Atul Singha Ph.D. Thesis (Except Results Discussion

DIVERSITY OF CYANOBACTERIA IN
ORGANIC FARMING FIELD UNDER RICE-
WHEAT CROPPING SYSTEM
ATUL SINGHA
DIVISION OF MICROBIOLOGY
INDIAN AGRICULTURAL RESEARCH INSTITUTE
NEW DELHI – 110 012
2009

DIVERSITY OF CYANOBACTERIA IN
ORGANIC FARMING FIELD UNDER RICE-
WHEAT CROPPING SYSTEM
By
ATUL SINGHA
A Thesis
Submitted to the Faculty of Post Graduate School,
Indian Agricultural Research Institute, New Delhi,
in partial fulfillment of the requirements
for the award of the degree of
DOCTOR OF PHILOSOPHY
In
MICROBIOLOGY
2009
Approved by:
Chairman:
Dr. Sunil Pabbi
Co-chairperson:
Dr. Dolly Wattal Dhar
Member:
Dr. Aqbal Singh
Member:
Dr. Y. V. Singh
Member:

Dr. Sunil Pabbi CCUBGA
Principal Scientist Division of Microbiology
Indian Agricultural Research Institute
New Delhi-110 012, India
CERTIFICATE
This is to certify that the thesis entitled “Diversity of
cyanobacteria in organic farming field under rice-wheat cropping
system” submitted to the Faculty of Post Graduate School, Indian
Agricultural Research Institute, New Delhi, by Mr. Atul Singha in
partial fulfillment of the requirements for the award of the degree of
Doctor of Philosophy in Microbiology embodies the results of bona-
fide work carried out by him under my supervision and guidance. No
part of thesis has been submitted by him for any other degree or
diploma.
I further certify that any help or information received during the
work on this thesis has been duly acknowledged.
Place: New Delhi (Dr. Sunil Pabbi)
Date: , 2009 Chairman
Advisory Committee

Acknowledgement
I am obliged to express deep sense of gratitude and indebtedness
to Dr. Sunil Pabbi, Principal Scientist, Centre for Conservation and
Utilisation of Blue Green Algae, Division of Microbiology, Indian
Agricultural Research Institute, New Delhi and Chairman of my Advisory
Committee for his meticulous guidance, sustained encouragement,
constructive criticism and imparting his enormous knowledge to build
myself and also during my course of investigation.
It is my privilege to acknowledge my indebtedness to Dr. (Mrs.)
Dolly Wattal Dhar, Head, Division of Microbiology and Co-chairperson,
for her encouragement and help during the course of investigation. It
gives me immense pleasure to acknowledge my gratitude and heartfelt
thanks to the members of my advisory committee Dr. Aqbal Singh, Dr.
Y.V. Singh, Dr. (Ms.) Anita Chaudhary, for their valuable suggestions,
encouragement and support in the form of providing me many of their
instrumental facilities.
I express my deep sense of gratitude and profound regards to
Head, Division of Microbiology, IARI, New Delhi.
My heartfelt thanks are due to my seniors Mrinal Kuchlan,
Nirbhay Singh, Vasudaban, RA Shrikrishna Yadav, SRF Monika,
Shalini, classmates Asit, Kaushik, Rupak, Dhananjay, Shyamsundar,
Mridul, Partho, Surender, Surya and my juniors Asit Mandal, Hillol,
Soham for their company, help and inspiration during my research. I
sincerely thank all the staff members of the Division of Microbiology for
their help and constant encouragement throughout the course of study.

It is my esteemed duty to reserve my highest regards to my
father Arabinda mother Arati, sister Ratna, for their unfathomable
love, continuous inspiration, and encouragement during my study at IARI.
I express my sincere thanks to library for the facilities provided.
I wish to acknowledge and thank Director and Dean, IARI, New
Delhi for providing me the opportunity to do my Ph.D. programme at this
prestigious institute.
My sincere thanks are due to our laboratory staff, especially, Sh.
Laxman and Sh. Muneshwar, and other members of CCUBGA family for
their valuable help during the course of my research work.
Finally, I thank the Council for Scientific and Industrial Research,
New Delhi for the financial assistance in the form of Junior Research
Fellowship.
Date:
Place: New Delhi (Atul Singha)

CONTENTS
Sl No. Chapters Pages
1 INTRODUCTION 1‐3
2 REVIEW OF LITERATURE 4‐30
3 MATERIAL AND METHODS 31‐43
4 RESULTS 44‐52
5 DISCUSSION 53‐65
6 SUMMARY 66‐69
ABSTRACT
ABSTRACT IN HINDI
BIBLIOGRAPHY i‐xix

LIST OF TABLES
Table
No.
Title of the table After page
1 Different Cyanobacterial Forms observed in the soil
samples from Rice field (Microscopic Observations)
44
2 Different Cyanobacterial Forms observed in the soil
samples from wheat field (Microscopic Observations)
44
3 Cyanobacteria isolated from organic rice field soil 45
4 Cyanobacteria isolated from organic wheat field soil 45
5 Cultural characteristics of cyanobacterial isolates from
organic Rice field
45
6 Morphological characterization of cyanobacterial isolates
from organic Rice field
45
7 Cultural characteristics of cyanobacterial isolates from
organic wheat field
45
8 Morphological characterization of cyanobacterial isolates
from organic wheat field
45
9 Chlorophyll content (µg g-1
soil) of the soil under rice crop 47
soil) of the soil under wheat
crop
47
11 Nitrogenase activity (nano moles of C2H4 h-1
kg-1
of soil) of
the soil under rice crop
48
kg-1
of soil) of
the soil under wheat crop
48
13 Total nitrogen content (%) of the soil under rice crop 48
14 Total nitrogen content (%) of the soil under wheat crop 48
15 Soil Organic C content (%) of the soil under rice crop 48
16 Soil Organic C content (%) of the soil under wheat crop 48

LIST OF FIGURES
Figure
No.
Title of the figure After page
soil) of the soil under rice crop 47
soil ) of the soil under wheat
crop
47
kg-1
of soil) of
the soil under rice crop
48
kg-1
of soil) of
the soil under wheat crop
48
5 Total nitrogen content (%) of the soil under rice crop 48
6 Total nitrogen content (%) of the soil under wheat crop 48
7 Soil Organic C content (%) of the soil under rice crop 48
8 Soil Organic C content (%) of the soil under wheat crop 48
9 Clustering analysis of cyanobacterial isolates using
restriction enzymes (a) DpnII and (b) MseI
49
10 Combine clustering analysis of cyanobacterial isolates
using restriction enzymes DpnII and MseI
49
11 Clustering analysis of isolates of (a) Nostoc and (b)
Anabaena using seventeen single primers
51
12 Clustering analysis isolates of (a) Cylindrospermum and
(b) Phormidium using seventeen single primers
52
13 Clustering analysis of the cyanobacterial isolates using
seventeen single primers
52

LIST OF PLATES
Plate
No.
Title of Plate After
Page
1 Photomicrographs of Cyanobacterial Isolates 44
6 16S rDNA amplification (a and b) and restriction digestion
with DpnII (c, d & e) and MseI (f , g & h) of the
cyanobacterial isolates
49
7 RAPD-PCR profiles of Nostoc isolates using different primers 51
8 RAPD-PCR profiles of Nostoc isolates using different primers 51
9 RAPD-PCR profile of Anabaena, Cylindrospermum and
Phormidium isolates
51
10 RAPD-PCR profile of Phormidium isolates using different
primers
51

1. INTRODUCTION
Rice and wheat are the staple food crops occupying nearly 13.5 million
hectares of the Indo-Gangetic plains (IGP) of South Asia covering Pakistan, India,
Bangladesh and Nepal. These crops contribute more than 80% of the total cereal
production and are grown in rotation, with other crops such as maize, pigeon pea,
sugarcane, and lentil substituting either the rice or wheat crop in some years (Huke et
al., 1993a, Huke et al., 1993b and Huke et al., 1993c; Woodhead et al., 1993 and
1994; Razzaque et al., 1995; Hobbs and Morris, 1996; Ladha et al., 2000; Abrol et
al., 2000; Timsina and Connor, 2001; Gupta et al., 2003). The rice–wheat production
systems are fundamental to employment, income, and livelihoods for hundreds of
millions of rural and urban poor of South Asia (Paroda et al., 1994).
Although since the 1960s, the growth rate in the South Asian cereal
production (on an average wheat 3.0%, rice 2.3% per annum) has kept pace with
population growth (Pingali and Heisey, 1996), evidence is now emerging that
continuous cultivation of rice and wheat is lowering soil fertility and organic matter
content (Yadav et al., 1998), depleting ground water resources in tube-well irrigated
areas (Gulati, 1999), exacerbating weed problem, including resistance to herbicide,
(Malik and Singh, 1995; Malik, 1996; Malik et al., 1998), and pest problems (Pingali
and Gerpacio, 1997).
Soil quality is one of the key driving variables for the maintenance of the
agro system and sustaining its productivity. Soil quality which consists of the
physical, chemical and biological components is in flux after being subjected to
various degradative processes. These processes include intensive agricultural
production, use of chemicals and non-sustainable mining of land resources. The
biological component of soil constitutes the most active part of the soil and is greatly
influenced by all these factors. The maintenance of this viable, diverse populations
and functioning of microbial communities is essential to sustainable agriculture.
These can function as bio-indicators of the stability of a community and can be used
to describe the ecological dynamics of a community and the impact of stress on that
community (Mills and Wassel, 1980; Atlas, 1984). An important limiting factor to
greater use of the indices is the absence of detailed information on the microbial

species composition of soil environments which is also influenced by management
practices in long term agricultural lands. Soil amendment with organic sources
favours plant development and improves soil quality, as well as having a suppressive
effect on many diseases (Erhart et al., 1999; Cotxurrera et al., 2002). Evaluation
performed both in microcosms and field experiments showed that organic
amendments not only act by improving soil structure, but also strongly influence the
soil microflora (Crecchio et al., 2001), little is known about however, the specific
modifications received by the different components of the microbial communities.
Nitrogen (N2) fixing cyanobacteria are a dominant microflora in rice fields
which helps to maintain and improve productivity of rice fields (Roger et al., 1993).
These organisms are able to withstand extremes of temperature and drought and
show remarkable variation in growth, nitrogen fixation and stress compatibility
(Goyal, 1997). In addition, these organisms have also been recognized as important
agents in the stabilization of soil surfaces (Bailey et al., 1973) primarily through the
production of extracellular polysaccharides. The need for algal inoculation arose
from an earlier belief that nitrogen fixing cyanobacteria are not commonly prevalent
in rice fields. Only 5% of 911 samples, 33% of 2213 samples (Okuda and
Yamaghchi, 1975; Venkataraman, 1975) and 71% of Japanese soils (Watanabe and
Yamamoto, 1971) showed occurrence of cyanobacteria. This led to the development
of these organisms as biofertilizers especially for flooded rice, as the rice field
conditions were conducive for the growth and establishment of cyanobacteria. In a
country like India, where more than 85% of the rice area accounts for holdings of 1-4
ha and 13% are marginal farmers with farming land of less than 1 ha who cannot
afford the expensive chemical inputs; cyanobacterial biofertilizer acted as a chief
source of nutrients at negligible price.
Studies on inoculation of BGA biofertilizers, its interaction with other
inorganic and organic inputs have been focused mainly on enhancing nitrogen
contribution to soil and crop or increasing crop yield. However, very limited reports
are available on the distribution and abundance of cyanobacteria as influenced by
these inputs. There has been little taxonomic and floristic study of cyanobacteria in
different cropping fields (Pereira et al., 2000) besides the fact that these have
important role in the nitrogen and cabon cycle in the soils. In cultivated fields, algae

are found even at 20 cm depth because of the turning of soil during ploughing.
Vegetation cover in the fields also influences occurrence of algal communities
(Goyal, 1997). Green manuring and other organic amendments are reported to
increase the yield of rice substantially (Ghosh and Saha, 1997). Integrated nutrient
management for sustainable crop production in India is reviewed with particular
reference to organic manures including press mud [filter cake], green manures,
legume residues, other crop residues, and biofertilizers including the use of legumes
in the rotation, blue-green algae, Azolla, Azospirillum, Azotobacter, phosphate
solubilizing microorganisms and vesicular arbuscular mycorrhiza. Reference is made
to nutrient management in several field crops including rice, wheat, maize, toria
[Brassica campestris var. toria], gobhi sarson [B. campestris var. sarson] and mung
beans [Vigna radiata] (Pasricha et al., 1996). But again little attention has been paid
to responses at the levels of organismal structure and the interrelation between
diversity and metabolic activity.
Recognizing the lack of information on the diversity and functioning of
cyanobacteria and understanding their interaction under organic farming here in this
study it is proposed to analyze communities of cyanobacteria in an organic field
under rice-wheat cropping system. The knowledge about distribution of taxa
obtained may help identify sources of cyanobacteria for use as biofertilizers in rice
cultivation especially in biofertilizer input basmati rice. The direct observations have
been combined with molecular techniques so that shifts in cyanobacterial community
can well be described authentically and the best surviving strains identified. This
study is proposed with the following objectives:
OBJECTIVES:
1. Isolation, purification and identification of cyanobacterial strains during rice
and wheat crop under organic farming.
2. Distributional pattern and in situ contribution of cyanobacteria as affected by
organic inputs.
3. Genetic characterization of cyanobacteria useful for assessing cyanobacterial
diversity.

