SlideShare a Scribd company logo
1 of 61
Download to read offline
Bioinformatic tools for the
diagnostic laboratory
A/Prof Torsten Seemann
Victorian Life Sciences Computation Initiative (VLSCI)
Microbiological Diagnostic Unit Public Health Laboratory (MDU PHL)
Doherty Applied Microbial Genomics (DAMG)
The University of Melbourne
ASA 2016 - Melbourne, AU - Sat 27 Feb 2016
Doherty Applied
Microbial Genomics
Lead bioinformatician ♥ microbial genomics
Whole genome sequencing
The currency of genomics
Reads
Reads are stored in FASTQ files
Genome
Types of sequence reads
100 - 300 bp (paired)
100 - 400 bp
5,000 - 15,000+ bp
5,000 - 50,000+ bp
What data do we really have?
Isolate genome
Sequenced reads
Other isolates in
sequencing run
Contamination
Sequencing adaptors
Spike-in controls eg. phiX
Unsequenced
regions
Do we have enough data?
∷ Depth
: expressed as fold-coverage of genome eg. 25x
: means each base sequenced 25 times (on average)
∷ Coverage
: the % of genome sequenced with depth > 0
25x
Genome data itself is of limited value.
Needs “extra” information
□ location: Australia 37.8S,145.0E
□ date: 2015 2015-07-20
□ source: human 60yo male faecal swab
□ etc.
Metadata
Got my reads, now what?
Two options
∷ De novo genome assembly
: reconstruct original sequence from reads alone
: like a giant jigsaw puzzle
: “create”
∷ Align to reference
: identify where each read fits on a related genome
: can not always be uniquely placed
: “compare”
De novo genome assembly
Amplified DNA
Shear DNA
Sequenced reads
Overlaps
Layout
Consensus ↠ “Contigs”
The effect of read length
250 bp - Illumina - $200 8000 bp - Pacbio - $2000
The problem with repeats
Repeat copy 1 Repeat copy 2
Collapsed repeat consensus
1 locus
4 contigs
Align to reference
Seven short 4bp reads
AGTC TTAC GGGA CTTT
TAGG TTTA ATAG
Aligned to 31bp reference
AGTCTTTATTATAGGGAGCCATAGCTTTACA
AGTC TAGG ATAG TTAC
TTTA GGGA CTTT
Eight short 4bp reads
AGTC TTAC GGGA CTTT
TAGG TTTA ATAG TTAT
Aligned to 31bp reference
AGTCTTTATTATAGGGAGCCATAGCTTTACA
AGTC TAGG ATAG TTAC
TTTA GGGA CTTT
TTAT
TTAT
Ambiguous alignment
D’oh!
Best practice
■ Use both approaches
□ reference-based + de novo
■ Best of both worlds
□ and worst of both worlds - interpretation is non-trivial
■ Still need
□ good epidemiology, metadata and domain knowledge!
The one true assay?
Applications of WGS
∷ Diagnostics
: species ⇒ subspecies ⇒ strain identification
: in silico antibiogram and virulence profile
∷ Surveillance
: in silico genotyping - MLST, serotyping, VNTR, MLVA
: what’s lurking in our hospital/community?
∷ Forensics
: outbreak detection
: source tracking
Isolate identification
∷ Can be done in seconds
∷ Directly from reads (or subset)
∷ Scan against index of unique k-mers (oligoes)
∷ Species level accurate (on average)
∷ Great for quality control !
Kraken,
MetaPhlan,
OneCodex
One Codex example metagenome output
Antibiogram
∷ The “resistome”
∷ Resistance specific genes
: we have good databases of these
: easy to identify to exact allele eg. blaNDM-9
∷ New alleles conferring resistance
: databases are poor (exceptions include M.tb)
: novel mechanisms arrive de novo
ResFinder, CARD,
ARG-Annot
SRST2, ABRicate
ABRicate example E.faecium output
START END GENE COVERAGE COVERAGE_MAP GAPS %COVERAGE %IDENTITY
7140 7902 erm(B) 1-762/762 ========/====== 1 100.00 99.08
8627 9421 aph(3')-III 1-795/795 =============== 0 100.00 100.00
11040 11948 ant(6)-Ia 1-345/909 =====.......... 0 35.00 100.00
15456 16257 lnu(B) 1-804/804 ========/====== 2 99.75 99.63
573128 575046 tet(M) 1-1920/1920 ========/====== 1 99.95 99.95
770130 770792 VanR-B 1-663/663 =============== 0 100.00 99.25
770792 772135 VanS-B 1-1344/1344 =============== 0 100.00 99.63
772306 773112 VanY-B 1-807/807 =============== 0 100.00 100.00
773130 773957 VanW-B 1-828/828 =============== 0 100.00 97.58
773954 774925 VanH-B 1-972/972 =============== 0 100.00 99.38
