SlideShare a Scribd company logo
1 of 22
Download to read offline
Master thesis @ BioBix
What the f*#@$k are we working on (aka, TOPICS):
• Small

stuff does matter…	


• Does

translation start at ATG?	


• Nuclear

translation, ay caramba?	


• (R)Evolutionary
• Hunt

epigenetics	


for imprinted loci	


• Cardiovascular

epigenomics
Small stuff does matter…
Canonical bio-active peptides: 	

-cleaved from precursor	

-signal peptide @ N-terminus	

-secretory pathway	

!

Micropeptides:	

-translated directly from sORF	

-lacking signal sequence	

-released in cytoplasm

Polaris: 3 peptides: 8, 9, 36 AA 	

Rotundifolia4: 1 peptide: 53 AA	

Enod40: 2 peptides: 12 and 24 AA	

Tarsal-less/pri: 4 peptides: 11 and 32 AA
Small stuff does matter…

Mus musculus

(common house mouse)

Build discovery strategy

Extrapolate strategy

160 Mbp 	

➡ Examples for
validation are available

➡

model	

systems

➡

L2 and L3 type
larvae	

➡ Embryonic stages
between 10-16h
➡

3 Gbp

between 8 and
12 days past coitus
(dpc)
➡

samples
Small stuff does matter…

(Crappé J. et al., BMC Genomics, 2013)
Does translation start at ATG?
Mass spectrometry

NGS: RNA-seq
Does translation start at ATG?
(1)

(3)

(4)

Does translation start at ATG?
(1) Generation of cell extracts in which ribosomes
have been faithfully halted along the mRNA they
are translating in vivo

(2) Nuclease digestion of RNAs that are not
protected by the ribosome followed by recovery
of the ribosome-protected mRNA fragments


(2)

(3)Quantitative conversion of the protected RNA
fragments into a DNA library

(4)That can be analyzed by deep sequencing

(Ingolia N. et al., Nature Protocols, 2012)

(Ingolia N. et al., Cell, 2011)
- Harringtonine 	

- Lactimidomycin (LTM)	

 (Lee S. et al., PNAS, 2012)
(Fritch C. et al., Gen. Research, 2012)
- Puromycin	

!
causes ribosome accumulation at translation initiation site (TIS)
Does translation start at ATG?
(1) 65% of transcripts contain more than 1 detectable TIS (mESC) (16% ≥ 4) 

--> Complexity of Proteome

(2) N-terminal truncations and/or extensions	

Alternate reading frames (internal out-of-frame), alternative splice
isoforms	

uORFs (regulation downstream initiation)	

!
(3) Often @ near-cognate initiation sites
n =13.454

(Ingolia N. et al., Cell, 2011)
Nuclear translation, ay caramba?
(R)Evolutionary epigenetics
(R)Evolutionary epigenetics
Hunt for imprinted loci

DNA-(hydroxy)methylatie	

ChIP-seq
Cardiovascular epigenomics

(TTAGGG)n'
Cardiovascular epigenomics
Where can you help out?
• Bioinformatics:	

1.

tool/pipeline development	


2.

data analysis/integration (computational genomics)	


3.

algorithm development	


• Technological
4.

aspects: NGS and MS	


xxx-seq, (replace xxx with MBD/RNA/RIBO/RRBS/
CHIP) or Mass Spectrometry
Where can you help out?
Example: Bioinformatics, tool/pipeline development
- Use RIBO-seq translation synthesis products as search space for MS/MS based proteomics/peptidomics	

- Construct a user-friendly, robust and fast pipeline to do the conversion	

- Both scripting based and implementation in Galaxy-P
Where can you help out?
Example: Bioinformatics, tool/pipeline development
Example: Bioinformatics, tool/pipeline development

Results:
(1) 45 LC runs resulting in 68.523 MS/MS spectra
(2) Different translation product types

Ribo-seq

N-terminomics

259$

16$
4$

1$
3$

1556$

n =13.454

n =1.835

(Menschaert G. et al., Mol & Cell Prot, 2013)
Example: Bioinformatics, tool/pipeline development
(3) Start codon: both cognate and near-cognate

