribd company logo
The Open HeliSphere ™  project True open source from the inventors of True Single Molecule Sequencing (tSMS ™) .  Aaron Kitzmiller BOSC 2008
Agenda ,[object Object],[object Object],[object Object],[object Object]
Single Molecule Sequencing by Synthesis Hybridize Primer 1 ~1/um 2 T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
Extend ‘ G’ Single Molecule Sequencing by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
Wash SM Sequence  by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
Image SM Sequence  by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
Cleave SM Sequence  by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
Flow Cell Imaging ,[object Object],[object Object],[object Object],[object Object],[object Object],Flow Cell 25 Channels (1.6 x 90 mm)‏ ~12 x 12 cm Flow cell volume = 180 µL
Raw data collection - C - A G C T - - C T - G - T A - C T - G - - A G - - A -  - - - A - C - A G C - - G - - - G - T - G - - - - - - - G  X C T A G C T A G C T A G C T A G C T A G C T A G C T A G  - C - A - C T - - C - - G C - A - - T - - C - A - - T - G  - - - A G - - A - - T - - C - A - - T - - - - A - C T - -  - - - - G - T A - - T - G - - - - - T A - - T A G - - - -
HeliScope and HeliSphere
Helicos and Open Source ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Open HeliSphere project ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Open HeliSphere project ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Bioinformatics Pipeline for Digital Gene Expression
SRF file processing ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
SMS file ,[object Object],[object Object],[object Object],read_iterator<read_record> rit(smsfile); read_record read;   //query the SMS file for desired flowcell/channel rit.select_channel(flowcell,channel);   //iterate over result set, default out format to ostream is fasta while(!rit.end()){ read = *rit; outf << read; rit++; } outf.close();
Pipeline configuration ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
DGE analysis ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
IndexDP 10mer word Template length 15, weight 10 w/sub ,[object Object],[object Object],[object Object],[object Object],ACGT AC G TA CCCGTA AAG ACGT AC A TA CCCGTA TTTACTTTACGT ACGTACATA CCCGTA AAG ACGTACATA CCCGTA TTTACTTTACGT
IndexDP ,[object Object],[object Object],[object Object],[object Object],[object Object]
QC analysis  ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Length distributions (yeast DGE experiment)‏ Raw:  Unfiltered reads, 6mer and above Filtered :  Quality score filter, AT < 0.9, BAO dinuc<0.7, trim leading Ts, length >= 20, alignment against BAO, P102 Aligned :  Normalized score >= 4 Company confidential
Error rates and alignments (yeast DGE experiment)‏ Error-rates were assessed using samples of alignments with normalized alignment score ≥4  to a high-expresser (YLR110C/CCW12)‏ 6.55% 0.44% 4.72% 1.39% Total Sub Del Ins GACGT-TATG G GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A C CGTGCTAAACAATCC Reference GACGT-TATG A GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A T CGTGCTAAACAATCC Consensus --------------------------------------------------------------------------- TGATGGTAGTAACGATGATGACGAAGA-TAA  CCCGCTG--A T CGTGCTAAACA-TC Reads GACGT-TATG A GTGATGGTAGTAACGATGATGA-GAAGA  GC-A T CGTGCTAAACA-TCC A-GTATATG A GTGATGGTAGTAACGATGATGACGAAGAATA  A T CGTGCTAAACAATCC GACGT-TATG A GTGATGGTAGTAACGATGATGACGA  AATGTAGACCCGCTGC-A T CGTGCTAAACAATCC ACGT-TATG A GTGATG-TAGTAACGATGATGACGAAGA-TAA GACGT-TATG A GT  ACGAAGA-TAATGTAGACCCGCTGCTA T CGT-CTA  GACGT-TATG A GTGATG-TA  GA-TAATGTAGACCTGC-GC-A T CGTGCTAAACAA  GACGT-TATG A GTGATG  GA-TAAT-TAGACCCGCTG--A T CGTG-TAA-CAA  GACGT-TATG A GTGATGGTAGTAACGATGATGACG
Acknowledgments  ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Original research shouldn’t start with copies
Hybrid development model Source code  repository Read-only source  code subset User-owned  packages Secure sync Company firewall
Typical closed source development Source code  repository Company firewall
Typical open source project Source code  repository Direct commit Checkout Submit patch via email
HeliScope and HeliSphere