774918 775946 VanA-B 1-1029/1029 =============== 0 100.00 98.93
775952 776560 VanX-B 1-609/609 =============== 0 100.00 96.72
2352083 2352631 aac(6')-Ii 1-549/549 =============== 0 100.00 99.64
2789984 2791462 msr(C) 1-1479/1479 =============== 0 100.00 98.92
Virulence profile
∷ The “virulome”
∷ Curated databases
: known virulence genes
: pathogenicity islands
∷ Caveats
: variable representation across organisms
VirulenceFinder,
VFDB, MvirDB,
ViPR, PAI DB
Backward compatibility
MLST
Resistome
Virulome
NG-MAST
MLVA
VNTR
Serotyping
Phage typing
PFGE
SRST2, mlst,
ngmaster, lissero,
and many more!
When typing lets us down
Typing resolution
Focus on a small “informative” section
Genotype shows isolates are related
D’oh!
Exploiting the whole genome
A familiar tree
Every SNP is sacred
∷ Chocolate bar tree
: branches were based on phenotypic attributes
: size, colour, filling, texture, ingredients, flavour
∷ Genomic trees
: want to use every part of the genome sequence
: need to find all differences between isolates
Finding differences
AGTCTGATTAGCTTAGCTTGTAGCGCTATATTAT
AGTCTGATTAGCTTAGAT
ATTAGCTTAGATTGTAG
CTTAGATTGTAGC-C
TGATTAGCTTAGATTGTAGC-CTATAT
TAGCTTAGATTGTAGC-CTATATT
TAGATTGTAGC-CTATATTA
TAGATTGTAGC-CTATATTAT
SNP Deletion
Reference
Reads
Snippy, VarScan,
SAMtools, GATK
and many more!
SNP distance matrix
Annotated tree
∷ 1 SNP resolution
∷ Distinguishes clades
within genotypes
∷ Interpretation is not
straightforward
10 SNPs
L. monocytogenes
Same tree!
Dendrogram
Spanning
Radial
Reference based analysis
∷ Implies you have a “close” reference
: need to be careful with draft genomes
∷ Very sensitive
: single mutation precision
∷ May not be complete
: ignores novel DNA in your isolate
Inferring transmission
∷ Identical
sequence
does not imply
transmission
∷ Easier to rule
out than in
The pan genome
Align all your isolate genomes
Find “common” segments
The core genome
Core is common to all & has similar sequence.
Example pan genome
Roary, LS-BSR,
OrthoMCL, Degust
Rows are genomes, columns are genes.
Core
∷ Common DNA
∷ Vertical evolution
∷ Genotyping
∷ Phylogenetics
∷ Novel DNA
∷ Lateral transfer
∷ Plasmids
∷ Mobile elements
∷ Partly unexploited
Accessory
Progress at MDU-PHL
Traditional workflow
Modern workflow
Nullarbor
∷ Software pipeline
: does “reads to report”
: cloud image available (mGVL)
∷ Under active development
: used at MDU-PHL for past year for routine jobs
: also used by USA CDC Enterics, FSS Qld, and research
∷ National access programme underway
null arbor
“no trees”
Doherty Applied Microbial Genomics
■ Non-profit service available
□ fixed price per isolate
■ Genome sequencing
□ Illumina NextSeq 500
■ Bioinformatics analysis
□ Nullarbor
■ Report
□ QC, typing, resistome, phylogeny
□ plus your raw data
Sharing is caring
Open science
∷ Crowd-sourcing provably works
: EHEC outbreak 2011
: Ebola, MERS, Zika
∷ But only if people share
: sequencing data
: metadata
: software source code for analysis
GenomeTrakr
∷ International cooperation
: Led by FDA + NCBI
: >20 collaborating institutes inc. UK PHE, DK DTU, MX
: Salmonella and Listeria
∷ Public SRA BioProject #183844
: Real-time submission of WGS genome reads
: Nightly updates of phylogenomic trees
: Contains ~25,000 strains of Salmonella
“GenomeTrakka”
∷ A shared online system for all Australian labs
: upload samples
: automated standard/specific analyses
: simple reports and visualization
: easy to submit to international archives (SRA)
∷ Access control
: each lab controls their own data
: jurisdictions can share data in national outbreaks
Final thoughts
Does WGS deliver?
Yes!Bioinformatics Epidemiology
Technology
Microbiology
This means
scientists
not just software
Domain
expertise
Always changing...
Acknowledgements
Ben Howden
Tim Stinear
Dieter Bulach
Jason Kwong
Anders G da Silva
Contact
tseemann.github.io
torsten.seemann@gmail.com
@torstenseemann
The End
Thank you for listening.