2. REVIEW OF LITERATURE
Soil is a critically important component of the earth’s biosphere and is a key
driving variable for the sustainability of any agro ecosystem. Soil quality consists of
the chemical, physical and biological components of a soil and their interaction. The
biological component plays an important role in the ecosystem processes which are
mainly carried out by the activities of the microbial world. These tiny organisms
dominate the decomposition processes in soil and the cycling of nutrients in soil-
plant systems. To determine how to manage the biological processes controlled by
soil microbes, it is important to understand the patterns, causes and consequences of
microbial diversity and the scale at which the microbial communities are structured.
The knowledge of variability of microbial population and processes will enable the
development of better fertilizer-pesticide application strategies. Since these microbial
communities are very sensitive to anthropogenic disturbance and are correlated with
soil functions, they can serve as good indicator of soil quality and health. Hence,
spatial and temporal variation in microbial diversity needs to be tracked community
wise in one cropping system with different management practices and then these can
be used to obtain background information on regulation of ecosystem processes in
different cropping systems.
2.1 Rice-wheat cropping system and organic farming
Rice-wheat systems occupy 24 million hectares of cultivated land in Asia. Of
this, 13.5 million hectares are in South Asia extending from the Indo-Gangetic Plains
to the Himalayan foothills. Rice-wheat systems cover about 32% of the total rice
area and 42% of the total wheat area in these four countries: India, Pakistan,
Bangladesh and Nepal. About one-third of India’s cereals are produced in the RWCS
(Rice Wheat Cropping System) belt and it contributes largely to the food grain
procurement by the Government for its public distribution system. However, even at
the present level of production and the fact that RWCS has been practised in India
only during the past 30 years or so, the question of its sustainability has been raised
and there are signs of fatigue and decline in yield, especially in states where the level
of production is 10 t/ha/yr or more. This is due to decline in soil fertility, particularly
its content of organic matter. RWCS has also adverse effects on the environment,

mainly due to the application of high rates of nitrogenous fertilizer. About 5–10% of
the nitrogen applied to rice may be lost through ammonia volatilization, which
contributes to acid-rain. Production of N2O due to denitrification is also likely to be
more under alternate wetting and drying conditions obtained under irrigated rice
culture. Leaching of nitrates may lead to groundwater pollution with nitrates and
some indications of this are already reported from Punjab. To prevent environmental
degradation due to fertilizer nitrogen, part of N demand of the RWCS needs to be
made by summer (June–July) green manuring or growing of dual purpose summer
legumes such as mungbean, use of biofertilizers such as blue-green algae, Azolla,
Azospirillum, etc. and organic manures (FYM, compost, etc.), i.e. to pursue an
integrated plant nutrient supply system.
During the boom of agricultural science, people found that using chemical
fertilizer could reduce the amount of labour it took to support plants with the
nutrients they needed for optimum yield. Since industrial fertilizers come in
chemical form they cannot integrate properly into the soil. In fact, they deteriorate
soil life itself. Chemical fertilizers can deplete the humus of a soil in a single
generation; it can damage or deteriorate the soil structure, which leads to erosion.
Chemical fertilizers can lower the overall nutrient content in the soil. Furthermore, if
an application of fertilizer does not integrate into the soil matrix; it rapidly leaches
out of the soil. Since farm practices have deviated from integrated application, the
soil has lost much of its overall fertility. The International Food Policy Research
Institute released a study showing that 40% of the world’s agricultural soil is
seriously degraded due to erosion and nutrient depletion from chemical fertilizer and
salanization due to excessive irrigation. Over 3 billion tons of topsoil is lost annually
due to non-organic farming methods such as chemical fertilization in Canada and the
US.
Scientists have recently shown that with improved management practices,
carbon stocks in the soil that are traditionally lost through land cultivation can be
restored, thus removing CO2 from the atmosphere. Furthermore, the use of animal
manure, algal biofertilizers has been shown to be influential in enriching soil carbon
content. However, few long-term studies of soil quality have been performed on
organic cultivated lands. Swiss researchers have analyzed the effects of fertilization

type, fertilization intensity (number of livestock to produce manure) and plant
protection on organic and biological matter in the soil, including microbial activity,
in organic and conventional farming systems, compared in a crop rotation with grass-
clover. The experiments and measurements carried out over 21 years have shown
that: · At the end of the 21-year period, soil organic nitrogen and carbon content are
5% to 12% higher at normal manure intensity (i.e. 1.4 livestock units/ha) compared
to reduced intensity (0.7 livestock units/ha). Compared to no manure use, the organic
carbon content in soil is 26% higher under normal manure use in organic farming. In
addition, organic matter content is up to 12% higher under composted farmyard
manure use compared to rotted and stacked manure (European Commission News,
2007).
The quality indicator for soil organic matter, which predicts changes in soil
carbon, is up to 20% higher in organic farming systems compared to conventional
farming, regardless of the fertilization intensity. Microbial activity (respiration) is
about 14% higher in organic compared to conventional farming and about 10%
higher at normal intensity compared to lower intensity. Activity potentials of
microorganisms (dehydrogenase-activity) are up to 71% higher in organic compared
to conventional soils
Takada et al. (2004) examined the situation of organic rice farming in
Indonesia, based on interviews conducted with an organic farm product dealer in
Yogyakarta and four organic farming groups in Central Java. The dealer started the
organic business with the support of an international non-governmental organization
in the United Kingdom, and has been instrumental in the initiation of the organic rice
market in Yogyakarta since 1997. The dealer sold organic rice from 14 farmers'
groups living in the suburbs of Yogyakarta as of September 2003. The higher price
for organic products is a major incentive to switch to organic farming. However, it is
necessary to obtain a sufficient amount of organic materials to produce organic
fertilizers for organic farming. It is argued that the sustainability of organic rice
farming and the certification for organic agricultural products should be considered
in the promotion of the organic farming movement.
Mendoza (2004) in a case study conducted in Mindoro, Philippines,
determined the benefits of organic farming in rice agro-ecosystems. Organic rice

farming utilized only 33% (US$39 ha-1
) of the cash capital required to grow a
hectare of rice when compared with conventional farm which spent US$118 ha-1
.
This much reduced cash capital expense in organic rice farming relieved women
from the burden of sourcing credit to finance crop establishment. All organic rice
farmers who participated in the study were members of a farmer' organization and/or
cooperative while only few conventional farmers were members of a farmer'
organization. Organic farming improved the soil quality. The paddy soil was loose
and had deeper mud, which was attributed to the higher soil organic matter (SOM)
accumulating as a result of crop residue recycling at 3-4 t ha-1
and application of
animal manure at 1-2 t ha-1
crop-1
. Loose and deeper mud led to easier and faster land
preparation and lesser weed growth which reduced the labour required in hand
weeding and time to do rotary weeding. The net revenue in organic farm was higher
(US$332 ha-1
) than in the conventional farm (US$290 ha-1
) despite the slightly lower
yields (3.25 t ha-1
) in organic compared with the yields obtained (3.52 t ha-1
) in the
conventional farms. The higher cash cost in the conventional farms was due mainly
to the agrochemical inputs that accounted for 83.2% of the cash cost (fertilizer, 65%;
pesticides, 18.2%). The fossil fuel based energy inputs (FFEI) in the organic farms
was only 18.3% (546.0 Mcal ha-1
) of the conventional farms (2977.21 ha-1
). For
every 1 cal of fossil fuel energy used in the conventional farm, only 4 cal was
produced while it was 19 cal in the organic farm. Organic farms were less energy
consuming. One tonne of rice in organic farms utilized only 170 Mcal of FFEI while
844 Mcal were utilized in the conventional farms. The case study had shown the
socio-economic, energy-use and environmental benefits of organic farming over
conventional farming. Thus, it is suggested that a national research and extension
programme for its promotion and widespread adoption by rice farmers in the country
should be facilitated.
2.2 Cyanobacteria and microbial diversity
A number of studies have pointed out the influence of agricultural practices
on the soil biological community (Kuhnelt, 1961; Martynuik and Wangner, 1978;
Bolton et al., 1985; Ramsay et al., 1986). Within a given soil, there is considerable
variation with depth in the composition of the microbial community (Kennedy and
Smith, 1995). Studies on inoculation of BGA biofertilizers, its interaction with other

inorganic and organic inputs have been focused mainly on enhancing nitrogen
contribution to soil and crop or increasing crop yield. However, very limited reports
are available on the distribution and abundance of cyanobacteria as influenced by
these inputs. In cultivated fields, algae are found even at 20 cm depth because of the
turning of soil during ploughing. Vegetation cover in the fields also influences
occurrence of algal communities (Goyal, 1997).
Perez-Pianeres et al., (2006) evaluated the response of the soil borne
microflora to the newly created soil environments resulting from the addition of
three different composts under controlled laboratory conditions. The results
demonstrated that compost amendments strongly influence soil biological properties
at a short term, at a global level as well as at a community level. Modification
depended on both the organic matter utilized and the amended soil.
Soil amendment with organic inputs is an agronomically interesting practice,
which favours plant development and improves soil quality. Organic amendments,
therefore, maintain and enhance the fertility and productivity of agricultural soils,
allowing a sustainable land use (Perez-Pianeres et al., 2006). Organic amendments
not only act by improving soil structure, they also strongly influence the soil
microflora (Crecchio et al., 2001). Organic inputs are an important source of
nutrients usable by microorganisms, thus enhancing the development of the
microflora and increase the global activity of the soils (Bailey and Lazarovits, 2003).
2.2.1 Influence on microbial population
Soil biota is the important soil constituents and the measurements of their
abundance, diversity or activity are considered potential indicators of soil quality.
Blue green algal abundance in soils has mostly been determined by direct
observation, plating techniques and measurement of pigments (Roger and
Kulasooriya, 1980). Tsujimura et al., (1998) investigated the distribution of soil
algae in saline irrigation land using culture dilution method, which estimates density.
However, the culture dilution method for soil algae estimation tends to lead to
underestimation (Broady, 1979; Whitton and Potts, 2000). Another problem when
estimating algal biomass by the culture method is that the sample may include
organisms, which can grow in culture but not in situ conditions. Some algae, which

