Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

The Human Genome Project - Part I

3,261 views

Published on

Part I

Published in: Science
  • Be the first to comment

The Human Genome Project - Part I

  1. 1. The Human Genome HAGenetics.org Dr. Hasan Alhaddad Guest lecturer: Molecular Basis of Human Diseases October 12th, 14th, 16th 2014 Room 244 (1 PM)
  2. 2. Lectures structure HAGenetics.org • Part I (Sunday Oct 12th): • The book of life (Matt Ridely’s analogy with modifications). • Introduction to the technologies at the time. • Part II (Tuesday Oct 14th): • Why sequencing genomes/the human genome? • Genome war (public and private projects). • Sequencing the genome. • Genome assembly. • Genome annotation. • Part III (Thursday Oct 16th): • Genome outcome. • The Genomic era.
  3. 3. AIMS (part I) • Learn the basics of the human genome and understand how to simplify the concept of a genome to the public. • Understand the technologies of the time and how they affect the project. • Understand the limitations of the technologies. • Understand some the general motives for sequencing the human genome. HAGenetics.org
  4. 4. What is the genome? HAGenetics.org The book of life The code to our existence The instructions to make who we are The map to how we look, feel, think, and behave The genome is ourselves in a chemical language
  5. 5. The human book of life – an analogy HAGenetics.org
  6. 6. The human book of life – an analogy HAGenetics.org I have two books The human book of life is called THE GENOME
  7. 7. The human book of life – an analogy HAGenetics.org Can you define the genome? What cells in your body have one copy of the genome and what cells have two?
  8. 8. Some details on the human book of life HAGenetics.org • Humans are diploid organisms - two books (genomes) in most of their cells. • Each book (genome) is composed of 23 chapters (chromosomes). • The total number of chapters (chromosomes) in a humans is 46. • Approximately 3 billion letters in the book! • Sex determination depends on chapter 23 (the sex chromosomes). • XX ! female. • XY ! male. Autosomal chromosomes Sex chromosomes
  9. 9. The human book of life How did we learn about the number of chromosomes in the HAGenetics.org human genome?
  10. 10. Sex determination (mostly) HAGenetics.org What are the 23rd chapters of your books of life? X X X Y
  11. 11. HAGenetics.org Genome size How did we learn about the size of the human genome?
  12. 12. HAGenetics.org Genome size How did we learn about the size of the human genome?
  13. 13. More details about the book HAGenetics.org • The number of pages, word, and letters differ in each chapter (chromosome). • Chapters (chromosomes) are numbered based on their size. (chr 1 is the largest). • The instructions/readable sections (genes) are not equally distributed over the chromosomes. • Many sections of the book (genome) are not readable. • Many sections of the book are of repeated letter, words, or sentences. • The book is written in a chemical language composed of four letters (A,T,G,C). • Sentences are made of words made of three letters (AAC, ATG, etc.).
  14. 14. What is written and how to read it? HAGenetics.org ATGCCATCACAAATGCGG CTATGCCATGACAAATGC GGCTAATGCCATGACAAAT GCGGCTAATGCCATGACAA ATGCGGCTAATGCCATGAC AAATGCGGCTACATGACAA ATGCGGCTAATGCCATGAC AAATGCGGCTAATCATGAC AAATGCGGCTACATGACCA TGACAAATGCGGCTACATG ACAACAACAACAACAACAA CAACAACAACAACATATATA TATATATATATATATATATATAT ATATATATATATATATATATATA TATATATATATATATATATATAT ATATATATATATATATATATATA TATATATATATATATATATATAT ATATATATATATATATATATATA TATATATATATATATATATATAT Met-Pro-Ser-Met-Arg-Lue-Cys- His-Asp-Lys-Cys-Gly-stop Make brown eyes and stop Bla bla bla bla bla More bla bla bla bla
  15. 15. The genome in a cell • The Wellcome collection in London. • The human genome printed using font size (5)! • If we print the genome using font size 12 and stretch the letter, it would go ~ from Kuwait to Spain! • A lot of information. How is it packaged in a 100 trillion tiny little human cells (1-100 um)? HAGenetics.org
  16. 16. HAGenetics.org Genome packaging The genome is packaged via the interaction of DNA with proteins.
  17. 17. Lost? HAGenetics.org Are you lost with these analogy? If yes, do not worry. You will learn all the details during upcoming lectures "
