B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby

1,981 views

Published on

Presentation by Tina Barsby, NIAB, Cambridge, UK
Delivered at the B4FA Media Dialogue Workshop, Kampala, Uganda - November 2012
www.b4fa.org

Published in: Science
0 Comments
4 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,981
On SlideShare
0
From Embeds
0
Number of Embeds
7
Actions
Shares
0
Downloads
144
Comments
0
Likes
4
Embeds 0
No embeds

No notes for slide

B4FA 2012 Uganda: Genetics, plant breeding and agriculture - Tina Barsby

  1. 1. Dr Tina Barsby Plant Science into Practice Genetics, Plant Breeding and Agriculture
  2. 2. Dr Tina Barsby Plant Science into Practice NIAB, Huntingdon Road, Cambridge, UK
  3. 3. Agriculture: the most important event in human history
  4. 4. Matthew 7:18-7:20 A good tree cannot bring forth evil fruit, neither can a corrupt tree bring forth good fruit. Every tree that bringeth not forth good fruit is hewn down, and cast into the fire. Wherefore by their fruits ye shall know them.
  5. 5. Agriculture is at the Center of Many of Society’s Most Important Debates • Global food security •Enhanced productivity •Increased yield •Sustainable production • Water availability •Drought-tolerant crops • Biofuels •Yield technologies to help meet demand for both food and fuel • Global warming •CO2 footprint •Fertilizer use Exciting time for Agriculture & Plant Breeding
  6. 6. Dr Tina Barsby Plant Science into Practice Meeting the challenges Food security: From “How to Feed the World in 2050” (FAO World Food Summit document, Nov 2009) • By 2050 the world’s population will reach 9.1 billion, 34 % higher than today • In order to feed this larger, more urban and richer population, food production (net of food used for biofuels) must increase by 70 % Environmental Challenges: (Climate Change 2007: Synthesis report, IPCC) • Climate change/agriculture’s global warming contribution - Agriculture and forestry account for 31% of global anthropogenic greenhouse gas emissions • Declining resources: Water, nutrients, natural habitats, biodiversity - Agriculture is responsible for 70% of freshwater withdrawal (United Nations Environment Programme)
  7. 7. Meeting the Demands of a Growing Global Market GROWING WORLD POPULATION (B) 9 RISING CEREAL DEMAND (MMT) 3000 8 2500 7 6 2000 5 1500 4 3 1000 2 500 1 1981 1999 2015 TRANSITION NATIONS • • • 2030 1981 DEVELOPED NATIONS 1999 2015 2030 DEVELOPING NATIONS World population continues to increase Per capita food consumption continues to rise Consumers continue to demand improved taste, convenience, and nutrition “To feed the eight billion people expected by 2025, the world will have to double food production…” CSIS - Seven Revolutions Source: FAO, WHO
  8. 8. Scarcity Security The green revolution Set Aside Biofuels Food Prices Food Security 9 Subsidy and Surplus Set aside, CAP changes
  9. 9. plant biodiversity sunlight science plants Agriculture, Land Use & Society Plants provide sustainable solutions ‘ultimate green & clean technology’
  10. 10. a solar energy source for manufacturing sunlight yesterday today and tomorrow plant biomass fossil reserves oil...refineries CHEMICALS biorenewables bio...refineries MATERIALS FUELS
  11. 11. Dr Tina Barsby Plant Science into Practice ‘Better seeds…better crops’ • Food crisis after WW1 • NIAB established by charitable donations for ‘the improvement of crops with higher genetic quality’ • Barriers to plant breeding, and to access for growers to improved varieties, were recognised barriers to enhanced food production
  12. 12. Dr Tina Barsby Plant Science into Practice 1931 Farmers leaflet 1932 Farmers leaflet The First Farmers Leaflets
  13. 13. Genetic Software & Hardware
  14. 14. Feeding future populations means doubling the productivity of neglected but nutritious crops such as yams and green bananas
  15. 15. • How’s my country doing? Is there an Agriculture strategy? – Availability – Affordability – Safety – Choice – Quality …
  16. 16. Dr Tina Barsby Plant Science into Practice •DuPont Food security index (there are others) •http://foodsecurity.eiu.com Availability Affordability Safety and Quality
  17. 17. Norman E. Borlaug
  18. 18. Growth rates due to early years of the Green Revolution (1961-1980) 3.5 3 2.5 2 Other inputs Cultivars 1.5 1 0.5 0 Latin America Asia Middle East Africa
  19. 19. Growth rates due to late years of the Green Revolution (1981-2000) 2.5 2 1.5 Other inputs Cultivars 1 0.5 0 -0.5 Latin America Asia Middle East Africa
  20. 20. Wheat Genetic history: plant breeding. Dwarfing genes reduced the weight of straw, changing the distribution of resources and Dwarfing genes resulting in: allow increased: •Higher grain •Nitrogen fertiliser yields. levels. In addition, Which increased pleiotropic effects susceptibility to of the dwarfing disease. But plants gene include were protected by more developed: newly grains per ear. •Fungicide
  21. 21. • • • • What do plant breeders do? How do they ‘introduce dwarfing genes’? Where do these new genes come from? Other questions?