may inhabit water, form dormant cells such as zygospores in dry periods and then
germinate when the habitat is resubmerged. Other methods for quantifying soil algae
hav ebeen attempted such as direct microscopic examination technique using
fluorescent microscopy, pigment extraction technique (Johansen, 1993). However,
each method has its own advantages and limitations (Fogg et al., 1973; Whitton and
Potts, 2000) and till now no standard method for estimation of soil algae has been
established. Venkataraman (1975) reported that the number of microorganisms is
affected in pot experiment using Tolypothrix tenuis as the inoculant.
Ibrahim et al. (1971) observed an increase in the total microbial population,
especially the number of nitrifiers and Azotobacter and Clostridium. Rao and Burns
(1990a,b) observed an eight fold increase in bacterial number after 13 weeks of
inoculation with the mixture of BGA. However, the increase was only 2.8 fold after
21 weeks. Similarly, Rogers and Burns (1994) recorded 500 fold, 16 fold and 48
fold increase in bacterial, fungi and actinomycetes population under the treatment
inoculated with Nostoc muscorum over the non-inoculated one.
Bachinger (1996) investigated soil microbial parameters and reported that the
treatment with high N content humus exhibited higher biological activity like
protease and dehydrogenase activity as well as microbial biomass (Chloroform
fumigation extraction). Microbial biomass is the main agent that supports the soil
functions and associated processes involved with the storing and the cycling of
nutrients and energy (Carter et al., 1999).
Hashem (2001) isolated, identified and quantified Cyanobacterial strains
from a wide range of distinctively different types of soils, viz., acid, calcareous,
saline, red and neutral soils under different agroecological zones (AEZ) of
Bangladesh. The isolated strains were tested for their N2-fixing capacity and growth
rate under various stress conditions prevailing in the rice field e.g. pH, combined N,
pesticides, salinity and nutrient availability in order to select suitable strains for use
as biofertilizer. Large-scale cyanobacterial biofertilizer was produced with the strains
showing high rates of growth and N2 fixation both in liquid cultures under laboratory
conditions and in soils of their habitats and non-habitats under open air. To assess the
effectiveness of the produced biofertilizer, field trials at the selected locations were
carried out on rice. To assess the effectiveness of the produced biofertilizer, field

trials at the selected locations were carried out on rice. Results of the field trials
showed that cyanobacterial biofertilizer may reclaim the problem soils such as acid
soils and saline soils, improve the fertility status and may supplement 21.5-35% N
for rice cultivation in these soils. This biofertilizer may be used in improving the soil
environment.
2.2.2 Influence on cyanobacterial diversity
Cyanobacteria contribute 15% of plant algal flora in tropics and about 2% in
the temperate climate. They are unique photosynthetic diazotrophs that have
contributed to the fertility of rice fields for centuries. The mass multiplication of
cyanobacteria for field application has gained momentum and is seen as a viable
option to cut down fertilizer costs. The soil based cyanobacterial inoculum is one of
the primary modes of algalization of the rice fields (Selvakumar et al., 2004).
In a rice field, crop canopy encourages the occurrence of forms like
Calothrix, Scytonema, Tolypothrix and Aulosira but it is dominated by green algae
just after transplantation. Thus, the density of cyanobacteria in the paddy field
ecosystem varies with the growth of rice crop (Kulasooriya, 1998). Inoculation of
BGA and Azolla alone or in combination resulted in increased density of BGA
dominated by Nostoc, Anabaena & Phormidium (Nayak et al. 2001).
The occurrence of cyanobacteria during wheat crop has also been reported
but there has been, however, no information on their interaction and role under such
conditions especially in relation to nitrogen fixation. There is a paucity of knowledge
on cyanobacterial diversity and naturally occurring seasonal variations of these
primary producers has been mainly studied with traditional cultivation dependent
and microscopic method in a variety of localities. Cyanobacterial abundance in soils
mostly determined by direct observations, culture dilution methods, plating
techniques and measurement of pigments (Roger and Kulasooriya, 1980), tend to
lead to underestimation (Broady, 1979; Whitton and Potts, 2000).
Berestetskii et al. (1986) reported that continuous cropping without fertilizers
and continuous cropping with green manuring resulted in the greatest numbers of
cyanobacteria in the rhizosphere of rice (41,200 and 68,700 cells/g soil,

respectively). On the other hand application of 180 kg N/ha reduced the population
to 23,800 cells.
Hashem et al. (1996) studded the effects of nutrients on indigenous blue-
green algae and rice yield were examined in Bangladesh in the boro season of 1992.
Ten treatments consisting of combinations of N, P, K, Mo, Mn, B, Zn, and Cu and
one control treatment without added nutrients were evaluated. Blue-green algal
populations were estimated before transplanting, 45 days after transplanting, and
after harvest. The indigenous BGA population was increased by added fertilizers.
The maximum increase was achieved in the plot receiving all the elements, followed
by the treatment with Mo, N, P, and K. The BGA flora recorded after harvest was
less than that observed 45 days after transplanting. Grain yield of rice increased
significantly with all treatments compared with the control. Maximum grain yield,
straw yield and nitrogen content in grain and straw were obtained in the treatment
with all the elements. Treatment with all the elements resulted in maximum N uptake
and N recovery. There was a positive correlation between BGA population and grain
and straw yields and nutrient uptake by rice.
Irisarri et al. (1999) evaluated the potential use of nitrogen-fixing
heterocystous cyanobacteria as natural biofertilizer for rice in Uruguay. Species
diversity, abundance and variation of these microorganisms during the crop cycle
were studied at Paso de la Laguna. Species diversity and population density of
heterocystous cyanobacteria were compared between treatments without urea
inoculated with cyanobacteria, with urea application and without inoculum, and
without N or inoculum. The commercial inoculum used dry mixture of Nostoc sp.
and Tolypothrix tenuis and was applied at twice the recommended dose. CuSO4 (2.5
kg/ha) was added to the control treatment to reduce the native cyanobacterial
population. Approximately 90% of the heterocystous cyanobacteria found in all
treatments belonged to the genera Anabaena and Nostoc. Anabaena was the
dominant genus in the control treatment and Nostoc in the rest of the treatments. The
less abundant genera were Calothrix, Cylindrospermum, Nodularia, Scytonema and
Tolypothrix. Macroscopic colonies of Gloeotrichia sp. appeared in all the treatments,
12 weeks after irrigation started. The highest value of cyanobacteria, 1.6x105
CFU/cm2
, was found in the control 8 weeks after irrigation started. At this time of

crop cycle, the highest cyanobacterial numbers were found in all the treatments. The
broadcast application of urea and the inoculation were associated with low
cyanobacterial density, 1.6x104
CFU/cm2
, respectively.
Leganes et al. (2001) conducted field experiments in Valencia, Spain to
determine the effect of phosphorus fertilizer application, straw incorporation (5 t/ha),
insecticide application (1.8 kg trichlorfon/ha) and inoculation with indigenous
heterocystous nitrogen-fixing cyanobacteria (mixture of Anabaena variabilis,
Calothrix marchica and Nostoc punctiforme; and Calothrix marchica and
Gloeotrichia sp.) on the abundance of heterocystous cyanobacteria in soil, nitrogen
fixation and rice (cv. Senia) grain yield. Superphosphate was applied at 25, 50, 100,
150, and 200 kg/ha. Application of different P levels did not significantly affect
either the number of nitrogen-fixing cyanobacteria, nitrogen fixation or grain yield.
Straw incorporation had no effect on the number of nitrogen-fixing cyanobacteria in
the soil. Nitrogenase activity in plots with incorporated straw was 87% higher than
the control plots. Grain yield was also higher (11%) in plots with incorporated straw.
Application of trichlorphon to control grazers slightly reduced the number of
heterocystous cyanobacteria in the soil. Inoculated plots showed a 92-105% increase
in the number of inoculated cyanobacteria taxa in soil compared to non-inoculated
plots. Plots fertilized with 140 kg N/ha showed a lower number of total and
inoculated heterocystous cyanobacteria in soil than the other plots.
Jha et al. (2001) showed that the application of chemical fertilizers at the
recommended level (medium fertility) or lower stimulated growth of the
diazotrophic cyanobacterial population and nitrogenase activity in a paddy field.
High fertilizer levels proved to be inhibitory to nitrogen-fixing cyanobacteria
indicating that indiscriminate use of chemical fertilizers for a longer period
drastically disturbed the natural ecological balance. Chunleuchanon et al. (2003)
investigated the N2-fixing cyanobacteria from Thai soils at 2-month intervals
between July 1997 and November 1999 to determine the population number,
population dynamics and favourable habitats. They selected the sites in three parts of
Thailand; North, Central and Northeast. In each part, they used various soil
ecosystems as sampling sites; at highest elevation as on the top of the mountain, in
the middle and at the foot of the mountain, as well as in flat areas of agricultural

practice and uncultivated areas. They found a high population of N2-fixing
cyanobacteria in agricultural areas where rice cultivation was practised, rather than
in other sites. The population dynamics in the mountain and uncultivated areas were
less fluctuating than in agricultural areas. The population densities in agricultural
areas increased in the rainy season and decreased during the dry season. Other
environmental factors such as temperature, moisture and pH also affected the
population densities in different habitats. They also found that Cyanobacterial
diversity was notably influenced by the type of ecosystem in both dry and rainy
seasons. The cultivation area containing rice in rotation with other crops contained
the most genetically diverse range of species.
Saboji and Geeta (2004) characterized cyanobacterial strains potential for
biofertilizer and their effect on paddy. Paddy and sugarcane are the major crops of
North Karnataka, India where flooded conditions persist. In order to develop the
cyanobacterial biofertilizer for paddy, the soil samples from districts of North
Karnataka were surveyed and analyzed for the presence of blue green algae under N-
free conditions. The cyanobacteria belonging to the genera Anabaena, Calothrix,
Cylindrospermum, Haphalosiphon, Nostoc and Westiellopsis were isolated and
identified from all the samples.
Prasanna and Nayak (2007) characterized the abundance of cyanobacteria in
various rice ecologies of India. They identified the isolates and determined diversity
indices in relation to the genera wise distribution. Average population counts
(measured as MPN) of various locations clearly brought out the tremendous diversity
among the locations sampled. Soil samples from Jeypore (Orissa state) recorded
highest diversity and 20 cyanobacterial forms, spanning 9 genera were isolated.
Nostoc and Anabaena were found to be the dominant genera in all the locations, in
terms of their abundance and exhibited highest diversity indices. Their results
suggested the need for practical utilization of these organisms towards developing
region-specific inocula-which can establish better in their niche and provide
maximum benefits to the crop.
In a rice field, crop canopy encourages the occurrence of forms like
Calothrix, Scytonema, Tolypothrix and Aulosira but it is dominated by green algae
just after transplantation. Thus, the density of cyanobacteria in the paddy field

ecosystem varies with the growth of rice crop (Kulasooriya, 1998). Inoculation of
BGA and Azolla alone or in combination resulted in increased density of BGA
dominated by Nostoc, Anabaena & Phormidium (Nayak et al. 2001).
Irisarri et al. (2001) studied the effect of urea fertilization on population
density and diversity of heterocystous cyanobacteria on a 3-year assay in Uruguay.
They observed a highest number of cyanobacteria, 1.6×104
CFU m−2
, at the control 8
weeks after flooding. About 90% of the heterocystous cyanobacteria found in both
treatments belong to the genera Nostoc and Anabaena. Maximum nitrogenase
activity was observed after 12 weeks of flooding in both treatments, with an average
of about 20 μmol C2H4 m−2
h−1
.
2.3 Cyanobacterial inoculation and soil parameters
Roger and Kulasooriya (1980) described that the beneficial properties of rice
field soils may be enhanced by the growth of blue green algae. The properties
included improved water-holding capacity, release of vitamins or plant stimulating
hormones, formation of extracellular polysaccharides leading to improved soil
aggregation and solubalilzation of phosphates and significant improvement as
measured in terms dehydrogenase, urease and phosphatase activities. Singh (1961)
reported that the mucilaginous and fragile thalli of Aphanothece from a compact
grey substratum firmly holding the soil particles together which also checks the soil
erosion. Such improvement in soil aggregation due to algal inoculation may favour
better seedling emergence of upland crops soon after rice harvest (Rogers and Burns,
1994).
BGA are known to excrete extracellularly a number of compounds like
polysaccharides, peptides, lipids in soil, which possible diffuse around soil particles
and hold/glue them together in the form of micro aggregates, which in turn grow and
take the shape of macroaggregate and subsequently covert into larger soil aggregates.
The importance of these compounds in soil aggregate formation or soil stabilization
has been indicated by many workers (Rogers and Burns, 1994). The quantity and
quality of excreted compounds also vary depending upon the species of blue green
algae, their physiological growth stages and also the associated environmental
conditions.