More Related Content

What's hot

Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,
Karan Veer Singh
 
Genomics and bioinformatics
Genomics and bioinformatics Genomics and bioinformatics
Genomics and bioinformatics
Senthil Natesan
 

What's hot (20)

Blast
BlastBlast
Blast
 
Molecular markr sscp
Molecular markr sscpMolecular markr sscp
Molecular markr sscp
 
Shotgun and clone contig method
Shotgun and clone contig methodShotgun and clone contig method
Shotgun and clone contig method
 
COMPARATIVE GENOMICS.ppt
COMPARATIVE GENOMICS.pptCOMPARATIVE GENOMICS.ppt
COMPARATIVE GENOMICS.ppt
 
Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,
 
Proteomic databases
Proteomic databasesProteomic databases
Proteomic databases
 
Genomics and bioinformatics
Genomics and bioinformatics Genomics and bioinformatics
Genomics and bioinformatics
 
Gene Ontology Project
Gene Ontology ProjectGene Ontology Project
Gene Ontology Project
 
Nucleic Acid Purification
Nucleic Acid Purification Nucleic Acid Purification
Nucleic Acid Purification
 
Screening methods for cloned libraries
Screening methods for cloned librariesScreening methods for cloned libraries
Screening methods for cloned libraries
 
In vitro testing of drug toxicity
In vitro testing of drug toxicityIn vitro testing of drug toxicity
In vitro testing of drug toxicity
 
''Electrophoretic Mobility Shift Assay'' by KATE, Wisdom Deebeke
''Electrophoretic Mobility Shift Assay'' by KATE, Wisdom Deebeke''Electrophoretic Mobility Shift Assay'' by KATE, Wisdom Deebeke
''Electrophoretic Mobility Shift Assay'' by KATE, Wisdom Deebeke
 
Motif andpatterndatabase
Motif andpatterndatabaseMotif andpatterndatabase
Motif andpatterndatabase
 
Identification of disease genes
Identification of disease genesIdentification of disease genes
Identification of disease genes
 
Protein protein interactions
Protein protein interactionsProtein protein interactions
Protein protein interactions
 
Illumina Sequencing
Illumina SequencingIllumina Sequencing
Illumina Sequencing
 
Ion torrent and SOLiD Sequencing Techniques
Ion torrent and SOLiD Sequencing Techniques Ion torrent and SOLiD Sequencing Techniques
Ion torrent and SOLiD Sequencing Techniques
 
Third Generation Sequencing
Third Generation Sequencing Third Generation Sequencing
Third Generation Sequencing
 
Flux balance analysis
Flux balance analysisFlux balance analysis
Flux balance analysis
 
NCBI
NCBINCBI
NCBI
 

Viewers also liked

The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
Justin Johnson
 
Whole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyWhole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiology
Philip Ashton
 

Viewers also liked (20)

What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
 
Big data nebraska
Big data nebraskaBig data nebraska
Big data nebraska
 
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
Microbiome Isolation and DNA Enrichment Protocol: Pathogen Detection Webinar ...
 
High-Throughput Sequencing
High-Throughput SequencingHigh-Throughput Sequencing
High-Throughput Sequencing
 
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member StatesProposal for 2016 survey of WGS capacity in EU/EEA Member States
Proposal for 2016 survey of WGS capacity in EU/EEA Member States
 
Poster ESHG
Poster ESHGPoster ESHG
Poster ESHG
 
Making Use of NGS Data: From Reads to Trees and Annotations
Making Use of NGS Data: From Reads to Trees and AnnotationsMaking Use of NGS Data: From Reads to Trees and Annotations
Making Use of NGS Data: From Reads to Trees and Annotations
 
The Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groupsThe Global Micorbial Identifier (GMI) initiative - and its working groups
The Global Micorbial Identifier (GMI) initiative - and its working groups
 
Aug2015 deanna church analytical validation
Aug2015 deanna church analytical validationAug2015 deanna church analytical validation
Aug2015 deanna church analytical validation
 
Metagenomics sequencing
Metagenomics sequencingMetagenomics sequencing
Metagenomics sequencing
 
Whole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiologyWhole genome microbiology for Salmonella public health microbiology
Whole genome microbiology for Salmonella public health microbiology
 
Genome Wide Methodologies and Future Perspectives
 Genome Wide Methodologies and Future Perspectives Genome Wide Methodologies and Future Perspectives
Genome Wide Methodologies and Future Perspectives
 
Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety? Whole Genome Sequencing (WGS): How significant is it for food safety?
Whole Genome Sequencing (WGS): How significant is it for food safety?
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome Sequencing
 
Toolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGSToolbox for bacterial population analysis using NGS
Toolbox for bacterial population analysis using NGS
 
Innovative NGS Library Construction Technology
Innovative NGS Library Construction TechnologyInnovative NGS Library Construction Technology
Innovative NGS Library Construction Technology
 
DNA Sequencing from Single Cell
DNA Sequencing from Single CellDNA Sequencing from Single Cell
DNA Sequencing from Single Cell
 