  22. 22. Pedigree method
  23. 23. Participatory maize breeding in Africa • Prioritize most important stresses under farmers’ conditions • Manage trials on experiment station and evaluate large numbers of cultivars, • Select the best, and … • Involve farmers – Mother trials in center of farming community grown under best-bet input conditions – Farmer-representative input conditions – Farmer-managed baby trials • Partnership with extension, NGOs, rural schools, and farmer associations The Mother / Baby trial design Collaborative, on-farm evaluation of maize cultivars Performance under farmers’ conditions and farmers’ acceptance
  24. 24. Holistic Research “No matter how excellent the research done in one scientific discipline is, its application in isolation will have little positive effect on crop production. What is needed are venturesome scientists who can work across disciplines to produce appropriate technologies and who have the courage to make their case with political leaders to bring these advances to fruition. ” Norman E. Borlaug
  25. 25. •Father of the Green revolution: Norman Borlaug. •Where did he find the dwarf geneDiversity! Japanese accession..Gene Banks •How did he make possible to grow dwarf wheat in a variety of environments?
  26. 26. Fundamental role of Diversity & Selection Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835
  27. 27. Crop Biodiversity The Seed Vault at Svalbard Global Crop Diversity Trust
  28. 28. Sources of novel variation • • • • International germplasm Landrace, or traditional varieties Wild relatives Progenitor species
  29. 29. Maize has more molecular diversity than humans and apes combined 1.34% 0.09% 1.42% Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001)
  30. 30. • Organisation and importance of Diversity • Selection is a powerful tool but need to understand & know what to select for.
  31. 31. Courtesy Tobert Rocheford and Catherine Bermudez Kandianis Keith Weller Keith Weller Scott Bauer Doug Wilson
  32. 32. ‘all life depends on sunlight and a green leaf’ biology is the science of the natural world & critical to the future of agriculture.
  33. 33. Plant Breeding: Mining Diversity • • SHW back-crossing by CIMMYT Identified reduced group of 94 for back-crossing to Xi19 & Paragon by diversity analysis • Develop UK adapted synthetic backcross derived lines (SHW-D) approx. 6,000 lines • SHW back-crossing by NIAB Genotypic and phenotypic assessment of 440 CIMMYT primary SHW Assess agronomic characteristics of SHW-D including pest & disease resistance, yield components, drought tolerance and nitrogen use efficiency
  34. 34. Paragon x SHW BC1F2 selections Delayed senescence Increased grain sites
  35. 35. Drought in Africa between now and 2090 Red, Orange = More prone to drought Blue = Wetter and less prone to drought Hadley Centre, Met Office, UK
  36. 36. Evaluation of drought tolerance High spike photosynthesis Stem reserves High preanthesis biomass Cellular traits: osmotic adjustment, heat tolerance, etc. Leaf traits: wax, rolling, thickness, etc. Early ground cover Long coleoptile Large seed Water relations: stomatal conductance, etc.
  37. 37. Drought assessment at CIMMYT Mexico Drought trials at Obregon, N. Mexico Tractor-mounted Giddings soil corer
  38. 38. Conventional pedigree selection Reproduced from Koebner & Summers 2003
  39. 39. Marker- Aided Selection • Locating and tagging the genes • Genes??