Traore (1985) studied nitrogen fixation by cyanobacteria during a cropping
cycle in three rain paddy fields of Mali that had not received exogenous nitrogen.
Under intense sunlight and in the absence of a crop canopy, the acetylene reducing
activity (ARA) showed two maxima, at the end of morning and in mid-afternoon.
With medium or low intensity of light and dense plant cover, a single maxima was
observed at the end of the morning. In the course of the cropping cycle, ARA
showed two maxima, at the tillering period and at crop ripening. In the case of the
nitrogen-fixing cyanobacteria, the first ARA peak corresponded to the predominance
of Anabaena species and the second one to the predominance of Cylindrospermum
species. No nitrogen-fixing forms were observed in one of the paddy fields studied.
A number of heterocystic non-nitrogen fixing species have been identified. Pot
experiments confirmed the inhibition of ARA in cyanobacteria by high light
intensity. Oscillatoria spp. are self-protected against light by negative phototactism
and by a process of photokinetic aggregation.
Sannigrahi and Mandal (1997) conducted experiments on the effect of slow
release nitrogenous fertilizers on the fixation of nitrogen by blue-green algae and the
changes in the contents of different nitrogen fractions in soils revealed that BGA
(Aulosira fertillissima) inoculation caused ~5% increase in the total nitrogen content
of Bolpur (Rhodustalf, pH 6.5) and Cooch Behar (Fluvaquent, pH 5.4) soils. Among
the fertilizer treatments, urea recorded the highest increase in total N due to
inoculation followed by lac-coated urea whereas the increase was lowest with
crotonylidene diurea. Application of N fertilizers increased both inorganic and
organic fractions of soil nitrogen. Readily available N forms (NH4
+
-N, NO3
-
+NO2
-
-N
and hydrolysable ammonium + amino sugar-N) were lower with inoculation than in
its absence, irrespective of soils and fertilizer treatments.
Ghosh and Saha (1997) conducted field experiments with wetland rice (Or
yza sativa cv. IR-36) in a sandy clay loam soil (Entisol) to study the effect of
inoculation with a soil-based mixed culture of four diazotrophic cyanobacteria,
Aulosira fertilissima, Nostoc muscorum, N. commune and Anabaena spp., on the N-
flux in inorganic NH4
+
+ NO3
–
+ NO2
–
), easily oxidizable, hydrolysable and non-
hydrolysable forms of N in soil during vegetative growth periods of the crop. Effects
on grain and straw yield and N uptake by the crop were estimated. The effects of

applying urea N and N as organic sources, viz. Sesbania aculeata, Neem
(Azardirachta indica) cake and FYM, each at the rate of 40 kg N ha–1
, to the soil
were also evaluated. Inoculation significantly increased the release of inorganic N,
evidenced by its increased concentrations either in soil or in soil solution. However,
such increases rarely exceeded even 4% of total N gained in different forms in the
soil system by inoculation during the vegetative growth stages of the rice plant, when
the nutritional requirement of the plants is at a maximum. Most of the N2 fixed by
cyanobacteria remained in the soil as the hydrolysable form (about 85%) during this
period. Inoculation caused an insignificant increase in grain (8%) and straw (11%)
yield, which was, however, accompanied by a significant increase in N uptake by the
grain (30%) and an increase in total uptake of 15.3 kg N ha-1
. Such beneficial effects
of inoculation varied in magnitude with the application of organic sources, with
farmyard manure (FYM) being the most effective. Application of urea N, on the
other hand, markedly reduced such an effect.
The rice-Indian mustard-moong [moong bean] (RMM) crop rotation was
observed to be more suitable for cyanobacterial nitrogen fixation than rice-wheat-
maize rotation. They also showed that cropped plots had higher nitrogenase activity
than fallow plots (Jha et al., 2001). The low fertility coupled with RMM rotation
were found to be best suited for promoting nitrogen fixation by cyanobacteria to
supply the rice plants. A top dressing of chemical nitrogenous fertilizer drastically
suppressed the cyanobacterial nitrogenase activity (ARA) within 12 h; the magnitude
of inhibition varied with respect to the cropping system. The inhibition was
overcome by the 10th day and the ARA value reached the pre-application value or
even higher in the case of low fertility and medium fertility level plots. They also
established a regression equation to predict nitrogen fixation in a given soil
ecosystem.
To develop suitable integrated nutrient management technology for lowland
rice (cv. Pawana)-wheat (cv. HD 2189) cropping system, Gholve et al. (2003)
conducted experiments in Maharashtra, India, during 1998-2001. Their treatments
comprised: 100% recommended rate (RD) of N (T1), 50% RD of N + 10 t Gliricidia
green manure/ha (T2) and 75% RD of N + 20 kg blue green algae (BGA)
[cyanobacteria]/ha (T3) nutrient management combinations for rice; and 75, 100 and

125% RD of N (F1, F2 and F3, respectively) treatments for wheat. RD for both crops
was 100, 50 and 50 kg N, P and K/ha, respectively. T2 out-yielded the rice grain
yields of T1 and T3. In terms of the residual effect of nutrient management in rice on
yield of succeeding wheat crops, T2 recorded the maximum wheat yield during
individual years as well as in pooled (34.18 q/ha). In terms of fertilizer management
in succeeding wheat crop, F3 produced the highest wheat yield (37.65 q/ha). Rice
grain equivalent yield was highest in T2. Graded N levels for wheat crop pooled data
indicated that the rice grain equivalent yields were at par in F3 and F2 treatments.
The data on net profit revealed that T2 recorded the highest values (Rs. 20 370/ha).
However, T1 and T3 were at par with each other, indicating the efficient role of
BGA as a low-cost technology in rice for substitution of N rate up to 25%. T2
recorded the highest benefit: cost (B:C) ratio (1.57), while F2 and F3 recorded equal
B:C ratio (1.51).
Dixit and Gupta (2000) conducted field experiments during two consecutive
kharif (monsoon) seasons of 1993 and 1994 on an Inceptisol soil at Kanpur, Uttar
Pradesh, India with rice cultivar Saket-4. The results revealed that grain and straw
yields of rice increased significantly with increasing levels of NPK fertilizers.
Application of farmyard manure at 10 tonnes ha-1
and blue green algae inoculation
either alone or in combination, increased the economic yield. The average increase in
the grain yield due to BGA was 0.24 tonne ha-1
(7.5%) while combined use of
farmyard manure and BGA showed the increase of 0.60 tonne ha-1
(19.2%). There
was an economy of 30 kg N, 15 kg P and 15 kg K due to farmyard manure and BGA
in first crop of rice. Content and uptake of N, P and K in grain showed increasing
trends as a result of NPK fertilizers, farmyard manure and BGA inoculation either
alone or in combination. Quality parameters like hulling percentage, milling
percentage, protein and amylose contents also increased due to use of these inputs.
At post-harvest stage of second year rice crop, there was a little variation in soil pH
as affected by treatments. Addition of farmyard manure and BGA showed positive
changes in organic carbon and N content of the soil. Available P and K content also
showed increasing tendency due to the treatments. Highest economic yield of the
crop was noted in the treatment combination of N120P60K60 and farmyard manure +
BGA.

Jha et al. (2004) studied the effect of organic substances viz., sewage and
slurry, compost, farmyard manure (FYM) and green manure on cyanobacterial
nitrogenase activity and its distributional pattern under different moisture regimes.
They showed that green manure was the most effective in enhancing cyanobacterial
nitrogenase activity, followed by FYM, compost and sewage and slurry. They
observed a better response in soils under waterlogged than under moist conditions
and gradual increase in nitrogenase activity up to one per cent organic carbon both in
vitro and in vivo.
Nayak et al. (2004) investigated the nitrogen fixing potential of
cyanobacteria in terms of acetylene reducing activity(ARA) and biomass
accumulation (in terms of chlorophyll) using surface and below-surface soil cores,
collected from, rice fields 45 and 90 days after transplanting (DAT). Their treatments
were different levels of urea (30, 60, 90, and 120 kg N ha-1) in combination with
inoculation using blue green algae (BGA) and Azolla biofertilizers. They observed
that application of biofertilizers brought about a significant enhancement in
chlorophyll accumulation and nitrogenase activity, when measured 45 DAT.
[positive effects in below-surface soil cores, on both these parameters as a result of
application of biofertilizers further emphasized their contribution to the N economy
of rice fields. Plots treated with 30 and 60 kg N ha-1
along with biofertilizers
exhibited the highest percentage increased in terms of algal biomass and ARA.
Karthikeyan et al. (2007) evaluated the potential of three cyanobacterial
isolates from the rhizosphere of wheat, with emphasis on their plant growth
promoting activity in pot culture experiments. All treatments were taken up in sterile
soil, under controlled conditions of National Phytotron Facility, IARI and in the
Glasshouse, using unsterile soil. The treatments in which all the three-cyanobacterial
isolates were applied along with 1/3 N + P + K gave statistically equivalent results as
compared to application of with full dose of chemical fertilizers in terms of grain
yields. Significant enhancement in microbial biomass carbon in the treatments was
observed at mid-crop and harvest stage, over un-inoculated controls. Field level
evaluation of these strains and testing under different agro-climatic conditions will

help to further evaluate their agronomic efficiency and utility in integrated nutrient
management of wheat crop.
2.3.1 N contribution by cyanobacteria
Soil nitrogen pool is believed to be maintained through biological nitrogen
fixation (Roger and Ladha, 1992) and fertilizer nitrogen. Among indigenous nitrogen
fixers in rice fields, blue green algae are the main contributors to nitrogen fixation
(Roger and Ladha, 1992). Nitrogen is brought into organic farming systems through
the inclusion of nitrogen fixing crop in rotation or use of biofertilizers/blue green
algae in rice crop. As a result, nitrogen balance studies under such systems are
usually positive (Nguyen et al., 1995). A blue green algal bloom usually corresponds
to less than 10 kg N ha-1
, a dense bloom may contain 10-20 kg N ha-1
.
Blue green algal biofertilizer is recommended only as a supplement to
nitrogenous fertilizers and the supplementation effect may remain perceptible even
in the presence of high levels of fertilizer nitrogen (Venkataraman and Goyal, 1969).
Pronounced additive effect of algal application at lower levels of fertilizer nitrogen
becomes important in extensive agriculture which envisages use of less fertilizer
nitrogen and ensuring maximum utilization of the natural process.
Importance of fixation of nitrogen and sustenance of nitrogen fertility of soil
has been reported by Singh (1961), Singh and Bisoyi, (1989), Santra (1993). Lot of
information has been generated in tropics regarding improvement in the fertility
status of rice soils to sustain rice yields by utilizting diazotrophic blue green algae as
the biological input (De, 1939; De and Sulaiman, 1950; Venkataraman, 1972; Singh
and Bisoyi, 1989). These organisms gave a considerable build up of nitrogen fertility
in rice soil (Roger and Kulasooriya, 1980; Saha and Mandal, 1980; Roger and
Reynaud, 1982). Investigations have also been undertaken with regard to the
possibility of using nitrogen-fixing cyanobacteria in non-flooded temperate
agricultural soils (Reynaud and Metting, 1988).
Multilocational trials conducted under varying agroclimatic conditions using
different rice varieties indicated that algal inoculation can result in an addition of 30