More Related Content

What's hot

The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181
Mahmoud Samir Fayed
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome Assemblies
Genome Reference Consortium
 
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
NMS Labs
 
Gene Sequences
 Gene Sequences Gene Sequences
Gene Sequences
Mohsin Shad
 
PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...ISA Interchange
 
The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185
Mahmoud Samir Fayed
 
ABGT 2016 Workshop Schneider
ABGT 2016 Workshop SchneiderABGT 2016 Workshop Schneider
ABGT 2016 Workshop Schneider
Genome Reference Consortium
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome Assemblies
Genome Reference Consortium
 
The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189
Mahmoud Samir Fayed
 

What's hot (11)

The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181The Ring programming language version 1.5.2 book - Part 157 of 181
The Ring programming language version 1.5.2 book - Part 157 of 181
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome Assemblies
 
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...The Challenges of Analytical Method Validation for Hallucinogens and Designer...
The Challenges of Analytical Method Validation for Hallucinogens and Designer...
 
Gene Sequences
 Gene Sequences Gene Sequences
Gene Sequences
 
PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...PID controller auto tuning based on process step response and damping optimum...
PID controller auto tuning based on process step response and damping optimum...
 
The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185The Ring programming language version 1.5.4 book - Part 152 of 185
The Ring programming language version 1.5.4 book - Part 152 of 185
 
ABGT 2016 Workshop Schneider
ABGT 2016 Workshop SchneiderABGT 2016 Workshop Schneider
ABGT 2016 Workshop Schneider
 
cloning
cloningcloning
cloning
 
Cloning
CloningCloning
Cloning
 
Creating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome AssembliesCreating Reference-Grade Human Genome Assemblies
Creating Reference-Grade Human Genome Assemblies
 
The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189The Ring programming language version 1.6 book - Part 151 of 189
The Ring programming language version 1.6 book - Part 151 of 189
 

Viewers also liked

Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008bosc_2008
 
The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,PARIS
 
Mulheres de jogadores de futebol
Mulheres de jogadores de futebolMulheres de jogadores de futebol
Mulheres de jogadores de futebol
Andre de Castro Zorzo
 
Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008bosc_2008
 
DESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADORDESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADOR
Mauro Bolagay
 
Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008bosc_2008
 
Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008bosc_2008
 

Viewers also liked (8)

Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008Heuer Bio Java Bosc2008
Heuer Bio Java Bosc2008
 
The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,The Power of Collaborative innovation, PWC, WEF Davos 2008,
The Power of Collaborative innovation, PWC, WEF Davos 2008,
 
Malaga
MalagaMalaga
Malaga
 
Mulheres de jogadores de futebol
Mulheres de jogadores de futebolMulheres de jogadores de futebol
Mulheres de jogadores de futebol
 
Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008Bhagat Myexperiment Bosc2008
Bhagat Myexperiment Bosc2008
 
DESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADORDESARROLLO DE LA SI EN ECUADOR
DESARROLLO DE LA SI EN ECUADOR
 
Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008Smith T Bio Hdf Bosc2008
Smith T Bio Hdf Bosc2008
 
Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008Andy Jenkinson Bosc Das 2008
Andy Jenkinson Bosc Das 2008
 

Similar to Kitzmiller Openhelisphereproject Bosc2008

In silico analysis for unknown data
In silico analysis for unknown dataIn silico analysis for unknown data
In silico analysis for unknown data
Santosh Rama Bhadra Tata
 
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisationWEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
Quality Assistance s.a.
 
