SlideShare a Scribd company logo
1 of 15
Decoding our
bacterial overlords
Dr Torsten Seemann
A bacterium
Bacteria are diverse
5,000,000,000,000,000,000,000,000,000,000,000
000,000,000,000,000,000,000,000,000,000,000,
000,000,000,000,000,000,000,000.
Bacteria run the show
100,000,000,000,000
1,000,000
90% microbial
Help digest
our food
Essential for human life
Immune system
Synthesize
vitamins
“Good” E.coli “Bad”
(colon) (bladder)
Bacteria are not malicious
6,000,000,000
letters
The blueprint of life
Genome
A T G C
4,000,000
letters
Extract
the DNA
Reading the genome
Chop it into
small pieces
Read DNA of each piece
We had a bunch of nice long DNA
(each 4 million letters long)
We got back millions of short DNA
(each only 200 letters long)
We want our nice long DNA back!
(please)
Can’t always get what you want
Reconstruct the DNA of the chromosome(s)
Genome assembly
● No box
● Millions of pieces
● Missing and duplicate pieces
● Broken pieces
● No corner or edge pieces
→ Usually end up with ~200 sequences
Like a jigsaw puzzle, but ...
Contains ~4,000 genes
Each gene is ~800 letters long
Genes start and end with special triplets
Finding genes
←ATGCATGATTAGCTTTTAGTCTTATAATGTCTTATATATCGCATTTAAGCCCTGATTCTATGAATG→
Genome is ~4,000,000 letters long
● Identify new species
● Find resistance genes
● Understand evolution
● Trace outbreak origin
Applications
2000 finished genomes
10,000 assembled draft genomes
200,000 downloadable genomes
2,000,000 sitting on USB disks?
Genome assembly is different
- RAM more useful than CPU
Computational challenge
Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

More Related Content

Viewers also liked

A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015Torsten Seemann
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Torsten Seemann
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Torsten Seemann
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Torsten Seemann
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Torsten Seemann
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015Torsten Seemann
 
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014Torsten Seemann
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...Torsten Seemann
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Torsten Seemann
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...Torsten Seemann
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015Torsten Seemann
 
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...Torsten Seemann
 

Viewers also liked (13)

A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
A peek inside the bioinformatics black box - DCAMG Symposium - mon 20 july 2015
 
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
Snippy - Rapid bacterial variant calling - UK - tue 5 may 2015
 
Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012Assembling NGS Data - IMB Winter School - 3 July 2012
Assembling NGS Data - IMB Winter School - 3 July 2012
 
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
Cleaning illumina reads - LSCC Lab Meeting - Fri 23 Nov 2012
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
 
De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015De novo genome assembly - IMB Winter School - 7 July 2015
De novo genome assembly - IMB Winter School - 7 July 2015
 
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014Rapid outbreak characterisation  - UK Genome Sciences 2014 - wed 3 sep 2014
Rapid outbreak characterisation - UK Genome Sciences 2014 - wed 3 sep 2014
 
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...De novo genome assembly  - T.Seemann - IMB winter school 2016 - brisbane, au ...
De novo genome assembly - T.Seemann - IMB winter school 2016 - brisbane, au ...
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
 
How to write bioinformatics software people will use and cite - t.seemann - ...
How to write bioinformatics software people will use and cite -  t.seemann - ...How to write bioinformatics software people will use and cite -  t.seemann - ...
How to write bioinformatics software people will use and cite - t.seemann - ...
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
 
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
WGS in public health microbiology - MDU/VIDRL Seminar - wed 17 jun 2015
 
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...What can we do with microbial WGS data?  - t.seemann - mc gill summer 2016 - ...
What can we do with microbial WGS data? - t.seemann - mc gill summer 2016 - ...
 

Similar to Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014

Transgenic animals
Transgenic animalsTransgenic animals
Transgenic animalsOmBagade1
 
Biology EOC Review
Biology EOC ReviewBiology EOC Review
Biology EOC Reviewtara_1109
 
Lecture 3 -the diversity of genomes and the tree of life
Lecture 3 -the diversity of genomes and the tree of lifeLecture 3 -the diversity of genomes and the tree of life
Lecture 3 -the diversity of genomes and the tree of lifeEmmanuel Aguon
 
Alli's class 112013
Alli's class 112013Alli's class 112013
Alli's class 112013gpalme
 
Genetic engineering
Genetic engineeringGenetic engineering
Genetic engineeringCrystal Rose
 
Biotechnology
BiotechnologyBiotechnology
Biotechnologypremmjppt
 
Bacterial, viral genome organisation
Bacterial, viral genome organisation Bacterial, viral genome organisation
Bacterial, viral genome organisation ANU RAJ
 
A. cells and microscopy check your learning
A. cells and microscopy   check your learningA. cells and microscopy   check your learning
A. cells and microscopy check your learningkcangial
 
Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technologysatheeshkbiotech
 
Medical applications of biotech
Medical applications of biotechMedical applications of biotech
Medical applications of biotechanita devi
 
Current Trends in Molecular Biology and BioTechnology (ppt)
Current Trends in Molecular Biology and BioTechnology (ppt)Current Trends in Molecular Biology and BioTechnology (ppt)
Current Trends in Molecular Biology and BioTechnology (ppt)Perez Eric
 