  40. 40. Genes (Every organism carries inside itself what are known as genes) • DNA is divided into sections called genes. • Each gene codes for a protein • Each protein has a function
  41. 41. DNA - the code for life • The DNA code consists of just 4 building blocks: – A, C, T and G. A C T G ...GCCTTACG… ....ACTGCCTGGAAC…. ….TGACGGACCTTG…. Source: Microsoft Encarta • Whether we are bacteria, fungi earthworms, mushrooms or humans our DNA has the same building blocks, just in a different order. Source: Microsoft Encarta
  42. 42. Chromosome changes: mutations
  43. 43. • A new characteristic is the result of a gene mutation • Genes can be amplified and ‘seen’ as molecular markers. • Breeders are choosing genes or combinations of genes which give the characters the farmer needs
  44. 44. Vavilov 1887-1943 •Soviet botanist & geneticist •Discovered and identified centres of origin of cultivated plants •Criticised the nonMendelian concepts of Lysenko •Arrested in 1940, died of malnutrition in prison in 1943.
  45. 45. Many plant species have been domesticated around the world All of the principal crops we rely on today come from domesticated species
  46. 46. Domestication: the first plant breeders The practice of artificial selection has been practiced by farmers for thousands of years and has transformed wild plants into the crops we depend on today through this process of domestication
  47. 47. Crop origins and diversification: multiple births Science 316, 1830-1835 ESEB Congress, Uppsala, Sweden, August 2007
  48. 48. Domestication traits: traits that distinguish seed & fruit crops from their progenitors
  49. 49. Little overlap between centres of origin & today’s productive agriculture. Nature Vol 418, 700-707 ESEB Congress, Uppsala, Sweden, August 2007
  50. 50. • Genetics: the science underlying plant breeding.
  51. 51. Heredity •Heredity is the passing of traits to offspring (from its parent or ancestors). Offspring resemble their parents more than they resemble unrelated individuals (why is this so?)
  52. 52. Charles Darwin Evolution is driven by natural selection
  53. 53. Darwin’s mentor Great Teachers often feature in the development of Great People!
  54. 54. Dr Tina Barsby Plant Science into Practice •Agriculture depends on plant breeding, choosing the best, crossing the best with the best and hoping for the best… •With a little guidance from genetics! •And the blessing of good soil and rainfall.
  55. 55. Sexual reproduction in plants
  56. 56. F1 Hybrids ESEB Congress, Uppsala, Sweden, August 2007
  57. 57. USA: Historic Maize Yields 6 5 Yield (tonnes/ha) 4 3 2 1 0 1875 To put your footer here go to View > Header and Footer 1925 1975 65
  58. 58. Hybrid vrs Open pollinated maize On the left, a local landrace variety On the right a new, hybrid maize variety developed by CIMMYT with PASS funding.
  59. 59. Concepts of Hybrid Production - Hybrid Vigour (Heterosis) Hybrid Vigour is the superiority of progeny (offspring) (F1) over the mean of its two parents (P) heterozygous heterosis inbreeding depression homozygous selfing
  60. 60. History of Hybrids in Sorghum 5000 United States 4500 3500 3000 2500 2000 Inbred Varieties 1500 Hybrid Cultivars 1000 500 Year 1997 1993 1989 1985 1981 1977 1973 1969 1965 1961 1957 1953 1949 1945 1941 1937 1933 0 1929 Yield (kg/ha) 4000
  61. 61. Hybrid Seed Production – Getting the cross • Hybrids are produced by hand emasculation in corn. • In wheat, chemicals are used to sterilize the pollen. • Cytoplasmic male sterility (CMS) is used for hybrid seed production in sorghum and pearl millet.