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
Lawrence kok
 
Selection analysis using HyPhy
Selection analysis using HyPhySelection analysis using HyPhy
PPePR Overview Web2 Ireland
PPePR Overview Web2 IrelandPPePR Overview Web2 Ireland
PPePR Overview Web2 Ireland
Liam Ó Móráin
 
2018 capi contest introduction japan-v2b
2018 capi contest introduction japan-v2b2018 capi contest introduction japan-v2b
2018 capi contest introduction japan-v2b
Yutaka Kawai
 
Langmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomicsLangmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomicsBOSC 2010
 
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem MandalH2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
Sri Ambati
 
Sequenciamento de DNA
Sequenciamento de DNASequenciamento de DNA
Sequenciamento de DNAfelipes
 
Simulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in theSimulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in the
IAEME Publication
 
Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009bosc
 
SPgen: A Benchmark Generator for Spatial Link Discovery Tools
SPgen: A Benchmark Generator for Spatial Link Discovery ToolsSPgen: A Benchmark Generator for Spatial Link Discovery Tools
SPgen: A Benchmark Generator for Spatial Link Discovery Tools
Holistic Benchmarking of Big Linked Data
 
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive
 
Xt 2000i cell counter Autoanalyser
Xt 2000i  cell counter AutoanalyserXt 2000i  cell counter Autoanalyser
Xt 2000i cell counter Autoanalyserbabu3151
 
Analyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARNAnalyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARN
Amanda Summers
 

Similar to Kitzmiller Openhelisphereproject Bosc2008 (20)

In silico analysis for unknown data
In silico analysis for unknown dataIn silico analysis for unknown data
In silico analysis for unknown data
 
cloning
cloningcloning
cloning
 
C:\fakepath\cloning
C:\fakepath\cloningC:\fakepath\cloning
C:\fakepath\cloning
 
Cloning
CloningCloning
Cloning
 
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisationWEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
WEBINAR HDX-MS a powerful tool for biopharmaceutical characterisation
 
Similarity
SimilaritySimilarity
Similarity
 
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
IB Chemistry on ICT, 3D software, Avogadro, Jmol, Swiss PDB, Pymol for Intern...
 
Selection analysis using HyPhy
Selection analysis using HyPhySelection analysis using HyPhy
Selection analysis using HyPhy
 
PPePR Overview Web2 Ireland
PPePR Overview Web2 IrelandPPePR Overview Web2 Ireland
PPePR Overview Web2 Ireland
 
2018 capi contest introduction japan-v2b
2018 capi contest introduction japan-v2b2018 capi contest introduction japan-v2b
2018 capi contest introduction japan-v2b
 
Langmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomicsLangmead bosc2010 cloud-genomics
Langmead bosc2010 cloud-genomics
 
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem MandalH2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
H2O World - PAAS: Predictive Analytics offered as a Service - Prateem Mandal
 
Poster Pubblicazione
Poster PubblicazionePoster Pubblicazione
Poster Pubblicazione
 
Sequenciamento de DNA
Sequenciamento de DNASequenciamento de DNA
Sequenciamento de DNA
 
Simulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in theSimulation of a cstr model for thevetia peruviana oil transesterification in the
Simulation of a cstr model for thevetia peruviana oil transesterification in the
 
Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009Swertz Molgenis Bosc2009
Swertz Molgenis Bosc2009
 
SPgen: A Benchmark Generator for Spatial Link Discovery Tools
SPgen: A Benchmark Generator for Spatial Link Discovery ToolsSPgen: A Benchmark Generator for Spatial Link Discovery Tools
SPgen: A Benchmark Generator for Spatial Link Discovery Tools
 
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
The Hive Think Tank: Machine Learning Applications in Genomics by Prof. Jian ...
 