1.0

ACG

0.0

G

TG

G

C

A
A
C
G

C
T

TA
C

G
T

1.0

probability

bits

2.0

T

0.5

G
TG

GA
ACCG
A

GTAC

C
0.0 TGT TC

T
C
A

5

Kozak	
  mo(f:[A/G]CCatgG[not	
  T]
Based on new N-term-ext and uORF identifications

T

C
A

5

WebLogo 3.3

WebLogo 3.3

(4) Example: HDGF_MOUSE (n-term-ext, near-cognate start site)
GTG

GTG

TTG

HDGF	
  (hsa)
	
  

stomach&

skin&

spleen&

heart&

kidney&

intes*ne&

lung&

46#
40#kDa#
38#kDa#
36.5#kDa#

HDGF	
  (mmu)	
  	
  

(V)AAPELASGAGIEAGAAR
(|)||||| || |||||||
(V)AAPELGPGATIEAGAAR

liver&

tes*s&

GCCGTGTGTTGCCCACCGCGCCCGGCCCTGTCCGA
GCGGCGCGCGGGCGCAGACGCCGTGGCTGCCCCGG
AGCTCGCGTCGGGGGCCGGCATCGAGGCGGGGGCC
GCGCGAGGGCCGGAGCGCAGCGGCGCCGCAACCGC
CGCACGCGCAAACTTGGGCTCGCGCTTCCCGGCTC
GGCGCGGAGCCCGGGGCGCCCGCGGCCCCGCCATG
TCGCGATCCAACCGGCAGA…

brain&

uc008ptc.1	
  

muscle&

ATG

32#

HDGF%

(Menschaert G. et al., Mol & Cell Prot, 2013)
(International) collaborations:
• VIB

(Medical Proteomics Group: ribosome
profiling and MS)	


• VITO

(Mass Spectrometry: small stuff)	


• NXTGNT
• Asklepios

(UGent sequencing facility)	


study investigators group	


• Weissman

lab, Fenyö lab (US: ribosome profiling,
cancer proteogenomics, MS)
More info @:
• where are we:

www.biobix.be

general info on the lab

topics online, your input ?

www.nucleotides2networks.be 	

• where

are we physically:

Building A, 2nd floor, Room 004	

symposium, 29th of November: 

“Bridging the gap between two omics worlds,
transcriptomics and proteomics”

invitation will follow/be posted on the biobix.be

• Mini

More Related Content

What's hot

DEseq, voom and vst
DEseq, voom and vstDEseq, voom and vst
DEseq, voom and vstQiang Kou
 
Catalyzing Plant Science Research with RNA-seq
Catalyzing Plant Science Research with RNA-seqCatalyzing Plant Science Research with RNA-seq
Catalyzing Plant Science Research with RNA-seqManjappa Ganiger
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...VHIR Vall d’Hebron Institut de Recerca
 
RNA-seq Data Analysis Overview
RNA-seq Data Analysis OverviewRNA-seq Data Analysis Overview
RNA-seq Data Analysis OverviewSean Davis
 
RNASeq Experiment Design
RNASeq Experiment DesignRNASeq Experiment Design
RNASeq Experiment DesignYaoyu Wang
 
RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities Paolo Dametto
 
Kogo 2013 RNA-seq analysis
Kogo 2013 RNA-seq analysisKogo 2013 RNA-seq analysis
Kogo 2013 RNA-seq analysisJunsu Ko
 
Talk ABRF 2015 (Gunnar Rätsch)
Talk ABRF 2015 (Gunnar Rätsch)Talk ABRF 2015 (Gunnar Rätsch)
Talk ABRF 2015 (Gunnar Rätsch)Gunnar Rätsch
 
Enabling Large Scale Sequencing Studies through Science as a Service
Enabling Large Scale Sequencing Studies through Science as a ServiceEnabling Large Scale Sequencing Studies through Science as a Service
Enabling Large Scale Sequencing Studies through Science as a ServiceJustin Johnson
 
