Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Motif andpatterndatabase


Published on

Motifs, patterns, profiles

Published in: Education
  • Be the first to comment

  • Be the first to like this

Motif andpatterndatabase

  1. 1. Motif and Pattern Databases And some practical approaches Sucheta Tripathy 10/2/2016
  2. 2. Motifs • Defined as a nucleotide or amino acid sequence pattern that is widespread and is associated with a biological function. – A sequence motif = A structural Motif. – A sequence motif residing in the coding region may encode a structural motif. – Non-coding nucleotide motifs may have regulatory role. May have recognition sites for DNA binding proteins.
  3. 3. Motifs, profiles and patterns • Conserved region of a DNA or protein – Motif • Qualitative expression of a motif – Pattern – Regular Expression – C[TA]TTG{X} • Quantitative expression of a motif – Profile – Position Specific Scoring Matrices (PSSMs) – Weight matrices
  4. 4. Motifs/Patterns N{P}[ST]{P} [FILV]Qxxx[RK]Gxxx[RK]xx[FILVWY] [] -> or (Probability information is lost) {} -> Not () -> repeated ^ -> Beginning
  5. 5. Profiles • Quantitative representation. • More useful for training dataset. TCTAGAAGATGGCAGTGGCGAAGA TCTAGAAAATGACAGTGGCGAAGA TCTAGAAAATGGCAGTAGCGAAGA TCTACTAAATGA TAGTAGCGAAGA A 0,0,0,100 ,0, 75,100, 75 ATG T 100,0,100,0,0, 25, 0, 0 ATG G 0, 0, 0, 0, 75 ,0, 0, 25 ATG C 0,100,0,0, 25 ,0, 0, 0 ATG
  6. 6. De novo prediction of Motifs • MEME; EXTREME; AlignAce, Amadeus, CisModule, FIRE, Gibbs Motif Sampler, PhyloGibbs, SeSiMCMC, ChIPMunk and Weeder. SCOPE, MotifVoter, and Mprofiler MEME (Multiple Expectation Maximization for Motif Elicitation)
  7. 7. Figure 3. Resources MacIsaac KD, Fraenkel E (2006) Practical Strategies for Discovering Regulatory DNA Sequence Motifs. PLoS Comput Biol 2(4): e36. doi:10.1371/journal.pcbi.0020036
  9. 9. Prosite