  62. 62. Training of Seed Growers in Hybrid Production Crossing A and B lines Heat sterilization of pollen using polythene bag Identifying the different parts of the sorghum plant
  63. 63. Gregor Johann Mendel, (b. 22 July 1822; d. 6 January 1884) Moravia, Austro-Hungarian Empire Brno (Czech Rep.) Experimemts, 1856-1870 Originator of the concept of the gene (autosomal inheritance) Birthplace of Modern Genetic Analysis Augustinian monastry garden, St. Thomas, Brünn, Austria
  64. 64. Mendel’s Laws • Law of equal segregation (First Law) The two members of a gene pair segregate from each other into the gametes; so that half the gametes carry one member of the pair and the other half of the gametes carry the other member of the pair. • Law of Independent Assortment (Second Law) - different gene pairs assort independently during gamete formation
  65. 65. Reasons for choosing to study garden pea • Can be grown in a small area • Produce lots of offspring • Easily identifiable traits • Can be artificially crosspollinated
  66. 66. A pea flower with the keel cut and opened to expose the reproductive parts
  67. 67. Artificial cross pollination
  68. 68. Genes (The genes are codes or messages. They carry information. The information they carry is used to tell the organism what chemicals it needs to make in order to survive, grow or reproduce ) • Genes make us who we are • We receive our genes from our parents • The same is true for all animals, plants and microbes
  69. 69. The seven character differences studied by Mendel
  70. 70. purple-flowered (f) x white flowered (m)
  71. 71. Summary and conclusions of Mendel’s experiments •After crossing pure parental strains, the F1 produced 100% of one character. •After self-pollinating the F1, both characters showed up in a 3:1 ratio. •Because the same types of ratio kept coming up, Mendel believed that there must be some mathematical formula or explanation for the observed data •The first assumption made by Mendel was that there must be a ”pair of factors” that controls the trait in pea plant. This “pair of factors” idea helped him formulate his principles
  72. 72. Dominant and recessive traits
  73. 73. Mendel’s Laws • Law of equal segregation (First Law) The two members of a gene pair segregate from each other into the gametes; so that half the gametes carry one member of the pair and the other half of the gametes carry the other member of the pair. • Law of Independent Assortment (Second Law) different gene pairs assort independently during gamete formation
  74. 74. Information from genes.
  75. 75. Serendipity: Natural Hybridisation  Many modern crop species are the result of ancient (or recent) hybridisation events. Oilseed Rape Cotton Wheat Maize
  76. 76. Wheat a classic allo-hexaploid Science Vol 316, 1862-1866 ESEB Congress, Uppsala, Sweden, August 2007
  77. 77. The New Rice for Africa Monty Jones 2004
  78. 78. Selective breeding is a powerful tool ESEB Congress, Uppsala, Sweden, August 2007
  79. 79. ‘Doubly Green Revolution’ Sir Gordon Conway • The aim •repeat the success of the Green Revolution •on a global scale to include Africa •in many diverse localities • and be •equitable •sustainable •and environmentally friendly
  80. 80. Daily calorie intake in developing world Rice 45% Wheat 29% Maize 11% Cassava 3% Sorghum 2% Potato 2% Sweet potato 2% Millet 2% Soybean 2% Bean 1%
  81. 81. t/ha US maize yields still rising – why? 2.0 1.5 1.0 0.5 -1.0 Source: Defra & USDA 2006 2004 2002 2000 1998 1996 1994 1992 1990 1988 -0.5 1986 0.0
  82. 82. “The Three Pillars of Yield” BREEDING AGRONOMICS BIOTECHNOLOGY Strategically breed plants to create new, more robust seeds that perform better – and longer – in the field. Use precision ag, planting density, plant health protection, and conservation tillage to make acres more productive. Supplement breeding advancements by adding special beneficial genes to the plant. ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW
  83. 83. The Importance of Genetics Products Germplasm Development Traditional & Molecular Breeding Genetics Genetic diversity Analytical Screens Biochemistry Variety Development Yield Trials Product Testing Molecular Genetics Market Identification by Trait, Crop, species Transgenic Plant Development Cell Culture Molecular Biology Genetics Gene Discovery Plant Biology Genomics • 24 ABI 377 Automated sequencers • 20,000 Lane per week capacity