2015.04.08-Next-generation-sequencing-issues
2015.04.08-Next-generation-sequencing-issues2015.04.08-Next-generation-sequencing-issues
2015.04.08-Next-generation-sequencing-issuesDongyan Zhao
 
Differential expression in RNA-Seq
Differential expression in RNA-SeqDifferential expression in RNA-Seq
Differential expression in RNA-SeqcursoNGS
 
Variant (SNPs/Indels) calling in DNA sequences, Part 2
Variant (SNPs/Indels) calling in DNA sequences, Part 2Variant (SNPs/Indels) calling in DNA sequences, Part 2
Variant (SNPs/Indels) calling in DNA sequences, Part 2Denis C. Bauer
 
Bioinfo ngs data format visualization v2
Bioinfo ngs data format visualization v2Bioinfo ngs data format visualization v2
Bioinfo ngs data format visualization v2Li Shen
 
So you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression AnalysisSo you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression AnalysisUniversity of California, Davis
 
Examining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencingExamining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencingStephen Turner
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishingNikolay Vyahhi
 

What's hot (20)

2014 villefranche
2014 villefranche2014 villefranche
2014 villefranche
 
DEseq, voom and vst
DEseq, voom and vstDEseq, voom and vst
DEseq, voom and vst
 
Catalyzing Plant Science Research with RNA-seq
Catalyzing Plant Science Research with RNA-seqCatalyzing Plant Science Research with RNA-seq
Catalyzing Plant Science Research with RNA-seq
 
Rnaseq forgenefinding
Rnaseq forgenefindingRnaseq forgenefinding
Rnaseq forgenefinding
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
 
RNA-seq Data Analysis Overview
RNA-seq Data Analysis OverviewRNA-seq Data Analysis Overview
RNA-seq Data Analysis Overview
 
RNASeq Experiment Design
RNASeq Experiment DesignRNASeq Experiment Design
RNASeq Experiment Design
 
RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities
 
Kogo 2013 RNA-seq analysis
Kogo 2013 RNA-seq analysisKogo 2013 RNA-seq analysis
Kogo 2013 RNA-seq analysis
 
Cloud bioinformatics 2
Cloud bioinformatics 2Cloud bioinformatics 2
Cloud bioinformatics 2
 
Talk ABRF 2015 (Gunnar Rätsch)
Talk ABRF 2015 (Gunnar Rätsch)Talk ABRF 2015 (Gunnar Rätsch)
Talk ABRF 2015 (Gunnar Rätsch)
 
Enabling Large Scale Sequencing Studies through Science as a Service
Enabling Large Scale Sequencing Studies through Science as a ServiceEnabling Large Scale Sequencing Studies through Science as a Service
Enabling Large Scale Sequencing Studies through Science as a Service
 
2015.04.08-Next-generation-sequencing-issues
2015.04.08-Next-generation-sequencing-issues2015.04.08-Next-generation-sequencing-issues
2015.04.08-Next-generation-sequencing-issues
 
Differential expression in RNA-Seq
Differential expression in RNA-SeqDifferential expression in RNA-Seq
Differential expression in RNA-Seq
 
Variant (SNPs/Indels) calling in DNA sequences, Part 2
Variant (SNPs/Indels) calling in DNA sequences, Part 2Variant (SNPs/Indels) calling in DNA sequences, Part 2
Variant (SNPs/Indels) calling in DNA sequences, Part 2
 
Bioinfo ngs data format visualization v2
Bioinfo ngs data format visualization v2Bioinfo ngs data format visualization v2
Bioinfo ngs data format visualization v2
 
So you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression AnalysisSo you want to do a: RNAseq experiment, Differential Gene Expression Analysis
So you want to do a: RNAseq experiment, Differential Gene Expression Analysis
 
Biological database
Biological databaseBiological database
Biological database
 
Examining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencingExamining gene expression and methylation with next gen sequencing
Examining gene expression and methylation with next gen sequencing
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishing
 

Viewers also liked

Viewers also liked (6)