Similar to Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014 (20)

Transgenic animals
Transgenic animalsTransgenic animals
Transgenic animals
 
Lecture 1,2
Lecture 1,2Lecture 1,2
Lecture 1,2
 
Biology EOC Review
Biology EOC ReviewBiology EOC Review
Biology EOC Review
 
Lecture 3 -the diversity of genomes and the tree of life
Lecture 3 -the diversity of genomes and the tree of lifeLecture 3 -the diversity of genomes and the tree of life
Lecture 3 -the diversity of genomes and the tree of life
 
Chapter26
Chapter26Chapter26
Chapter26
 
Alli's class 112013
Alli's class 112013Alli's class 112013
Alli's class 112013
 
Genetic engineering
Genetic engineeringGenetic engineering
Genetic engineering
 
Biotechnology
BiotechnologyBiotechnology
Biotechnology
 
U1 and U2 Exam Review from 28May
U1 and U2 Exam Review from 28MayU1 and U2 Exam Review from 28May
U1 and U2 Exam Review from 28May
 
Bacterial, viral genome organisation
Bacterial, viral genome organisation Bacterial, viral genome organisation
Bacterial, viral genome organisation
 
A. cells and microscopy check your learning
A. cells and microscopy   check your learningA. cells and microscopy   check your learning
A. cells and microscopy check your learning
 
Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technology
 
Genomics and Plant Genomics
Genomics and Plant GenomicsGenomics and Plant Genomics
Genomics and Plant Genomics
 
Medical applications of biotech
Medical applications of biotechMedical applications of biotech
Medical applications of biotech
 
e. coli
e. colie. coli
e. coli
 
Prokaryotes
ProkaryotesProkaryotes
Prokaryotes
 
Genetic engineering
Genetic engineeringGenetic engineering
Genetic engineering
 
Current Trends in Molecular Biology and BioTechnology (ppt)
Current Trends in Molecular Biology and BioTechnology (ppt)Current Trends in Molecular Biology and BioTechnology (ppt)
Current Trends in Molecular Biology and BioTechnology (ppt)
 
Stemcell nutrition therapy 4
Stemcell nutrition therapy 4Stemcell nutrition therapy 4
Stemcell nutrition therapy 4
 
Biotech 06
Biotech 06Biotech 06
Biotech 06
 

More from Torsten Seemann

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will useTorsten Seemann
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Torsten Seemann
 
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...Torsten Seemann
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015Torsten Seemann
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Torsten Seemann
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Torsten Seemann
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...Torsten Seemann
 

More from Torsten Seemann (7)

How to write bioinformatics software no one will use
How to write bioinformatics software no one will useHow to write bioinformatics software no one will use
How to write bioinformatics software no one will use
 
Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016Snippy - T.Seemann - Poster - Genome Informatics 2016
Snippy - T.Seemann - Poster - Genome Informatics 2016
 
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...Sequencing your poo with a usb stick -  Linux.conf.au 2016 miniconf  - mon 1 ...
Sequencing your poo with a usb stick - Linux.conf.au 2016 miniconf - mon 1 ...
 
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015Long read sequencing -  WEHI  bioinformatics seminar - tue 16 june 2015
Long read sequencing - WEHI bioinformatics seminar - tue 16 june 2015
 
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
Visualizing the pan genome - Australian Society for Microbiology - tue 8 jul ...
 
Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015Long read sequencing - LSCC lab talk - fri 5 june 2015
Long read sequencing - LSCC lab talk - fri 5 june 2015
 
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...Parallel computing in bioinformatics   t.seemann - balti bioinformatics - wed...
Parallel computing in bioinformatics t.seemann - balti bioinformatics - wed...
 

Recently uploaded

Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.aasikanpl
 
Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.aasikanpl
 
TOTAL CHOLESTEROL (lipid profile test).pptx
TOTAL CHOLESTEROL (lipid profile test).pptxTOTAL CHOLESTEROL (lipid profile test).pptx
TOTAL CHOLESTEROL (lipid profile test).pptxdharshini369nike
 
‏‏VIRUS - 123455555555555555555555555555555555555555
‏‏VIRUS -  123455555555555555555555555555555555555555‏‏VIRUS -  123455555555555555555555555555555555555555
‏‏VIRUS - 123455555555555555555555555555555555555555kikilily0909
 
Recombinant DNA technology( Transgenic plant and animal)
Recombinant DNA technology( Transgenic plant and animal)Recombinant DNA technology( Transgenic plant and animal)
Recombinant DNA technology( Transgenic plant and animal)DHURKADEVIBASKAR
 
BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.
BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.
BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.PraveenaKalaiselvan1
 
RESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptx
RESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptxRESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptx
RESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptxFarihaAbdulRasheed
 
Cytokinin, mechanism and its application.pptx
Cytokinin, mechanism and its application.pptxCytokinin, mechanism and its application.pptx
Cytokinin, mechanism and its application.pptxVarshiniMK
 
LIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptx
LIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptxLIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptx
LIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptxmalonesandreagweneth
 