  84. 84. Bioinformatics DNA Sequencing and ‘Omics © ISTOCKPHOTO DAVID MARCHAL SNP Genotyping
  85. 85. The Life sciences revolution Unlocking the genetic potential of the biosphere Exciting time Molecular biology Computer science Plant Breeding Mathematics Sustainable food production
  86. 86. Contemporary Science ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTAT GGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTACC GCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCTT CTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA DNA – a common language across living organisms in the biosphere genome programmes link understanding of biology to agriculture implications for: - livestock - arable - forestry - aquaculture
  87. 87. Democratisation of genomics Roche 454: Metagenomics, amplicon sequencing, BAC sequencing Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for amplicons, small genomes, focused GBS and pilot experiments Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes
  88. 88. Genes provide the foundation of new products for farmers Genes Protein yield? tolerance to drought? flowering time? Trait biomass utility? improved agronomy? tolerance to cold? Product
  89. 89. In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating Ability to Realize Step-Change Improvements Traits GENOMES/YEAR Genome for every yield plot Reference genomes for each crop •Heterosis •Phenotypic & metabolic plasticity •Perenniality Genomes targeted for specific traits (disease) •Evolution breeding systems •Ecological competitive ability •Intra & intergenotypic Competition PREDICTION POWER ACCELERATING • Gene prediction knowledge will grow exponentially • Unlocks the opportunity for gene-based breeding •Nutrient mobilisation Crop & Root ideotypes Water utilisation
  90. 90. Pau Euralis Ag Chem & Seed Industry May 2000 July 1996 100% Equity August 1996 100% Equity Interstate Payco Payco Interstate GarstSeed Co. Seed Garst Mendel Biotech AstraZeneca PLC The Netherlands August 1996 100% Equity June 1997 $78 M 100% Equit y United Kingdom Mogen International NV Paradigm Genetics ExSeedGenetics LLC December 1997 July 1998 $1.4 Best ( ) April 1996 $30 M 50% Equity November 1996 $50 M 5% Equit y May 1997 $242 M 45% Equit y Total cost $322 Million Plant Breeding International Cambridge, . Ltd. Ltd July 1998 $525 M 100% Equity Monsanto/ Pharmacia United Kingdom June 1998 First Line Seeds, . Ltd. Ltd Canada Novartis AG November 1998 50% Equit y August 1998 100% Equity Agritrading Italy (Syngenta AG) Wilson Seeds, Inc. 1998 100% Equity July 1999 100% Equity December 1998 40% Equit y Brazil Asgrow Seed Company LLC DeKalb Genetics Corporation France July 1997 Affymetrix CuraGen Koipesol /Agrosem /Agra Spain November 1996 $240 M 100% Equity Custom Farm Seed July 1999 20% Equit y U.S. Cooperative System: Croplan Genetics, FFR, March 1996 $1.2 B 40% Equit y May 1998 $2.5 B 100% Equity Total cost $3.7 Billion Jacob Hartz Seed Co., Inc. Monsoy France July 1999 80% Equit y Switzerland November 1997 JV wit h FT Sementes Corn States Hybrid Service, Inc. Sarl. Corn States International . Sarl Eridania Beghin -Say Land O’ Lakes November 1998 50% Equit y January 1997 $1.02 B 100% Equit y Holden’s Foundation Seeds April 1998 100% Equity Sturdy Grow Hybrids, Inc. 1983 100% Equity Cereon Syngenta AG Diversa Corp. GrowMark , etc. May 1998 $100 M 50% Equit y Joint Venture Cargill’s International Seed Division $150 M 100% Equity April 1996 Calgene, , Calgene Inc. 20% Equit y The Netherlands France Zimmerman Hybrids, Inc. May 1998 $100 M 50% Equit y Joint Venture Other Companies Advanta BV Advanta BV Cargill Inc. , Renessen Agracetus Inc. , Cooperatives August 1996 50% Equit y August 1996 HybriTechSeed HybriTechSeed Int’l., Inc. 100% Equity 1982 November 1997 $150 M 100% Equity Joint Ventures 50% RoyalVanderHave Equit y The Netherlands France Brazil Seed Companies The Netherlands 100% Equity Cargill Hybrid Seeds North America HybriTech Europe SA February 1996 90% Equit y SA Sementes Agroceres Life Science Companies Cooperatie CosunUA UA France February 1996 10% Equit y AgriPro Seed Wheat Division Italy Maisadour Semences SA OGS Pioneer Hi-Bred International, Inc. Maxygen April 1998 100% Equity BASF March 1999 100% Equity HybrinovaSA HybrinovaSA Lynx Dois Marcos October 1999 