Web Scraping
Web ScrapingWeb Scraping
Web Scraping
 
Williams.pnas
Williams.pnasWilliams.pnas
Williams.pnas
 
Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
Van criekinge next_generation_epigenetic_profling_vvumc_uploadedVan criekinge next_generation_epigenetic_profling_vvumc_uploaded
Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
 
2014 09 30_t1_bioinformatics_wim_vancriekinge
2014 09 30_t1_bioinformatics_wim_vancriekinge2014 09 30_t1_bioinformatics_wim_vancriekinge
2014 09 30_t1_bioinformatics_wim_vancriekinge
 
Van criekinge next_generation_epigenetic_profling_vuppsala
Van criekinge next_generation_epigenetic_profling_vuppsalaVan criekinge next_generation_epigenetic_profling_vuppsala
Van criekinge next_generation_epigenetic_profling_vuppsala
 
Bpc 2013
Bpc 2013Bpc 2013
Bpc 2013
 

Similar to Master thesis topics at BioBix

Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchAnshika Bansal
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012Dan Gaston
 
IPK - Reproducible research - To infinity
IPK - Reproducible research - To infinityIPK - Reproducible research - To infinity
IPK - Reproducible research - To infinityPeterMorrell4
 
Giab jan2016 intro and update 160128
Giab jan2016 intro and update 160128Giab jan2016 intro and update 160128
Giab jan2016 intro and update 160128GenomeInABottle
 
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_coursehansjansen9999
 
Reproducible research - to infinity
Reproducible research - to infinityReproducible research - to infinity
Reproducible research - to infinityPeterMorrell4
 
Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Jane Landolin
 
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...Andor Kiss
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part Ihhalhaddad
 
AdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.pptAdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.pptRuthMWinnie
 
AdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.pptAdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.pptEdizonJambormias2
 
RNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGSRNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGSHAMNAHAMNA8
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics finalRainu Rajeev
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Torsten Seemann
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...QBiC_Tue
 

Similar to Master thesis topics at BioBix (20)

Thesis bio bix_2014
Thesis bio bix_2014Thesis bio bix_2014
Thesis bio bix_2014
 
Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences research
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012
 
IPK - Reproducible research - To infinity
IPK - Reproducible research - To infinityIPK - Reproducible research - To infinity
IPK - Reproducible research - To infinity
 
Giab jan2016 intro and update 160128
Giab jan2016 intro and update 160128Giab jan2016 intro and update 160128
Giab jan2016 intro and update 160128
 
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_course
 
Reproducible research - to infinity
Reproducible research - to infinityReproducible research - to infinity
Reproducible research - to infinity
 
Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121
 
2016 bergen-sars
2016 bergen-sars2016 bergen-sars
2016 bergen-sars
 
Ensembl Browser Workshop
Ensembl Browser WorkshopEnsembl Browser Workshop
Ensembl Browser Workshop
 
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part I
 
AdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.pptAdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
 
AdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.pptAdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
AdamAmeur_SciLife_Bioinfo_course_Nov2015.ppt
 
RNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGSRNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGS
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics final
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
 
BioSB meeting 2015
BioSB meeting 2015BioSB meeting 2015
BioSB meeting 2015
 
Apolo Taller en BIOS
Apolo Taller en BIOS Apolo Taller en BIOS
Apolo Taller en BIOS
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...
 

More from Prof. Wim Van Criekinge

2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_upload2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_uploadProf. Wim Van Criekinge
 
2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_upload2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_uploadProf. Wim Van Criekinge
 
2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_upload2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_uploadProf. Wim Van Criekinge
 
2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_upload2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_uploadProf. Wim Van Criekinge
 
2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_upload2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_uploadProf. Wim Van Criekinge
 
Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]Prof. Wim Van Criekinge
 
2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_upload2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_uploadProf. Wim Van Criekinge
 
2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_upload2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_uploadProf. Wim Van Criekinge
 
2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_upload2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_uploadProf. Wim Van Criekinge
 

More from Prof. Wim Van Criekinge (20)