Xt 2000i cell counter Autoanalyser
Xt 2000i  cell counter AutoanalyserXt 2000i  cell counter Autoanalyser
Xt 2000i cell counter Autoanalyser
 
Analyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARNAnalyse Et Visualisation De Structures 2D D ARN
Analyse Et Visualisation De Structures 2D D ARN
 

More from bosc_2008

Lee Apollo Bosc2008
Lee Apollo Bosc2008Lee Apollo Bosc2008
Lee Apollo Bosc2008bosc_2008
 
Kallio Chipster Bosc2008
Kallio Chipster Bosc2008Kallio Chipster Bosc2008
Kallio Chipster Bosc2008bosc_2008
 
Introduction Bosc2008
Introduction Bosc2008Introduction Bosc2008
Introduction Bosc2008bosc_2008
 
Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008bosc_2008
 
Faga C Map Bosc2008
Faga C Map Bosc2008Faga C Map Bosc2008
Faga C Map Bosc2008bosc_2008
 
Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008bosc_2008
 
Greene Bosc2008
Greene Bosc2008Greene Bosc2008
Greene Bosc2008bosc_2008
 
Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008bosc_2008
 
Gordon Semantic Web 2008
Gordon Semantic Web 2008Gordon Semantic Web 2008
Gordon Semantic Web 2008bosc_2008
 
Menager Mobyle Bosc2008
Menager Mobyle Bosc2008Menager Mobyle Bosc2008
Menager Mobyle Bosc2008bosc_2008
 
Haider Embrace Bosc2008
Haider Embrace Bosc2008Haider Embrace Bosc2008
Haider Embrace Bosc2008bosc_2008
 
Antao Biopython Bosc2008
Antao Biopython Bosc2008Antao Biopython Bosc2008
Antao Biopython Bosc2008bosc_2008
 
Banks Genographer Bosc2008
Banks Genographer Bosc2008Banks Genographer Bosc2008
Banks Genographer Bosc2008bosc_2008
 
Wilson Make Bosc2008
Wilson Make Bosc2008Wilson Make Bosc2008
Wilson Make Bosc2008bosc_2008
 
Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008bosc_2008
 
O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008bosc_2008
 

More from bosc_2008 (16)

Lee Apollo Bosc2008
Lee Apollo Bosc2008Lee Apollo Bosc2008
Lee Apollo Bosc2008
 
Kallio Chipster Bosc2008
Kallio Chipster Bosc2008Kallio Chipster Bosc2008
Kallio Chipster Bosc2008
 
Introduction Bosc2008
Introduction Bosc2008Introduction Bosc2008
Introduction Bosc2008
 
Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008Mackey Bio Perl Bosc2008
Mackey Bio Perl Bosc2008
 
Faga C Map Bosc2008
Faga C Map Bosc2008Faga C Map Bosc2008
Faga C Map Bosc2008
 
Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008Prins Bio Lib Bosc2008
Prins Bio Lib Bosc2008
 
Greene Bosc2008
Greene Bosc2008Greene Bosc2008
Greene Bosc2008
 
Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008Gnaneshan Public Health Bosc2008
Gnaneshan Public Health Bosc2008
 
Gordon Semantic Web 2008
Gordon Semantic Web 2008Gordon Semantic Web 2008
Gordon Semantic Web 2008
 
Menager Mobyle Bosc2008
Menager Mobyle Bosc2008Menager Mobyle Bosc2008
Menager Mobyle Bosc2008
 
Haider Embrace Bosc2008
Haider Embrace Bosc2008Haider Embrace Bosc2008
Haider Embrace Bosc2008
 
Antao Biopython Bosc2008
Antao Biopython Bosc2008Antao Biopython Bosc2008
Antao Biopython Bosc2008
 
Banks Genographer Bosc2008
Banks Genographer Bosc2008Banks Genographer Bosc2008
Banks Genographer Bosc2008
 
Wilson Make Bosc2008
Wilson Make Bosc2008Wilson Make Bosc2008
Wilson Make Bosc2008
 
Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008Smith Inter Mine Bosc2008
Smith Inter Mine Bosc2008
 
O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008O Connor Solexa Tools Bosc2008
O Connor Solexa Tools Bosc2008
 

Recently uploaded

Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...
Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...
Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...
James Anderson
 
20240607 QFM018 Elixir Reading List May 2024
20240607 QFM018 Elixir Reading List May 202420240607 QFM018 Elixir Reading List May 2024
20240607 QFM018 Elixir Reading List May 2024
Matthew Sinclair
 
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
DanBrown980551
 
UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6
DianaGray10
 
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdfObservability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Paige Cruz
 
Microsoft - Power Platform_G.Aspiotis.pdf
Microsoft - Power Platform_G.Aspiotis.pdfMicrosoft - Power Platform_G.Aspiotis.pdf
Microsoft - Power Platform_G.Aspiotis.pdf
Uni Systems S.M.S.A.
 
Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!
Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!
Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!
SOFTTECHHUB
 
Mind map of terminologies used in context of Generative AI
Mind map of terminologies used in context of Generative AIMind map of terminologies used in context of Generative AI
Mind map of terminologies used in context of Generative AI
Kumud Singh
 
Full-RAG: A modern architecture for hyper-personalization
Full-RAG: A modern architecture for hyper-personalizationFull-RAG: A modern architecture for hyper-personalization
Full-RAG: A modern architecture for hyper-personalization
Zilliz
 
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
Neo4j
 
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
SOFTTECHHUB
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
ControlCase
 
GraphSummit Singapore | The Art of the Possible with Graph - Q2 2024
GraphSummit Singapore | The Art of the  Possible with Graph - Q2 2024GraphSummit Singapore | The Art of the  Possible with Graph - Q2 2024
GraphSummit Singapore | The Art of the Possible with Graph - Q2 2024
Neo4j
 
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
Neo4j
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
KatiaHIMEUR1
 
DevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA ConnectDevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA Connect
Kari Kakkonen
 
Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?
Nexer Digital
 
20240605 QFM017 Machine Intelligence Reading List May 2024
20240605 QFM017 Machine Intelligence Reading List May 202420240605 QFM017 Machine Intelligence Reading List May 2024
20240605 QFM017 Machine Intelligence Reading List May 2024
Matthew Sinclair
 
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
Neo4j
 
Large Language Model (LLM) and it’s Geospatial Applications
Large Language Model (LLM) and it’s Geospatial ApplicationsLarge Language Model (LLM) and it’s Geospatial Applications
Large Language Model (LLM) and it’s Geospatial Applications
Rohit Gautam
 

Recently uploaded (20)

Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...
Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...
Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...
 
20240607 QFM018 Elixir Reading List May 2024
20240607 QFM018 Elixir Reading List May 202420240607 QFM018 Elixir Reading List May 2024
20240607 QFM018 Elixir Reading List May 2024
 
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
 
UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6
 
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdfObservability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
 
Microsoft - Power Platform_G.Aspiotis.pdf
Microsoft - Power Platform_G.Aspiotis.pdfMicrosoft - Power Platform_G.Aspiotis.pdf
Microsoft - Power Platform_G.Aspiotis.pdf
 
Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!
Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!
Goodbye Windows 11: Make Way for Nitrux Linux 3.5.0!
 
Mind map of terminologies used in context of Generative AI
Mind map of terminologies used in context of Generative AIMind map of terminologies used in context of Generative AI
Mind map of terminologies used in context of Generative AI
 
Full-RAG: A modern architecture for hyper-personalization
Full-RAG: A modern architecture for hyper-personalizationFull-RAG: A modern architecture for hyper-personalization
Full-RAG: A modern architecture for hyper-personalization
 
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
 
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
Why You Should Replace Windows 11 with Nitrux Linux 3.5.0 for enhanced perfor...
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
 
GraphSummit Singapore | The Art of the Possible with Graph - Q2 2024
GraphSummit Singapore | The Art of the  Possible with Graph - Q2 2024GraphSummit Singapore | The Art of the  Possible with Graph - Q2 2024
GraphSummit Singapore | The Art of the Possible with Graph - Q2 2024
 
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
 
DevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA ConnectDevOps and Testing slides at DASA Connect
DevOps and Testing slides at DASA Connect
 
Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?Elizabeth Buie - Older adults: Are we really designing for our future selves?
Elizabeth Buie - Older adults: Are we really designing for our future selves?
 