kg N ha-1
. This however, depends upon agroecological condition, which would
regulate the activity and establishment of introduced algae (Venkataraman, 1979;
Venkataraman and Goyal, 1969 though Roger and Kulasooriya (1980) and Singh and
Singh (1987) recorded 30 kg N h-1
year-1
as a satisfactory value when environmental
factors are favourable. Experiments conducted at CRRI, Cuttack indicated that
inoculation in soil with Aulosira sp. At the rate of 60 kg ha-1
(fresh weight)
registered significant changes of soil nitrogen content. BGA incorporated to Soil
increased 13-14% of N content under field conditions and BGA amended soil
released 50% of ammonium N at 50 days of flooding (Singh et al., 1981). The rate
of N released by BGA was 12 and 35% after 7 and 35 days of flooding (Saha et al.,
1982). Ghosh and Saha (1997) also reported that the inoculation of soil with soil
based mixed culture of four diazotrophic cyanobacteria namely Aulosira fertilissima,
Nostoc muscorum, Nostoc commune and Anabaena species significantly increased
the release of inorganic nitrogen in soil. Nitrogen content of soil was higher in
exposed light incubated soil than unexposed soil due to N gain by blue green algae
(Singh and Singh, 1987).
Inoculation with Nostoc muscorum in a green house experiment had a
pronounced effect on soil chemical and biological properties with total nitrogen
increasing by 111-120% (Rogers and Burns, 1994). Chopra and Dube (1971)
reported that the pots inoculated with Tolypothrix tenuis showed considerable
increase in total and organic nitrogen. Release of nitrogen from rapid decomposition
of fresh or dry mass incorporated into the soil has been reported (Saha et al., 1982;
Tirol et al., 1982; Miam and Stewart, 1985).
Availability of nitrogen fixed by blue green algae to the rice plant has been
shown with the help of 15
N studies (Reynaud et al., 1975; Inubishi and Watanabe,
1986). Using 15
N, Stewart (1967) have shown the possible contribution of blue
green algal nitrogen fixation. Mian and Stewart (1985) observed that about 50% of
total N fixed by BGA is released to the surroundings.
Recently, contribution of N2 fixing blue green algae to rice production and
availability of nitrogen using 15
N labeled material, in microplot experiment to obtain

more direct information on the dynamics of utilization of N by rice plants has been
studied (Valiente et al., 2000). In this study, the recovery of blue green algal
nitrogen was compared with the recovery of same amount of labeled ammonium
sulphate under field conditions. The availability of nitrogen to rice plant was similar
to that of chemical fertilizer even at the tillering stage indicating a fast mineralization
of organic nitrogen in the soil followed by a rapid and fast transfer of fixed nitrogen
to rice crops. The amount of blue green algal nitrogen recovered in plants was
however lower in other study (Tirol et al., 1982).
2.3.2 Influence of cyanobacterial inoculation and N uptake
In intensified rice systems N use and N uptake efficiency decreases as
application of N fertilizer increases. The role of blue green algae in nitrogen
economy of rice fields and the yield of rice has been well demonstrated and widely
documented (Venkataraman, 1981; Santra, 1991). Nitrogen fixed by these
organisms may become available to rice plants only after their release into the
surrounding either as extracellular products and/or on mineralization of the
intracellular contents. Direct evidence of the transfer of blue green algal N to rice
plants is however, scarce (Roger, 1996). Nitrogen fixation by blue green algae vis a
vis its release in the soil water system may be more useful for crop production during
the vegetative growth stage of rice plants than at later stages (Ghosh and Saha, 1993;
Roger et al., 1993).
Recovery of BGA fixed N by rice varied from 13-50% depending upon the
nature of inoculum, method of application and the absence of soil fauna (Tirol et al.,
1982). 52% of nitrogen added was recovered in the grain and straw of the first rice
crop using suspension of blue green alga, Aulosira buried 5-7 cm deep in greenhouse
pot culture experiments. Addition of ammonium chloride equivalent to 100 kg N ha-
1
did not affect the recovery of algal nitrogen and surface placement of alga reduced
the recovery by first crop to 37% of added nitrogen (Wilson et al., 1980). The
results from the studies undertaken by other workers also indicated the transfer of
fixed nitrogen from blue green algae to higher plants and demonstrated the potential
for efficient transfer of nitrogen from algal cells to rice plants (Jones and Wilson,

1978; Stewart, 1967). In a four crop experiments comparing the role of Azolla, blue
green algae and urea, Singh and Singh (1987) found positive N balance ranging from
13-163 mg N crop-1
pot-1
. Balances were highest (133-163 mg N crop-1
pot-1
) in pots
that received 60 kg organic nitrogen (BGA and Azolla) ha-1
and lowest 13-29 mg in
pots that received 30-60 kg N ha-1
as urea. Balance in the control was 51 mg N crop-
1
pot-1
.
2.3.3 Role of cyanobacteria on organic matter and C status
A build up of organic matter due to algal inoculation in rice soil has been
reported (De and Sulaiman, 1950; Das et al., 1991). Fuller and Rogers (1952)
estimated an annual increment of 6 tons organic matter per million pounds of soil in
Arizona through BGA inoculation. BGA inoculation increased soil organic carbon
and Singh (1961) reported 68.7% increase of organic matter in Usar soils. Using
15
N, Nekrasova and Aleksandrova (1982) confirmed that algal biomass contributed
significantly to humus formation in soils despite the absence of typical lignin in
them. All these results and others compiled by Roger and Kulasooriya (1980) and
Roger et al. (1987) indicated that under favourable conditions a good algal bloom in
rice field yields on an average about 6-8 tonnes of fresh biomass. The persistence of
such biomass in soil as organic matter however, depends on its decomposability.
The biomasses of some algae are decomposed quickly while those of others last
longer (Watanabe and Kiyohara, 1960). The differing susceptibility of algae to
decomposition is related to the relative biodegradability of algal cell-wall
compounds, like polyaromatic compounds (Gunnison and Alexander, 1975) and their
physiological growth stages. As an example, the decomposability of Anabaena sp in
soil is faster than other commonly inoculated BGA species in rice fields. Algal
biomass rich in akinetes is also not easily decomposed when compared with algal
vegetative cells (Mandal et al., 1999).
Aiyer et al. (1972) could not detect any increase in organic carbon and
attributed it to rapid loss of organic matter due to tropical climatic conditions.
Further, in rice fields well-developed colonies of blue green algae with wide
variations in the levels of organic carbon or biomass addition by BGA have been

recorded (Rao and Burns, 1990; Das et al., 1991). However, experiments at CRRI
revealed 5-32% increase of soil organic carbon under field conditions (Singh et al.,
1981). In intensified rice systems N use and N uptake efficiency decreases as
application of N fertilizer increases. The role of blue green algae in nitrogen
economy of rice fields and the yield of rice has been well demonstrated and widely
documented (Venkataraman, 1981; Santra, 1991). Nitrogen fixed by these
organisms may become available to rice plants only after their release into the
surrounding either as extracellular products and/or on mineralization of the
intracellular contents. Direct evidence of the transfer of blue green algal N to rice
plants are however, scarce (Roger, 1996). Nitrogen fixation by blue green algae vis
a vis its release in the soil water system may be more useful for crop production
during the vegetative growth stage of rice plants than at later stages (Ghosh and
Saha, 1993; Roger et al., 1993).
2.4 Molecular diversity analysis
Turner et al. (2001) conducted molecular phylogenetic study using maximum
likelihood tree inference methods with small subunit ribosomal RNA sequence data
to ascertain the evolutionary relationships among sheathless, single-cell
cyanobacteria capable of nitrogen fixation. They showed that cyanobacterial strains
of the genus Cyanothece fall into at least three independent lines of descent within a
larger assemblage previously designated the SPM sequence group. They also
observed that there was no strong correlation between aerobic versus anaerobic
nitrogen-fixing activity and phylogenetic relationships. Their results support a
hypothesis of multiple gains and/or losses of nitrogen-fixation abilities among the
sheathless, unicellular cyanobacteria.
Lindblad et al. (1989) prepared DNA from cyanobacteria freshly isolated
from coralloid roots of natural populations of five cycad species viz. Ceratozamia
mexicana mexicana (Mexico), C. mexicana robusta (Mexico), Dioon spinulosum
(Mexico), Zamia furfuraceae (Mexico) and Z. skinneri (Costa Rica). Using the
Southern blot technique and cloned Anabaena PCC 7120 nifK and glnA genes as

probes, restriction fragment length polymorphisms of these cyanobacterial symbionts
were compared. The five cyanobacterial preparations showed differences in the sizes
of their DNA fragments hybridizing with both probes, indicating that different
cyanobacterial species and/or strains were involved in the symbiotic associations. On
the other hand, a similar comparison of cyanobacteria freshly collected from a single
Encephalartos altensteinii coralloid root and from three independently subcultured
isolates from the same coralloid root revealed that these were likely to be one and the
same organism. Moreover, the complexity of restriction patterns shows that a
mixture of Nostoc strains can associate with a single cycad species although a single
cyanobacterial strain can predominate in the root of a single cycad plant. Thus, a
wide range of Nostoc strains appear to associate with the coralloid roots of cycads.
Lyra et al. (1997) characterized Planktonic, filamentous cyanobacterial
strains from different genera, both toxic and nontoxic by SDS-PAGE of whole-cell
proteins and PCR/RFLP of the 16S rRNA gene. Total protein pattern analysis
revealed the mutual relationships at the genus level. The nonheterocystous strains out
grouped from the nitrogen-fixing ones. With both methods, Aphanizomenon
clustered with Anabaena, and Nodularia with Nostoc. In the RFLP study of
Anabaena, the neurotoxic strains were identical, but the hepatotoxic ones formed a
heterogeneous group. Genetic distances found in the RFLP study were short,
confirming that close genotypic relationships underlie considerable diversity among
cyanobacterial genera.
Rudi et al. (1997) developed a diagnostic system using the DNA sequence
polymorphism in the 16S rRNA regions V6 to V8 for individual strain
characterization and identification of oxyphotobacterial strains (cyanobacteria and
prochlorophytes). PCR primers amplifying V6 to V8 from oxyphotobacteria in
unialgal cultures were constructed. Direct solid-phase or cyclic sequencing was used
to determine the sequences from the amplified DNA. Their survey included 10
strains of Nostoc /Anabaena /Aphanizomenon (Nostoc category), 5 strains of
Microcystis (Microcystis category), and 4 strains of Planktothrix (Planktothrix
category). Fifteen additional strains of cyanobacteria and two strains of

prochlorophytes were included such that the major phyletic groups were represented.
One of the strains, Phormidium sp. NIVA-CYA 203, contained an 11-nucleotide
insertion with no homology to other known 16S rRNA sequences. Based on
parsimony and neighbor-joining trees, the phyletic relationships of the strains were
investigated. Thirteen major branches were found, with Pseudanabaena limnetica
NIVA-CYA 276/6 as the most divergent strain. The strain categories Nostoc,
Planktothrix, and Microcystis were all monophyletic. The sequence polymorphism
within Nostoc was higher than that in Planktothrix and Microcystis. Based on the
sequence and phyletic information, group-specific PCR primers for the categories
Nostoc, Planktothrix, and Microcystis were constructed. For the strains included in
this work, the amplifications were specific for the relevant groups.
Viti et al. (1997) investigated the genotypic diversity of several strains of
Arthrospira maxima and A. platensis on the basis of morphological criteria using
very sensitive total DNA restriction profile analysis which are cultivated and sold as
health food, animal feed and source of food additives and fine chemicals.
Nishihara et al. (1997) used random amplified polymorphic DNA (RAPD)
analysis to discriminate genotypes in five species of Microcystis. Strains of each
group with the identical allozyme genotype gave similar RAPD patterns
characterizing the respective group. On the other hand, no similarities in RAPD
patterns were observed among strains of which allozyme genotypes were different. A
good accordance between the RAPD analysis and allozyme divergence indicated a
high reliability of both methods for discrimination of the affiliated groups of
Microcystis. Several amplified DNA fragments, which were expected to be markers
for a particular taxon with identical allozyme genotype, were also observed on the
RAPD patterns. Genetic homogeneities of M. novacekii, M. viridis, and M.
wesenbergii were shown by RAPD analysis as well as the allozyme genotype.
However, significant variations were observed in M. aeruginosa and M. ichthyoblabe
in the levels of DNA and proteins (allozymes).