2020 02 11_biological_databases_part1
2020 02 11_biological_databases_part12020 02 11_biological_databases_part1
2020 02 11_biological_databases_part1
 
2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_upload2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_upload
 
2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_upload2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_upload
 
2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_upload2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_upload
 
2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_upload2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_upload
 
2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_upload2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_upload
 
P7 2018 biopython3
P7 2018 biopython3P7 2018 biopython3
P7 2018 biopython3
 
P6 2018 biopython2b
P6 2018 biopython2bP6 2018 biopython2b
P6 2018 biopython2b
 
P4 2018 io_functions
P4 2018 io_functionsP4 2018 io_functions
P4 2018 io_functions
 
P3 2018 python_regexes
P3 2018 python_regexesP3 2018 python_regexes
P3 2018 python_regexes
 
T1 2018 bioinformatics
T1 2018 bioinformaticsT1 2018 bioinformatics
T1 2018 bioinformatics
 
P1 2018 python
P1 2018 pythonP1 2018 python
P1 2018 python
 
Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]
 
2018 05 08_biological_databases_no_sql
2018 05 08_biological_databases_no_sql2018 05 08_biological_databases_no_sql
2018 05 08_biological_databases_no_sql
 
2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_upload2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_upload
 
2018 03 20_biological_databases_part3
2018 03 20_biological_databases_part32018 03 20_biological_databases_part3
2018 03 20_biological_databases_part3
 
2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_upload2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_upload
 
2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_upload2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_upload
 
P7 2017 biopython3
P7 2017 biopython3P7 2017 biopython3
P7 2017 biopython3
 
P6 2017 biopython2
P6 2017 biopython2P6 2017 biopython2
P6 2017 biopython2
 

Recently uploaded

Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfJayanti Pande
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationnomboosow
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Krashi Coaching
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3JemimahLaneBuaron
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13Steve Thomason
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
Beyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactBeyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactPECB
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...Sapna Thakur
 
social pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajansocial pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajanpragatimahajan3
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104misteraugie
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 

Recently uploaded (20)

Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communication
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Beyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactBeyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global Impact
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
 
social pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajansocial pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajan
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 