20240605 QFM017 Machine Intelligence Reading List May 2024
20240605 QFM017 Machine Intelligence Reading List May 202420240605 QFM017 Machine Intelligence Reading List May 2024
20240605 QFM017 Machine Intelligence Reading List May 2024
 
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
 
Large Language Model (LLM) and it’s Geospatial Applications
Large Language Model (LLM) and it’s Geospatial ApplicationsLarge Language Model (LLM) and it’s Geospatial Applications
Large Language Model (LLM) and it’s Geospatial Applications
 

Kitzmiller Openhelisphereproject Bosc2008

  • 1. The Open HeliSphere ™ project True open source from the inventors of True Single Molecule Sequencing (tSMS ™) . Aaron Kitzmiller BOSC 2008
  • 2.
  • 3. Single Molecule Sequencing by Synthesis Hybridize Primer 1 ~1/um 2 T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
  • 4. Extend ‘ G’ Single Molecule Sequencing by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
  • 5. Wash SM Sequence by Synthesis G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
  • 6. Image SM Sequence by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T
  • 7. Cleave SM Sequence by Synthesis T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T T G A A C G T A C T T G C C G C A T G A A C G A C T T G C T G A A C G A C T T G C C T A C T G A C G T C T G G 5’ 5’ T G G G G G G G G T G A A C G T G A A C G T G A A C G 5’ 5’ T A C T T G C C G C A A C T T G C A C T T G C C T A C T G A C G T C T T
  • 8.
  • 9. Raw data collection - C - A G C T - - C T - G - T A - C T - G - - A G - - A - - - - A - C - A G C - - G - - - G - T - G - - - - - - - G X C T A G C T A G C T A G C T A G C T A G C T A G C T A G - C - A - C T - - C - - G C - A - - T - - C - A - - T - G - - - A G - - A - - T - - C - A - - T - - - - A - C T - - - - - - G - T A - - T - G - - - - - T A - - T A G - - - -
  • 11.
  • 12.
  • 13.
  • 14. Bioinformatics Pipeline for Digital Gene Expression
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.
  • 21.
  • 22. Length distributions (yeast DGE experiment)‏ Raw: Unfiltered reads, 6mer and above Filtered : Quality score filter, AT < 0.9, BAO dinuc<0.7, trim leading Ts, length >= 20, alignment against BAO, P102 Aligned : Normalized score >= 4 Company confidential
  • 23. Error rates and alignments (yeast DGE experiment)‏ Error-rates were assessed using samples of alignments with normalized alignment score ≥4 to a high-expresser (YLR110C/CCW12)‏ 6.55% 0.44% 4.72% 1.39% Total Sub Del Ins GACGT-TATG G GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A C CGTGCTAAACAATCC Reference GACGT-TATG A GTGATGGTAGTAACGATGATGACGAAGA-TAATGTAGACCCGCTGC-A T CGTGCTAAACAATCC Consensus --------------------------------------------------------------------------- TGATGGTAGTAACGATGATGACGAAGA-TAA CCCGCTG--A T CGTGCTAAACA-TC Reads GACGT-TATG A GTGATGGTAGTAACGATGATGA-GAAGA GC-A T CGTGCTAAACA-TCC A-GTATATG A GTGATGGTAGTAACGATGATGACGAAGAATA A T CGTGCTAAACAATCC GACGT-TATG A GTGATGGTAGTAACGATGATGACGA AATGTAGACCCGCTGC-A T CGTGCTAAACAATCC ACGT-TATG A GTGATG-TAGTAACGATGATGACGAAGA-TAA GACGT-TATG A GT ACGAAGA-TAATGTAGACCCGCTGCTA T CGT-CTA GACGT-TATG A GTGATG-TA GA-TAATGTAGACCTGC-GC-A T CGTGCTAAACAA GACGT-TATG A GTGATG GA-TAAT-TAGACCCGCTG--A T CGTG-TAA-CAA GACGT-TATG A GTGATGGTAGTAACGATGATGACG
  • 24.
  • 25. Hybrid development model Source code repository Read-only source code subset User-owned packages Secure sync Company firewall
  • 26. Typical closed source development Source code repository Company firewall
  • 27. Typical open source project Source code repository Direct commit Checkout Submit patch via email