Rasmussen and Svenning (1998) used repeated DNA (short tandemly
repeated repetitive [STRR] and long tandemly repeated repetitive [LTRR])
sequences in the genome of cyanobacteria to generate a fingerprint method for
symbiotic and free-living isolates. Primers corresponding to the STRR and LTRR
sequences were used in the PCR, resulting in a method which generates specific
fingerprints for individual isolates. The method was useful both with purified DNA
and with intact cyanobacterial filaments or cells as templates for the PCR. Twenty-
three Nostoc isolates from a total of 35 were symbiotic isolates from the angiosperm
Gunnera species, including isolates from the same Gunnera species as well as from
different species. The results show a genetic similarity among isolates from different
Gunnera species as well as a genetic heterogeneity among isolates from the same
Gunnera species. Isolates which have been postulated to be closely related or
identical revealed similar results by the PCR method, indicating that the technique is
useful for clustering of even closely related strains. The method was applied to
nonheterocystus cyanobacteria from which a fingerprint pattern was obtained.
Nilsson et al. (2000) studed the diversity among 45 cyanobacterial isolates
from 11 different Gunnera species originating from different geographical areas by
means of polymerase chain reaction (PCR) fingerprinting with short tandemly
repeated repetitive (STRR) sequences as primers. They identified ten groups of
symbiotic cyanobacteria and five unique isolates not belonging to a particular group
and showed that most groups are restricted to one geographical area which indicates
the limited distribution of related cyanobacterial strains. They also found an
extensive cyanobacterial diversity both within and between the 11 different Gunnera
species.
Redfield et al. (2002) examined cyanobacterial diversity in three types of
predominant soil crusts in an arid grassland in Utah, USA by terminal restriction
fragment length polymorphism (TRF or T-RFLP) analysis and 16S rDNA sequence
analysis from clone libraries. They extracted total DNA from cyanobacteria, lichen,
or moss-dominated crusts that represent different successional stages in crust
development, and which contribute different amounts of carbon and nitrogen into the

ecosystem and cyanobacterial 16S rRNA genes were amplified. Both TRF and clone
sequence analyses indicated that the cyanobacterial crust type is dominated by strains
of Microcoleus vaginatus, but also contains other cyanobacterial genera. In the moss
crust, M. vaginatus-related sequences were also the most abundant types, together
with sequences from moss chloroplasts. In contrast, sequences obtained from the
lichen crust were surprisingly diverse, representing numerous genera, but including
only two from M. vaginatus relatives. By obtaining clone sequence information, they
were able to infer the composition of many peaks observed in TRF profiles, and all
peaks predicted for clone sequences were observed in TRF analysis. Their study
provides the first TRF analysis of biological soil crusts and the first DNA-based
comparison of cyanobacterial diversity between lichen, cyano and moss-dominated
crusts. Their results indicated that for this phylogenetic group, TRF analysis, in
conjunction with limited sequence analysis can provide accurate information about
the composition and relative abundance of cyanobacterial types in soil crust
communities.
Teaumroong et al. (2002) studied the diversity among 853 isolates of
nitrogen-fixing cyanobacteria obtained from soil samples collected from different
ecosystems including mountainous, forest and cultivated areas in the central,
northern and northeastern regions of Thailand. Most isolates showed slow growth
rate and had filamentous, heterocystous cells. The percentage of heterocysts in the
filaments of different isolates varied from 8.3 to 9.6. Only a few strains showed high
nitrogen-fixing potential, while most of the strains exhibited low capacity for
nitrogen fixation. Anabaena and Nostoc were the dominant genera among these
isolates. One hundred and two isolates were randomly selected from this diverse
collection to determine the extent of genetic diversity on the basis of DNA
fingerprinting using the PCR method. Based on the PCR products obtained by using
a combination of three primers, all strains could be distinguished from one another.
When a subset of 45 isolates of Nostoc and a subset of 44 isolates of Anabaena were
further analyzed by PCR, a wide range of diversity was observed within each of
these genera.

Zheng et al. (2002) examined the genetic diversity of symbiotic
cyanobacteria in coralloid roots of cycads using PCR fingerprinting with primers
derived from repetitive sequences. They achieved a highest genetic resolution using
the primer corresponding to the short tandemly repeated repetitive sequences. They
collected cyanobacteria from the coralloid roots of a large number of indigenous
cycad plants and used directly in the PCR. They demonstrated that numerous
cyanobacteria were present in a single coralloid root even within a single cluster in
the coralloid root, and observed diversity between the apical, middle and basal
regions.
Song et al. (2005) investigated the diversity and changes of the
cyanobacterial assemblage during a rice growth season and after harvest in a paddy
field located in Fujian Province, China. They analyzed cyanobacterial populations by
a semi-nested PCR, followed by denaturing gradient gel electrophoresis analysis.
Twenty-four phylotypes were identified from the denaturing gradient gel
electrophoresis profiles. The number of cyanobacterial phylotypes showed a seasonal
variation and reached a peak in September, both in the upper (0–5 cm) and the
deeper (10–15 cm) soil fractions. Some cyanobacterial sequences were only present
during the rice growth season, while others were only found after harvest.
Taton et al. (2006) isolated 59 strains of cyanobacteria from the benthic
microbial mats of 23 Antarctic lakes, from five locations in two regions, in order to
characterize their morphological and genotypic diversity. On the basis of their
morphology, the cyanobacteria were assigned to 12 species that included four
Antarctic endemic taxa. Sequences of the ribosomal RNA gene were determined for
56 strains. In general, the strains closely related at the 16S rRNA gene level
belonged to the same morphospecies. Nevertheless, divergences were observed
concerning the diversity in terms of species richness, novelty, and geographical
distribution. For the 56 strains, 21 operational taxonomic units (OTUs, defined as
groups of partial 16S rRNA gene sequences with more than 97.5% similarity) were
found, including nine novel and three exclusively Antarctic OTUs.

Fiore et al. (2007) studied twelve populations of filamentous, heterocytous
scytonematoid cyanobacteria from subaerophytic (mainly epiphytic) habitats in
subtropical and tropical Brazil (São Paulo). The populations form a uniform cluster,
which differs from the traditional scytonematoid genera genetically and by several
indistinct, but typical morphological characters (fasciculation of filaments, rare false
branching). They isolated two strains in monospecific cultures and their 16S rRNA
gene sequencing indicated that they form a separate position at the generic level.
They proposed a new genus, Brasilonema with the type species Brasilonema
bromeliae and are described using combined molecular and cytomorphological
criteria, in accordance with the nomenclatorial recommendations of both the
Bacteriological Code and the Botanical Code of Nomenclature (cf. Oren 2004). The
genus Brasilonema is commonly distributed, particularly in subaerophytic habitats
from southeastern Brazil.
Marquardt and Palinska (2007) studied 30 strains of filamentous, non-
heterocystous cyanobacteria from different habitats and different geographical
regions assigned to diverse oscillatorian genera but they collectively referred to as
members of the Phormidium group. They characterized them using a polyphasic
approach by comparing phenotypic and molecular characteristics. Their phenotypic
analysis dealt with cell and filament morphology, ultra-structure, phycoerythrin
content, and complementary chromatic adaptation and the molecular phylogenetic
analyses were based on sequences of the 16S rRNA gene and the adjacent intergenic
transcribed spacer (ITS). Genetically similar strains originated from distant sites
while other strains isolated from the same sampling site were in different
phylogenetic clusters. Also the presence of phycoerythrin was not correlated with the
strains' position in the phylogenetic trees. In contrast, there was some correlation
among inferred phylogenetic relationship, original environmental habitat, and
morphology. Closely related strains came from similar ecosystems and shared the
same morphological and ultra structural features. Nevertheless, structural properties
are insufficient in themselves for identification at the genus or species level since
some phylogenetically distant members also showed similar morphological traits.

Their results reconfirm that the Phormidium group is not phylogenetically coherent
and requires revision.
Sihvonen et al. (2007) sequenced 16S rRNA genes from 42 cyanobacterial
cultures and environmental samples belonging to the genus Calothrix, and the
morphologically similar genera Rivularia, Gloeotrichia and Tolypothrix.
Phylogenetic analysis of the 16S rRNA gene identified large sequence diversity
among the Calothrix morphotype strains. Their results demonstrated that Calothrix,
Gloeotrichia and Tolypothrix do not form a monophyletic group but instead display a
high level of genetic diversity. The evolutionary distances between cyanobacteria,
morphologically identified as Calothrix, suggest that they belong to at least five
different genera. Their results also suggested that the genus Gloeotrichia is distantly
related to the genus Calothrix. They also found correlations between genetic
grouping and morphology in redundancy analysis.

3. MATERIAL AND METHODS
3.1 Experimental site
The experiment was conducted in the Kharif and Rabi seasons (July 2006 to
April 2007) using soil samples under rice and wheat crop of the organic farming
plots at the Indian Agricultural Research Institute (IARI), New Delhi, located at a
latitude 28o
N and longitude of 77o
E and is about 250 m above mean sea level.
The climate of Delhi is semi-arid and sub-tropical, characterized by hot
summers and cold winters. Mean annual precipitation is about 650 mm, most of
which is confined to a three month period from July to September (monsoon). The
total precipitation was 409.1 mm during Kharif season (Rice, July to November,
2006) and 106.9 mm during Rabi season (Wheat, November, 2006 to April, 2007)
and average temperatures ranged from 21.31 to 32.470
C and 12.62 to 26.30
C in
Kharif and Rabi season respectively.
The soil of the experimental area is of alluvial origin, sandy clay loam in
texture, alkaline in reaction, non-calcareous, and bears low cation exchange capacity.
The organic farming in this field at IARI, New Delhi was started in 2003 with
cropping sequence of rice-wheat. The layout has been kept undisturbed. In the
present study soil samples were studied under the rice (Pusa Basmati 1) and wheat
(HD-2687) crop.
3.2 Collection and analysis of soil samples
Field experiment on organic farming in operation for the last three years was
used for collection of soil samples. The treatments are as follows:
T
Tr
re
ea
at
tm
me
en
nt
ts
s:
:
1. A
Az
zo
ol
ll
la
a @
@ 1
1.
.0
0 t
t/
/h
ha
a
2. B
BG
GA
A @
@ 1
10
0 k
kg
g /
/ h
ha
a
3. F
FY
YM
M @
@ 5
5.
.0
0 t
t/
/h
ha
a
4. V
Ve
er
rm
mi
ic
co
om
mp
po
os
st
t @
@ 5
5.
.0
0 t
t/
/h
ha
a
5. A
Az
zo
ol
ll
la
a @
@ 1
1.
.0
0 t
t/
/h
ha
a +
+ B
BG
GA
A @
@ 1
10
0 k
kg
g /
/ h
ha
a +
+ F
FY
YM
M @
@ 5
5.
.0
0 t
t/
/h
ha
a
6. A
Az
zo
ol
ll
la
a @
@ 1
1.
.0
0 t
t/
/h
ha
a +
+ F
FY
YM
M @
@ 5
5.
.0
0 t
t/
/h
ha
a +
+V
Ve
er
rm
mi
ic
co
om
mp
po
os
st
t @
@ 5
5.
.0
0 t
t/
/h
ha
a
7. B
BG
GA
A @
@ 1
10
0 k
kg
g /
/ h
ha
a +
+ F
FY
YM
M @
@ 5
5.
.0
0 t
t/
/h
ha
a +
+ V
Ve
er
rm
mi
ic
co
om
mp
po
os
st
t @
@ 5
5.
.0
0 t
t/
/h
ha
a
8. A
Az
zo
ol
ll
la
a @
@ 1
1.
.0
0 t
t/
/h
ha
a +
+ B
BG
GA
A @
@ 1
10
0 k
kg
g /
/ h
ha
a +
+ F
FY
YM
M @
@ 5
5.
.0
0 t
t/
/h
ha
a +
+ V
Ve
er
rm
mi
ic
co
om
mp
po
os
st
t
@
@ 5
5.
.0
0 t
t/
/h
ha
a