100% Equity August 1997 50% Equit y Brazil Lexicon Incyte Nidera Semillas ScheringAG India February 1999 100% Equity Sementes Ribeiral Ltda . Sementes Fartura Ltda Mitla Pesquisa Agricola Ltda Brazil December 1999 24% Equit y Germany Aventis CropScience December 1999 76% Equit y March 1998 50% Equit y 1996 95% Equit y Germany Canada Agritope/Agrinomics RhoBio France Diversa 15% Equit y Canada France France Protein Technologies Brazil 1997 25% Equit y Morgan Seeds Argentina Nickerson Seeds United Kingdom March 1994 100% Equity 99% Equity France October 1990 100% Equity October 1993 80% Equit y September 1996 $34.6 M 100% Equity Akin Seed Co. Groupe Limagrain Dinamilho Carol Productos Agricolas Ltda International 1997 55% Equit y July 1994 85% Equit y KingAgroInc. Pau Euralis March 1998 50% Equit y Biogemma Callahan Seeds June 1994 100% Equity Lynx December 1997 $1.5 B 100% Equity Mais Angevin France Biotechnica International, Inc./ LG Seeds April 1998 $32 M 100% Equity Verneuil Holding SA France December 1996 $9.4 M 18.75% Equity March 1999 $15 M 25% Equit y France France Plantec Biotechnologie Great Lakes Hybrids, Inc. 83.6% Illinois Foundation Seed, Inc. Equit y AgrEvo July 1999 100% Equity 1993 80% Equit y Advanced AgriTraits March 1999 16.4% Equit y August 1997 50% Equit y March 1999 12% Equit y KWS Saat Exelixis Pending Up to 25% Equit y August 1996 75% Equit y- $550M ProagroGroup Aventis SA Argentina Germany Plant Genetic Systems International (PGS) E.I. DuPont de Nemours & Co. Optimum Quality Grains, LLC Dow Agrosciences October 1998 $322 M 100% Equity Diversa Diversa) Mycogen Corporation September 1998 100% Equity Paradigm Incyte LION Exelixis Bayer February 1996 $72 M 100% Equity Hibridos Colorado Ltda deMilho FT Biogeneticsde Milho Ltda United AgriseedsInc. , Brazil Large Scale Biology (BioSource)
  91. 91. Distribution of Miscanthus Species N 55° N 24° S 9° after Hodkinson & Renvoize et al. 2001
  92. 92. IGER’s hunt for Asian elephant grass http://www.iger.bbsrc.ac.uk/News/9march2007miscanthus.htm China Taiwan Japan
  93. 93. Crossing • Hybridisation Strategy • 2n M. sinensis x 2n M. sinensis from wide geographical origins • 4n M. sacchariflorus x 2n M. sinensis to produce 3n M. x giganteus types
  94. 94. Selection
  95. 95. STARCH BIOSYNTHESIS ENZYMES ADPglucose SSI SSIIa SSIII GBSSI Amylose BEI BEIIa BEIIb Isa1 Amylopectin
  96. 96. Waxy & Starch Synthase – Tetra-ARMs 400 bp 300 bp 200 bp 100 bp Negative Control Riso 16 YMK + Tipple YMK Tipple Tipple Tipple Tipple x YMK F1 Tipple x YMK F1 Tipple x YMK F1 Tipple x YMK F1 Tipple x YMK F1 Tipple x YMK F1 •Tetra-ARMs PCR applied to both these genes. •Example below is a gel of the waxy amplicons external fragment (PCR positive control) wild type amplicon mutant specific amplicon
  97. 97. Ghana’s Success Story Sources: Development Outreach, October, 08;Coulombe & Wodon, World Bank; Irish Hunger Report • MDG 1 achieved • Malnourished - 5.8m in 1993 to 2.7 m in 2003. • Declines in % underweight children and mortality • Strong agricultural growth since 80s • 25% increase due to area expansion • Maize yield up by 36%, cassava by 50% • New maize, yam, rice and cassava varieties • A pest resistant cassava. • Strong growth in smallholder cocoa & pineapples • Market liberalisation • New rural infrastructure
  98. 98. All this is threatened by Climate Change • Higher temperatures • Greater & more intense rainfall • Greater droughts • River bank erosion • Rising sea levels • More intense cyclones • Salt water incursions
  99. 99. The biosphere – nature’s solutions
  100. 100. Next steps ? Proteomics Genomics Analytical Technology Transgenic Traits Molecular Engineering (Higher Sustainable Yields) Germplasm Improvement Breeding: major technology platform for food, water & energy security Winter Nurseries Computer Technology Plot Mechanisation Quantitative Genetics Statistics Pedigree Breeding Hybridisation Open Pollinated Selection Time New Opportunities for Agriculture Plant Breeders use any combination of these technologies to develop enhanced products for customers, and continue to explore technologies to enhance this process
  101. 101. Dr Tina Barsby Plant Science into Practice •Developing an industry-wide resource, showcasing new technology and innovation in plant genetic development for the agriculture and horticulture sectors, on themes of:

×