  18. 18. HAGenetics.org What was known at the time? A summary: • Humans have diploid genome (2n = 46 chromosomes) in their somatic cells. • Humans have haploid genome (n = 23 chromosomes) in their germ-line cells. • Humans have 22 pairs of autosomal chromosomes and 1 pair of sex chromosomes (X and Y) • Human genome contains heterochromatic regions (highly condensed – few active genes) and Euchromatic region (lightly condensed – many active genes). • Human genome size is ~ 3 billion bp.
  19. 19. HAGenetics.org Molecular technologies of the time How were genes/genomes studied at the time? We will go over some key technologies that are relevant to the human genome project.
  20. 20. HAGenetics.org Molecular technologies of the time Polymerase Chain Reaction Biochomicals.com
  21. 21. Polymerase chain reaction • Polymerase Chain Reaction (PCR) allows the amplification (copying) of small amounts of DNA millions of copies. • The method was developed by Kary Mullis (1983) and he was awarded the Nobel Prize for his invention. • The process of PCR is similar to the process of DNA replication except it is done in tubes rather than living cells. • It is considered in many cases the first step before any genetic analysis. • Many methods and applications involve PCR. HAGenetics.org
  22. 22. DNA replication and PCR • DNA replication in the cells involves making an identical copy of the genome (DNA). • PCR uses the same procedure but to generate millions of copies of a small section of the genome in a tube! HAGenetics.org
  23. 23. Components What do we need to replicate (copy) DNA? HAGenetics.org 1. DNA template. 2. Building block of DNA (dNTPs). 3. DNA copier (an enzyme). 4. 3’OH (primer).
  24. 24. Components: (1) DNA template • The DNA sample you collect from a crime scene or the one under investigation is the DNA template. 3’ 5’ 3’ Each strand serves as a template for copying. Remember complementary base-pairing! HAGenetics.org G A C T A T T A G C G C A T C G C G G C T A A T T A G C A T C G A T C G 5’ 5’ 3’ A T G G G A C C A T A G T G A C A C T A C C C T G G T A T C A C T G T G 3’ 5’
  25. 25. Components: (2) dNTP (building blocks) Do you remember? DNA is made of nucleotides! HAGenetics.org
  26. 26. Components: (2) dNTP (building blocks) Deoxyribonucleoside triphosphate (dNTP) H Four dNTPs serve as the building blocks of DNA HAGenetics.org (dATP, dTTP, dGTP, dCTP) Remember Nucleotides!
  27. 27. Components: (2) dNTP (building blocks) Deoxyribonucleoside triphosphate (dNTP) HAGenetics.org Why triphosphate? For the energy required to for the phosphodiester bond + H H
  28. 28. Components: (3) DNA copier (polymerase) • DNA polymerase is the DNA copier in the cell. • Uses the dNTPs (DNA building blocks) to make a complementary strand to the template. • Uses the available 3’-OH of a previous nucleotide and 5’phsphate from dNTP to form a phosphodiester bond. • Each time DNA Pol finds the correct complementary dNTP and catalyzes the reaction linking the new nucleotide. HAGenetics.org Remember DNA Pol needs 3’-OH
  29. 29. Components: (4) primer (3’ OH) Primers are short piece of polynucleotide HAGenetics.org G C T A T T A G C C G G T A T C A C T G T G 5’ 5’ OH-3’ 3’ In order for the DNA copying machine to work and add nucleotides, a 3’-OH needs to be available to form a phosphodiester bond!
  30. 30. PCR Process • Three steps are involved in PCR: 1. DNA template denaturation: separation of the two strands of DNA. 2. Primers annealing: small oligonucleotide attaches to each separated strand providing the 3’OH for DNA polymerase. 3. DNA polymerization (extension): DNA polymerase extends the primers on both strands and adds nucleotides. HAGenetics.org
  31. 31. HAGenetics.org PCR Process 1. DNA denaturation 2. Primers annealing 3. DNA extension
  32. 32. HAGenetics.org PCR cycles 1. DNA denaturation 2. Primers annealing 3. DNA extension Temp (C) 94 C 55-65 C 72 C What happens if we repeat this cycle many times? Cycle 1 Cycle 2 Cycle 3 Cycle 4 Cycle 5 21 22 23 24 25 Exponential growth in the number of copies generated. The number of copies you get at the end of your PCR will be 2#cycles (236 cycles = 68 billion copies)