9. N
N8
80
0P
P4
40
0K
K4
40
0
10. N
N0
0P
P0
0K
K0
0
Above treatments are applied to each crop i.e. Rice and Wheat but in Wheat; Azolla
was replaced by Azotobacter.
Plot size: 5 X 4m
Layout: Completely Randomized Block Design
Number of Replications: Three
The soil samples (0-15 cm depth, 5 cm diameter cores) were taken I) before sowing /
transplanting, II) 45 days and III) 90 days after sowing / transplanting.
3.2.1 Soil Chlorophyll (Prasanna et al., 2003)
To estimate the soil chlorophyll, fresh soil cores (0-3 cm) were collected with
the help of tube auger, and placed in 55 ml glass vials and tightly sealed using
subaseal stoppers. Acetone:DMSO (1:1) mixture was added to soil and vortexed to
allow proper mixing of soil. The vials were stored in dark, at room temperature until
all the pigments got extracted (48-96 hr.). The samples were thoroughly shaken at
the end of extraction period and the coloured solvent removed, by centrifugation.
The OD of supernatant was taken at 663, 645, 630 and 750 nm. Values of OD at 750
nm are substracted from the other readings as a correction for turbidity. The
concentration of chlorophyll is determined using the equations given by
SCOR/UNESCO (1966) and expressed in terms of per gram of soil.
Chlorophyll “A” = 11.64 (OD665) – 2.16 (OD645) + 0.10 (OD630)
Chlorophyll / g of soil = Chlorophyll “A” X Extract volume / Volume of sample of
soil
3.2.2 Soil nitrogenase activity (Acetylene Reduction Assay, ARA) (Hardy et al.,
1973)
Nitrogenase activity in soil cores was determined by Acetylene Reduction
Assay (ARA) with the help of Gas Chromatography (Gas chromatograph, Chemito
Model GC-1000).
The fresh soil cores (0-3 cm, approximately 14 g) were collected with the
help of tube auger, and placed in 55 ml glass vials and tightly sealed using subaseal
stoppers. After removing 3.5 mL of air from the vial using hypodermic syringe, 3.5

mL of acetylene was injected and the tubes were incubated for three hours under
continuous illumination (2500 Lux white light) at 30ºC. The reaction was terminated
by injecting 50% TCA and gas phase was assayed for ethylene. One mL of gas
mixture was removed with gas tight syringe and injected into preconditioned
Chemito GC-1000 Gas Chromatograph, housing a two meter long (2mm i.d.)
Porapak N stainless steel column and Flame Ionization Detector (FID). The column
temperature was maintained at 80ºC, injector and detector at 100ºC. A flow rate of
30 mL min-1
of N2 served as carrier gas. Standard ethylene gas (commercially
available as a mixture with argon) was used for auto-calibration using the software
(Company provided) and the amount of ethylene evolved was determined.
Peak height (mm) of C2H4 in the injection volume = a mm
Peak height for 1 mL injection volume = b mm
n mole C2H4 corresponding to ‘b’ mm peak height from the standard curve = ‘c’ n
moles
Volume of vial = ‘d’ mL = 55 mL
Volume of algal sample = ‘e’ mL = -- mL
Volume of gas phase in vial = d-e = ‘f ‘mL = -- mL
n moles C2H4 / vial = f x c for 180 min incubation
Chlorophyll value of the sample = ‘g’ mg chl mL-1
Chlorophyll of sample volume (e) = g x e = g x 5
Nitrogenase activity=n moles C2H4 mg-1
chlorophyll hr-1
= 10 x c x 60
180 x g x 5
Running conditions for Gas Chromatograph for Acetylene Reduction Assay
Detector type : FID, H2, 24 mL min-1
, air 180 mL min-1
, temperature
1000
C
Column : Stainless steel, 183 cm X 0.32, 1.0, Porapak N (60- 80mesh)
Injector port : Temperature, 100 o
C
Carrier gas : N2, 30mL min-1
Oven
temperature
: Iso-thermal, 80 o
C
Retention time : C2H4, 1.60 min (relative)
3.2.3 Soil organic carbon
Organic carbon in soil was determined by Walkley and Black method (1934).

(i) Reagents:
a) 1N Potassium dichromate: Dissolve 49.04 g of AR grade K2Cr2O7 in about
500 mL of distilled water and make the volume to one litre.
b) Concentrated sulphuric acid
c) 0.5 N Ferrous ammonium sulphate: Dissolve 196 g of ferrous ammonium
sulphate in distilled water, add 20 mL of conc. H2SO4 and make volume to
one litre with distilled water.
d) Diphenylamine indicator: Dissolve 0.5 g of the dye in a mixture of 20 mL of
distilled water and 100 mL of conc. H2SO4.
e) Orthophosphoric acid (85%).
(ii) Procedure:
One gram of 0.2 mm mesh soil sample was taken in a 500 mL dry Borosil
Conical flask. 10 mL of 1N K2Cr2O7 and 20 mL of conc. H2SO4 was added to it. The
flasks were swirled a little and kept on an asbestos sheet for 30 minutes at room
temperature. 200 mL of distilled water and 10 mL of orthophosphoric acid were
further added slowly. This was followed by addition of 1 mL of diphenylamine
indicator and titrated with 0.5 N ferrous ammonium sulphate solution until the green
colour starts appearing.
Organic carbon (%) in soil = 10 (B – S)/B X 0.003 X 100/wt. of sample (g)
Where, B and S stand for the titre values (mL) of Blank and Sample,
respectively.
3.2.4 Total nitrogen
Total N was estimated by Kjeldahl digestion-distillation method (Bremner,
1965).
(i) Reagents:
a) Digestion mixture: Potassium sulphate and copper sulphate (20:1).
b) Concentrated sulphuric acid.
c) Potassium thiosulphate
d) NaOH (40%).

e) Boric acid (4%)
f) 0.1N H2SO4
(ii) Procedure:
One gram of 0.2 mm mesh soil sample was taken in digestion tube. 6 mL of
conc. H2SO4, 1 g of digestion mixture and one piece of potassium thiosulphate
crystal was added to it. The tubes were kept on digester at 280o
C for 2 hr and 30
minutes. The tubes were cooled down at room temperature. The contents were then
distilled against 40% NaOH in distillation unit and collected in 4% boric acid. The
total N content was determined through titration against 0.1N H2SO4.
Total N (%) in soil = 10 (B – S)/B X 1.4 X 100/wt. of sample (g)
Where, B and S stand for the titre values (mL) of Blank and Sample, respectively.
3.3 Isolation, Purification and Identification of cyanobacteria
One gram of soil sample from different treatments was inoculated in 40 mL
BG-11 medium (nitrogen containing and nitrogen free) in 100 mL conical flasks.
These were incubated in a culture room under optimal growth conditions at 28+2o
C
temperature and 2500 lux light intensity with 16/8 light/dark cycle. The flasks were
observed everyday for the algal growth and when visible algal growth appeared, it
was lifted using an inoculation needle and suspended in 5 mL sterilized fresh
medium in a test tube. The tubes are shaken vigorously to make a homogenous
suspension and 0.5 mL of this was surface plated on an agar plate containing BG-11
medium. The plates were observed regularly and isolated colonies were picked up
and inoculated into 5 mL fresh sterilized medium in a test tube. The isolated cultures
were examined under the microscope for their purity and the pure cultures were then
transferred into fresh 100 mL flasks containing 40 mL of sterilized medium.
Microscopic observations were carried out for every culture and these were
identified up to genus level using morphological keys as described by Desikachary
(1959).
3.4 Growth and Maintenance of the isolates
The different isolates were grown and maintained on BG-11 medium, with or
without nitrogen (Stanier et al., 1971) under discontinuous illumination of 16h:8h

light/dark cycles at 2500–3000 Lux light intensity with cool white fluorescent tubes
at 28±2°C temperature in a culture room. The composition of BG-11 medium is as
follows:
Component
g L-1
K2HPO4 0.04
MgSO4. 5H2O 0.075
CaCl2.2H2O 0.036
Citric acid 0.006
Ferric ammonium citrate 0.006
EDTA 0.001
Na2CO3 0.02
Trace Metal Mix (A5) 1 mL
The trace metal mixture A5 solution (Arnon, 1938) contained the following
constituents in g L-1
.
H3BO3 2.86
MnCl2.4H20 1.81
ZnSO4.7H2O 0.222
Na2MoO4 .2H2O 0.390
CuSO4.5H2O 0.079
Co(NO3)2.6H20 0.049
The medium was prepared using the double distilled water. pH was
maintained in the range of 7.1-7.3 for the optimal growth of cultures.
3.5 Sterilization
All growth media, solutions, unless stated otherwise, were sterilized in
horizontal autoclave at 121°C temperature at 15 psi (1.06 kg/m2
pressure) for 20
minutes. The glassware was sterilized in hot air oven at 160°C for 3hrs. The Borosil
make glassware were first rinsed with chromic acid solution and then repeatedly
washed with tap water before finally rinsing with distilled water.

3.6 Morphological analysis of the isolates
3.6.1 Cultural behavior
The isolated cyanobacteria were examined for their morphological
characteristics and cultural behavior in liquid BG-11 medium. The morphological and
cultural characteristics were compared with the standard keys described by Desikachary
(1959).
3.6.2 Microscopic examination
Fifteen days old cultures were examined under the microscope and the
following attributes were recorded for the isolates.
™ Size, shape, colour of trichomes / filaments
™ Heterocyst size and shape
3.7 Molecular Characterization
3.7.1 DNA isolation
(i) Reagents:
a) 1M Tris HCl (pH-8.0): 121.1 g Tris HCl + 800 mL distilled water and pH
adjusted by adding concentrate HCl to the volume of 1 litre.
b) 0.5 M EDTA (pH-8.0): 186.1 g EDTA + 800 mL distilled water and pH
adjusted by adding concentrate HCl to the volume of 1 litre.
c) CTAB extraction buffer (1 lit.)
20 g CTAB (Cetyl Trimethyl Ammonium Bromide)
860 mL sterile double distilled water
81.82 g NaCl
100 mL 1 M Tris HCl
40 mL 0.5 M EDTA
Stir vigorously on a magnetic stirrer. Store in room temperature and prior to
use add 2- Mercaptoethanol @ 20 μl /20ml.
(d) Chilled ethanol (70 %)
(e) T.E. buffer (1 litre) (pH.-8.0): 10 mL 1 M Tris HCl + 2 mL 0.5 M EDTA
dissolve in 1 litre of double distilled water.