Top 30 Resources For Instructional Designers
Top 30 Resources For Instructional DesignersTop 30 Resources For Instructional Designers
Top 30 Resources For Instructional Designers
 

Similar to Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobials 2016 - Melb, AU - sat 27 feb 2016

Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...
Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...
Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...
InsideScientific
 

Similar to Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobials 2016 - Melb, AU - sat 27 feb 2016 (20)

Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
 
A Genome Sequence Analysis System Built with Hypertable
A Genome Sequence Analysis System Built with HypertableA Genome Sequence Analysis System Built with Hypertable
A Genome Sequence Analysis System Built with Hypertable
 
Expanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSExpanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGS
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
 
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
 
Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...
Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...
Casting a Wider Net in Zebrafish Screening with Automated Microscopy and Imag...
 
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
 
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
Approaches to analysing 1000s of bacterial isolates - ICEID 2015 Atlanta, USA...
 
Forensics: Human Identity Testing in the Applied Genetics Group
Forensics: Human Identity Testing in the Applied Genetics GroupForensics: Human Identity Testing in the Applied Genetics Group
Forensics: Human Identity Testing in the Applied Genetics Group
 
CNV, GWAS & Clinical Analysis Advancements in SVS
CNV, GWAS & Clinical Analysis Advancements in SVSCNV, GWAS & Clinical Analysis Advancements in SVS
CNV, GWAS & Clinical Analysis Advancements in SVS
 
Overview of the commonly used sequencing platforms, bioinformatic search tool...
Overview of the commonly used sequencing platforms, bioinformatic search tool...Overview of the commonly used sequencing platforms, bioinformatic search tool...
Overview of the commonly used sequencing platforms, bioinformatic search tool...
 
VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
 
Jan2015 using the pilot genome rm for clinical validation steve lincoln
Jan2015 using the pilot genome rm for clinical validation steve lincolnJan2015 using the pilot genome rm for clinical validation steve lincoln
Jan2015 using the pilot genome rm for clinical validation steve lincoln
 
An Exploration of Clinical Workflows in VarSeq
An Exploration of Clinical Workflows in VarSeqAn Exploration of Clinical Workflows in VarSeq
An Exploration of Clinical Workflows in VarSeq
 
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysis
 
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
 
VarSeq 2.6.0: Advancing Pharmacogenomics and Genomic Analysis
VarSeq 2.6.0: Advancing Pharmacogenomics and Genomic AnalysisVarSeq 2.6.0: Advancing Pharmacogenomics and Genomic Analysis
VarSeq 2.6.0: Advancing Pharmacogenomics and Genomic Analysis
 

More from Torsten Seemann

De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015
Torsten Seemann
 

More from Torsten Seemann (17)

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will use
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
 
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
 
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
 
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
Pipeline or pipe dream - Midlands Micro Meeting UK - mon 15 sep 2014
 
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
 

Recently uploaded

CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
anilsa9823
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Lokesh Kothari
 
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 bAsymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Sérgio Sacani
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
gindu3009
 
Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdf
PirithiRaju
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
Sérgio Sacani
 
DIFFERENCE IN BACK CROSS AND TEST CROSS
DIFFERENCE IN  BACK CROSS AND TEST CROSSDIFFERENCE IN  BACK CROSS AND TEST CROSS
DIFFERENCE IN BACK CROSS AND TEST CROSS
LeenakshiTyagi
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Sérgio Sacani
 

Recently uploaded (20)

CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 
fundamental of entomology all in one topics of entomology
fundamental of entomology all in one topics of entomologyfundamental of entomology all in one topics of entomology
fundamental of entomology all in one topics of entomology
 
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 bAsymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
Asymmetry in the atmosphere of the ultra-hot Jupiter WASP-76 b
 
Physiochemical properties of nanomaterials and its nanotoxicity.pptx
Physiochemical properties of nanomaterials and its nanotoxicity.pptxPhysiochemical properties of nanomaterials and its nanotoxicity.pptx
Physiochemical properties of nanomaterials and its nanotoxicity.pptx
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
 
Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdf
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
DIFFERENCE IN BACK CROSS AND TEST CROSS
DIFFERENCE IN  BACK CROSS AND TEST CROSSDIFFERENCE IN  BACK CROSS AND TEST CROSS
DIFFERENCE IN BACK CROSS AND TEST CROSS
 
Forensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdfForensic Biology & Its biological significance.pdf
Forensic Biology & Its biological significance.pdf
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
 
Botany 4th semester file By Sumit Kumar yadav.pdf
Botany 4th semester file By Sumit Kumar yadav.pdfBotany 4th semester file By Sumit Kumar yadav.pdf
Botany 4th semester file By Sumit Kumar yadav.pdf
 

Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobials 2016 - Melb, AU - sat 27 feb 2016