  33. 33. HAGenetics.org PCR – how many copies? Threshhold Not enough DNA template No chemicals left in the reaction tube # DNA copies # cycles
  34. 34. HAGenetics.org Problems! There were some difficulties with this system: 1. Three water-baths with three different temperature. 2. DNA polymerase denatures at 94 C.
  35. 35. • The sample has to be transferred into multiple water baths to accommodate the needed temperature. • DNA polymerase needs to be added in every cycle because DNA polymerase denatures at high temperature. Adding DNA Pol HAGenetics.org Problems! DNA denature (94 C) Primer annealing (55-65 C) Extension (72 C) DNA Pol denatures
  36. 36. Improvement 1 • Using Thermus aquaticus (Taq) polymerase. • Taq polymerase is heat stable and the cycles can take place without the polymerase being destroyed during the denaturation phase. HAGenetics.org
  37. 37. Improvement 1 • Using Thermus aquaticus (Taq) polymerase. HAGenetics.org Biochomicals.com
  38. 38. Improvement 2 Replacing old machine (water baths) with a thermocycler. HAGenetics.org
  39. 39. Improvement 2 Replacing old machine (water baths) with a thermocycler. HAGenetics.org
  40. 40. To consider • Length and GC content of your primer. • Compatibility of your forward and reverse primers. • Primer’s sequences do not complement each other (primer dimer). • Annealing temperature of both primers should be the same. • Length of the target DNA piece ( the longer the target the longer the extension time). • DNA polymerase, primers and other chemicals’ concentration should be precisely calculated. HAGenetics.org
  41. 41. Problem with PCR What if we do not know the sequence of DNA to design primers? How can I get enough copies of DNA? HAGenetics.org
  42. 42. Problem with PCR HAGenetics.org • Copying unknown DNA using a biological system (bacteria). • The approach used is called “Molecular Cloning”. • It makes use Endonucleases (restriction enzymes) and plasmids of bacteria to copy a specific unknown piece of DNA. • The plasmid’s DNA can serve as a primer for PCR and DNA sequencing.
  43. 43. Why copy DNA? Why molecular cloning or PCR matters in genome HAGenetics.org studies? DNA CANNOT be sequenced using one copy!
  44. 44. What is DNA sequencing? HAGenetics.org It is reading the letters of the book. It is reading the exact nucleotide sequence of the genome.
  45. 45. Sequencing methods available now! HAGenetics.org 1. Maxam and Gilbert chemical degradation method (extinct). 2. Sanger sequencing (dideoxy or chain termination method). 3. Illumina sequencing. 4. SOLiD sequencing. 5. Pyrosequencing. 6. Ion Torrent method. 7. Single molecule sequencing.
  46. 46. Sanger sequencing (the great method) • Fredrick Sanger has developed a sequencing method and received a Noble prize for it. • Sanger sequencing method is also called Chain Termination Method and Dideoxy sequencing method. • Employs: HAGenetics.org • specific primers • dNTPs • ddNTPs • DNA polymerase • DNA template
  47. 47. DNA synthesis DNA synthesis requires the availability of a 3’-OH and energy HAGenetics.org + H H H H
  48. 48. DNA synthesis Difference in OH location in sugar and consequences HAGenetics.org
  49. 49. DNA synthesis The absence of OH group on the 3’ carbon of the sugar blocks HAGenetics.org further addition of nucleotides
  50. 50. Sanger sequencing procedure HAGenetics.org DNA Template Polymerase Excess dNTPs Primer ddGTP ddCTP ddATP ddTTP
  51. 51. Sanger sequencing procedure 5 3 G AA AA TT T C CC T 3 C T T A A G G A A T T 5 HAGenetics.org 5 G 5 G A 5 G A A 5 G A A T 5 G A A T T 5 G A A T T C 5 G A A T T C C 5 G A A T T C C T
  52. 52. HAGenetics.org Sanger sequencing procedure A T G C + 3 5 • Analysis using high resolution polyacrylamide gel electrophoresis. • Fragments are detected using radioactive markers and autoradiography. ACT GGT CAAT C GAT C GT A _
  53. 53. Sanger sequencing - Gel • Reading these gels for the human genome is a lot of work. • We need a faster more efficient method. HAGenetics.org
  54. 54. • Each dideoxy nucleotide is attached to a florescent marker. • At the end of each cycle, a laser beam can detect the florescent marker and thus record the position of the nucleotide. HAGenetics.org Sanger sequencing - Automated
  55. 55. Chromatogram - Automated HAGenetics.org

×