(ii) Procedure:
Genomic DNA isolation was carried out by modified N-Cetyl-N, N, N-
Trimethyl ammonium bromide (CTAB) method (Rogers and Bendish, 1998).
Fourteen days old cyanobacterial suspension was homogenized using a glass
homogenizer and used for the extraction of DNA. A known volume of suspension
was centrifuged at 14,000 rpm for 10 minutes. The supernatant was slowly removed
with the help of a micropipette and the pellet retained. The cell pellet was washed
twice with sterile CTAB buffer. The cell pellet was stored at -70o
C temperature.
Performed freeze-thaw cycles thrice to break the cells. To the pellet was added 700µl
of sterile CTAB buffer and 6µl of proteinase K (20mg/mL). Incubated the solution at
65o
C in water bath for 11
/2 hrs. After a brief cooling 700µl of chloroform was added
and contents were mixed well by gentle shaking on a shaker at room temperature for
15 mins. The tubes were then spinned at 6000Xg for 3 mins. to get the top aqueous
phase. Aqueous phase (600 μl) was transferred to a fresh 1.5 mL eppendorf tube
without disturbing the interface above the chloroform layer. Particulate matter was
carefully avoided while pipetting. To the aqueous phase thus obtained, 900 μl of
100% ethanol was added and the mixture was then mixed gently. Further, the tubes
were chilled at –20°C in a deep freeze for 1 ½ hrs, spun for 3 mins at 10000xg and
the supernatant discarded. The pellet having DNA was washed with 70% ethanol,
air-dried and resuspended in 50 μl TE buffer. These DNA preparations were stored
at –20°C for further use.
3.7.1.1 Quantification of DNA
The extracted DNA preparations were quantified by taking absorbance at 260
nm. The value of 1 absorbance at A260 is equal to 50μg/mL for standard DNA. The
integrity of isolated genomic DNA was determined by 0.8% agarose (Sisco Research
Laboratories Pvt. Ltd.) gel electrophoresis against 1 kb molecular weight marker
(Fermentas) for 1 hr. at 75 volts. To check the purity of DNA, the absorbance was
read at 260 nm and 280 nm, and the ratio of A260 and A280 was calculated, which
should be about 1.8 for pure DNA preparation.
3.7.2 16S rRNA gene amplification
The 16S rRNA genes were amplified with cyanobacteria specific universal primers
FD1 (5’AGAGTTTGATCCTGGCTCAG3’) and RP2

(5’ACGGCTACCTTGTTACGACTT3’) (Weisburg et al., 1991) by modified reaction
protocol (Lyra et al., 1997). The reaction was performed in a total volume of 25 µL
containing 50 ng of template DNA along with other components. Amplification was
carried out for 35 cycles on Master Cycler Gradient (Eppendorf) as shown.
Composition of PCR mixer for 16S rRNA gene amplification
Components/ sample Concentration
(stock)
Quantity/reaction
PCR buffer with KCl
+ Mg Cl2 (15mM)
10 X 2.5μl
MgCl2
dNTPs (mix)
25mM
100mM each
1μl
0.5μl
16S Primers (FD1 and RP2) 0.5 picomoles/μL each 5.0μl
Taq polymerase
5 U/μl 0.2μl
Sterile water - 12.8μl
Template DNA 25 ng/μL 3μl
Total 25μl
Thermal cycler parameters for 16S rRNA gene amplification
Steps
Temperature
(o
C)
Duration
(min)
Cycles Activity
1. 94 5.00 1 Denaturation
2. 94 0.50
35
Denaturation
3. 64 0.75 Annealing
4. 72 2.00 Extension
5. 72 5.00 1 Final Extension
6. 4 24 hours 1 Hold

3.7.2.1 Electrophoresis and observation
10 µL of the amplified PCR product were loaded on horizontal 1% (w/v)
agarose (Sisco Research Laboratories Pvt. Ltd.) gel in 1XTAE buffer (0.5M EDTA,
1M Tris-acetate, pH 8.0) stained with ethidium bromide solution (0.5 µg/mL) and
electrophoresed at 75 volts for about 1 hr.. In all 1 kb molecular size standard
(Fermentas) were run along with the amplified products to determine the
approximate band size. The amplified product were visualized on UV
transilluminator and were preserved in the form of pictures using Gel Doc System
(MiniBis Bioimaging System, USA)
3.7.2.2 RFLP analysis of the 16S rRNA gene
Amplified PCR products (5–10 μL) were digested singly overnight at 37°C
with 5 U of two different restriction enzymes each: Dpn II and Mset I (New England
Biolabs) (Rasmussen and Svenning, 2001). 10 µL of the restricted fragments were
analyzed on horizontal gel electrophoresis in 3.0% agarose (Sisco Research
Laboratories Pvt. Ltd.) in 1X TAE buffer (0.5M EDTA, 1M Tris-acetate, pH 8.0)
and electrophoresed at 75 volts for 3 hrs. and visualized by ethidium bromide (0.5
µg/ml). The molecular weight standard used was a λ 100-bp ladder (Fermentas). The
patterns of the restriction fragments were visualized on UV transilluminator and
were preserved in the form of pictures using Gel Doc System (MiniBis Bioimaging
System, USA) and the amplification product sizes were evaluated using Software
Quantity One (Biorad, USA).
3.7.2.3 Statistical Analysis
Fingerprints generated from different cyanobacterial isolates were compared
and all bands were scored depending on decreasing order of their molecular weights
for each DNA sample. The presence or absence of particular DNA fragments was
converted into binary data and the pairwise genetic similarities among the genotypes
under study were determined using Jaccard’s coefficient (Jaccard 1908). Cluster
analyses were carried out on similarity estimates using the unweighted pair-group
method with arithematic average (UPGMA) using NTSYS-pc, version 1.80 (Rohlf,
1995).

3.7.3 Single RAPD-PCR
A set of seventeen single oligo-deoxyribonucleotide RAPD primers
(Williams et al., 1990) having GC content of 60-80% were tested in nine
cyanobacterial isolates from genus Nostoc, nine isolates from genus Anabaena, three
isolates from genus Cylindrospermum and three isolates from genus Phormidium.
All RAPD primers were obtained from Integrated DNA Technologies. In RAPD-
PCR reaction, the concentrations for different components viz. Taq polymerase,
template DNA and primers were standardized. The standard concentrations and the
combination which gave consistent profile and provided adequate DNA fingerprints
with sharp bands were used under annealing temperature of 34O
C. The PCR reaction
was performed in a total volume of 20 μL having template DNA of approximately
80-100 ng concentration along with other components.
Sequences of single RAPD oligonucleotides primers
S. No. Primers Primer sequence ( 5′ Æ 3′ )
1. CRA-22 CCGCAGCCAA
2. CRA-25 AACGCGCAAC
3. D-02 GGACCCAACC
4. Hip-CA GCGATCGCCA
5. Hip-GC GCGATCCGCC
6. Hip-TG GCGATCGCTG
7. MM TCACGGTGCA
8. OPA-11 CAATCGCCGT
9. OPA-13 CAGCACCCAC
10. OPD-02 GGACCCAACC
11. OPD-16 AGGGCGTAAG
12. OPD-18 GAGAGCCAAC
13. OPD-20 ACCCGGTCAC
14. P2 ACAACTGCTC
15. P3 TGACTGACGC
16. P10 GCGATCCCCA
17. P100 ATCGGGTCCG

Composition of RAPD-PCR mixer
Components
Concentration
(stock)
Quantity/reaction
PCR buffer with KCl +
MgCl2 (15 mM each)
10X 2μl
dNTPs (mixed) 10mM 1μl
Primer 10picomoles/μl 1μl
Taq polymerase 5U/μl 0.2μl
Sterile water - 12.8μl
Template DNA 100ng 3.00μl
Total 20μl
Thermal cycler parameters for RAPD-PCR
Steps
Temperature
(o
C)
Duration
(min)
Cycles Activity
1. 94 5 1 Denaturation
2. 94 1
45
Denaturation
3. 34 1 Annealing
4. 72 2 Extension
5. 72 5 1 Final Extension
6. 4 24 hours 1 Hold
3.7.3.1 Electrophoresis and observation
After RAPD-PCR for single reaction, 10µl of amplified PCR products along
with 1 kb ladder (Fermentas) were loaded on 1.5% agarose (Sisco Research Laboratories
Pvt. Ltd.) gel in 1X TAE buffer (0.5M EDTA, 1M Tris-acetate, pH 8.0), stained with
ethidium bromide solution (0.5 µg/mL) and electrophoresed for 2 hrs. at 75 volts. The

banding pattern were visualized on UV trans-illuminator and were preserved in the form
of pictures using Gel Doc System (MiniBis Bioimaging System, USA) and the
amplification product sizes were evaluated using Software Quantity One (Biorad, USA).
3.7.3.2 Statistical Analysis
Each band visualized on a gel was considered a RAPD marker and a part of
the total RAPD fingerprint generated for a strain of cyanobacteria. The presence or
absence of a band at any position on the gel was used to construct the binary matrix
for the cyanobacterial RAPD markers from the described. Pairwise genetic
similarities among the genotypes under study were determined using Jaccard’s
coefficient (Jaccard, 1908). Cluster analyses were carried out on similarity estimates
using the unweighted pair-group method with arithematic average (UPGMA) using
NTSYS-pc, version 1.80 (Rohlf, 1995).

6. SUMMARY
Cyanobacteria (Blue Green Algae) are a group of prokaryotic organisms that
are morphologically, physiologically and developmentally diverse. Their unique
characteristic is that they carry out oxygenic photosynthesis and some have the
capacity to fix atmospheric nitrogen. These qualities make cyanobacteria as an
important member in the crop fields especially in the flooded rice soil. They provide
cheap nitrogen to plants besides increasing crop yields by making soil vital and
productive. They also improve soil health by adding organic matter and due to this
these organisms play a very important role in organic agriculture. The present
investigation was carried out on the diversity of cyanobacteria in organic farming field
under rice-wheat cropping system.
Soil samples were taken at different intervals during rice and wheat crop,
processed and the cyanobacterial diversity was assessed by isolating the distinct and
dominating forms. In all forty two isolates, twenty four from rice and eighteen from
wheat field were isolated. The heterocystous forms Nostoc and Anabaena dominated
during both rice and wheat crop irrespective of the treatment where as Westiellopsis
was common during rice crop and Cylindrospermum species during wheat crop.
Most of the studies have shown a distinct succession of cyanobacteria in rice field
which changes with change in temperature, sunshine, moisture content as well as age
of the plant.
The contribution of blue green algae through algalization, Azolla culture
alone or in combination with other organic inputs viz. FYM and Vermicompost
along with associated microflora has been evaluated in terms of biomass
accumulation (soil chlorophyll and organic carbon) and nitrogen fixing potential in
terms of Acetylene Reduction Assay (ARA) and total nitrogen content in the soil.
The results have shown that soil chlorophyll increased in all the treatments
incorporating BGA and Azolla where as inoculation of FYM or Vermicompost did
not affect the soil chlorophyll levels. This clearly indicated that inoculated BGA and
Azolla bring about an enhancement in biomass in terms of soil chlorophyll. This may
be due to the fact that both BGA and Azolla are photosynthetic and their inoculation
leads to a considerable build up in the population under favorable rice field
conditions thus contributing to the biomass in terms of soil chlorophyll. The

Atul Singha Ph.D. Thesis (Except Results Discussion

Atul Singha Ph.D. Thesis (Except Results Discussion

Recommended

Recommended

More Related Content

Similar to Atul Singha Ph.D. Thesis (Except Results Discussion

Similar to Atul Singha Ph.D. Thesis (Except Results Discussion (20)

More from Amy Cernava

More from Amy Cernava (20)

Recently uploaded

Recently uploaded (20)

Atul Singha Ph.D. Thesis (Except Results Discussion