Master thesis topics at BioBix

  • 2. What the f*#@$k are we working on (aka, TOPICS): • Small stuff does matter… • Does translation start at ATG? • Nuclear translation, ay caramba? • (R)Evolutionary • Hunt epigenetics for imprinted loci • Cardiovascular epigenomics
  • 3. Small stuff does matter… Canonical bio-active peptides: -cleaved from precursor -signal peptide @ N-terminus -secretory pathway ! Micropeptides: -translated directly from sORF -lacking signal sequence -released in cytoplasm Polaris: 3 peptides: 8, 9, 36 AA Rotundifolia4: 1 peptide: 53 AA Enod40: 2 peptides: 12 and 24 AA Tarsal-less/pri: 4 peptides: 11 and 32 AA
  • 4. Small stuff does matter… Mus musculus (common house mouse) Build discovery strategy Extrapolate strategy 160 Mbp ➡ Examples for validation are available ➡ model systems ➡ L2 and L3 type larvae ➡ Embryonic stages between 10-16h ➡ 3 Gbp between 8 and 12 days past coitus (dpc) ➡ samples
  • 5. Small stuff does matter… (Crappé J. et al., BMC Genomics, 2013)
  • 6. Does translation start at ATG? Mass spectrometry NGS: RNA-seq
  • 8. (1) (3) (4) Does translation start at ATG? (1) Generation of cell extracts in which ribosomes have been faithfully halted along the mRNA they are translating in vivo
 (2) Nuclease digestion of RNAs that are not protected by the ribosome followed by recovery of the ribosome-protected mRNA fragments
 (2) (3)Quantitative conversion of the protected RNA fragments into a DNA library
 (4)That can be analyzed by deep sequencing (Ingolia N. et al., Nature Protocols, 2012) (Ingolia N. et al., Cell, 2011) - Harringtonine - Lactimidomycin (LTM) (Lee S. et al., PNAS, 2012) (Fritch C. et al., Gen. Research, 2012) - Puromycin ! causes ribosome accumulation at translation initiation site (TIS)
  • 9. Does translation start at ATG? (1) 65% of transcripts contain more than 1 detectable TIS (mESC) (16% ≥ 4) 
 --> Complexity of Proteome
 (2) N-terminal truncations and/or extensions Alternate reading frames (internal out-of-frame), alternative splice isoforms uORFs (regulation downstream initiation) ! (3) Often @ near-cognate initiation sites n =13.454 (Ingolia N. et al., Cell, 2011)
  • 13. Hunt for imprinted loci DNA-(hydroxy)methylatie ChIP-seq
  • 16. Where can you help out? • Bioinformatics: 1. tool/pipeline development 2. data analysis/integration (computational genomics) 3. algorithm development • Technological 4. aspects: NGS and MS xxx-seq, (replace xxx with MBD/RNA/RIBO/RRBS/ CHIP) or Mass Spectrometry
  • 17. Where can you help out? Example: Bioinformatics, tool/pipeline development - Use RIBO-seq translation synthesis products as search space for MS/MS based proteomics/peptidomics - Construct a user-friendly, robust and fast pipeline to do the conversion - Both scripting based and implementation in Galaxy-P
  • 18. Where can you help out? Example: Bioinformatics, tool/pipeline development
  • 19. Example: Bioinformatics, tool/pipeline development Results: (1) 45 LC runs resulting in 68.523 MS/MS spectra (2) Different translation product types Ribo-seq N-terminomics 259$ 16$ 4$ 1$ 3$ 1556$ n =13.454 n =1.835 (Menschaert G. et al., Mol & Cell Prot, 2013)
  • 20. Example: Bioinformatics, tool/pipeline development (3) Start codon: both cognate and near-cognate 1.0 ACG 0.0 G TG G C A A C G C T TA C G T 1.0 probability bits 2.0 T 0.5 G TG GA ACCG A GTAC C 0.0 TGT TC T C A 5 Kozak  mo(f:[A/G]CCatgG[not  T] Based on new N-term-ext and uORF identifications T C A 5 WebLogo 3.3 WebLogo 3.3 (4) Example: HDGF_MOUSE (n-term-ext, near-cognate start site) GTG GTG TTG HDGF  (hsa)   stomach& skin& spleen& heart& kidney& intes*ne& lung& 46# 40#kDa# 38#kDa# 36.5#kDa# HDGF  (mmu)     (V)AAPELASGAGIEAGAAR (|)||||| || ||||||| (V)AAPELGPGATIEAGAAR liver& tes*s& GCCGTGTGTTGCCCACCGCGCCCGGCCCTGTCCGA GCGGCGCGCGGGCGCAGACGCCGTGGCTGCCCCGG AGCTCGCGTCGGGGGCCGGCATCGAGGCGGGGGCC GCGCGAGGGCCGGAGCGCAGCGGCGCCGCAACCGC CGCACGCGCAAACTTGGGCTCGCGCTTCCCGGCTC GGCGCGGAGCCCGGGGCGCCCGCGGCCCCGCCATG TCGCGATCCAACCGGCAGA… brain& uc008ptc.1   muscle& ATG 32# HDGF% (Menschaert G. et al., Mol & Cell Prot, 2013)
  • 21. (International) collaborations: • VIB (Medical Proteomics Group: ribosome profiling and MS) • VITO (Mass Spectrometry: small stuff) • NXTGNT • Asklepios (UGent sequencing facility) study investigators group • Weissman lab, Fenyö lab (US: ribosome profiling, cancer proteogenomics, MS)
  • 22. More info @: • where are we:
 www.biobix.be
 general info on the lab
 topics online, your input ?
 www.nucleotides2networks.be • where are we physically:
 Building A, 2nd floor, Room 004 symposium, 29th of November: 
 “Bridging the gap between two omics worlds, transcriptomics and proteomics”
 invitation will follow/be posted on the biobix.be • Mini