Grafana in space: Monitoring Japan's SLIM moon lander in real time
Grafana in space: Monitoring Japan's SLIM moon lander  in real timeGrafana in space: Monitoring Japan's SLIM moon lander  in real time
Grafana in space: Monitoring Japan's SLIM moon lander in real timeSatoshi NAKAHIRA
 
Twin's paradox experiment is a meassurement of the extra dimensions.pptx
Twin's paradox experiment is a meassurement of the extra dimensions.pptxTwin's paradox experiment is a meassurement of the extra dimensions.pptx
Twin's paradox experiment is a meassurement of the extra dimensions.pptxEran Akiva Sinbar
 
Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |aasikanpl
 
zoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzohaibmir069
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSarthak Sekhar Mondal
 
Call Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCR
Call Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCRCall Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCR
Call Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCRlizamodels9
 
Microphone- characteristics,carbon microphone, dynamic microphone.pptx
Microphone- characteristics,carbon microphone, dynamic microphone.pptxMicrophone- characteristics,carbon microphone, dynamic microphone.pptx
Microphone- characteristics,carbon microphone, dynamic microphone.pptxpriyankatabhane
 
TOPIC 8 Temperature and Heat.pdf physics
TOPIC 8 Temperature and Heat.pdf physicsTOPIC 8 Temperature and Heat.pdf physics
TOPIC 8 Temperature and Heat.pdf physicsssuserddc89b
 
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |aasikanpl
 
Solution chemistry, Moral and Normal solutions
Solution chemistry, Moral and Normal solutionsSolution chemistry, Moral and Normal solutions
Solution chemistry, Moral and Normal solutionsHajira Mahmood
 
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxAnalytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxSwapnil Therkar
 

Recently uploaded (20)

Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Mayapuri Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
 
Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Aiims Metro Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
 
TOTAL CHOLESTEROL (lipid profile test).pptx
TOTAL CHOLESTEROL (lipid profile test).pptxTOTAL CHOLESTEROL (lipid profile test).pptx
TOTAL CHOLESTEROL (lipid profile test).pptx
 
‏‏VIRUS - 123455555555555555555555555555555555555555
‏‏VIRUS -  123455555555555555555555555555555555555555‏‏VIRUS -  123455555555555555555555555555555555555555
‏‏VIRUS - 123455555555555555555555555555555555555555
 
Recombinant DNA technology( Transgenic plant and animal)
Recombinant DNA technology( Transgenic plant and animal)Recombinant DNA technology( Transgenic plant and animal)
Recombinant DNA technology( Transgenic plant and animal)
 
BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.
BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.
BIOETHICS IN RECOMBINANT DNA TECHNOLOGY.
 
RESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptx
RESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptxRESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptx
RESPIRATORY ADAPTATIONS TO HYPOXIA IN HUMNAS.pptx
 
Cytokinin, mechanism and its application.pptx
Cytokinin, mechanism and its application.pptxCytokinin, mechanism and its application.pptx
Cytokinin, mechanism and its application.pptx
 
LIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptx
LIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptxLIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptx
LIGHT-PHENOMENA-BY-CABUALDIONALDOPANOGANCADIENTE-CONDEZA (1).pptx
 
Grafana in space: Monitoring Japan's SLIM moon lander in real time
Grafana in space: Monitoring Japan's SLIM moon lander  in real timeGrafana in space: Monitoring Japan's SLIM moon lander  in real time
Grafana in space: Monitoring Japan's SLIM moon lander in real time
 
Twin's paradox experiment is a meassurement of the extra dimensions.pptx
Twin's paradox experiment is a meassurement of the extra dimensions.pptxTwin's paradox experiment is a meassurement of the extra dimensions.pptx
Twin's paradox experiment is a meassurement of the extra dimensions.pptx
 
Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Lajpat Nagar (Delhi) |
 
zoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistanzoogeography of pakistan.pptx fauna of Pakistan
zoogeography of pakistan.pptx fauna of Pakistan
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
 
Call Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCR
Call Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCRCall Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCR
Call Girls In Nihal Vihar Delhi ❤️8860477959 Looking Escorts In 24/7 Delhi NCR
 
Microphone- characteristics,carbon microphone, dynamic microphone.pptx
Microphone- characteristics,carbon microphone, dynamic microphone.pptxMicrophone- characteristics,carbon microphone, dynamic microphone.pptx
Microphone- characteristics,carbon microphone, dynamic microphone.pptx
 
TOPIC 8 Temperature and Heat.pdf physics
TOPIC 8 Temperature and Heat.pdf physicsTOPIC 8 Temperature and Heat.pdf physics
TOPIC 8 Temperature and Heat.pdf physics
 
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
 
Solution chemistry, Moral and Normal solutions
Solution chemistry, Moral and Normal solutionsSolution chemistry, Moral and Normal solutions
Solution chemistry, Moral and Normal solutions
 
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptxAnalytical Profile of Coleus Forskohlii | Forskolin .pptx
Analytical Profile of Coleus Forskohlii | Forskolin .pptx
 

Decoding our bacterial overlords - Melbourne Knowledge Week - tue 28 oct 2014