SlideShare a Scribd company logo
Phylogenetic Workflows: Tree Building and Post-tree Analyses Naim Matasci The iPlant Collaborative Plant Biology 2011 August 6-10, 2011
Why is the tree of life important? “ Knowledge of evolutionary relationships is fundamental to biology, yielding new insights across the plant sciences, from comparative genomics and molecular evolution, to plant development, to the study of adaptation, speciation, community assembly, and ecosystem functioning.”
Nothing in biology makes sense except in the light of evolution. T. G. Dobzahnsky
Scalability Ackerly, 2009; J. Felsenstein, ca. 1980; Ranger Cluster at TACC
iPlant Tree of Life Grand Challenge ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Ancestral state of Hawaiian lobelioids Lobelia niihauensis  (Image: David Eickhoff) Cyanea leptostegia  (Image: Karl Magnacca)
 
Continuous Ancestral Character Estimation  (Schulter  et al.  1997, Paradis 2004) ?
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
>gi|1835233|emb|Z83147.1| S.nepaulensis rbcL gene TTATTATACTCCTGAATAYGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAGCCT GGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGT GGACCGATGGACTTACTAACCTTGATCGTTACAAAGGGCGATGCTACAACATAGAGCCCGTTGCTGGAGA AGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATG TTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAA TCCCTACTGCGTATTGTAAAACTTTCCAAGGACCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAA CAAGTATGGTCGTCCCTTGCTGGGATGTACTATTAAACCTAAATTGGGGTTATCGGCTAAAAACTACGGT AGAGCAGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAAC CATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTTTAAAGCACAGTCTGAAACAGG TGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTATATTT >gi|1835227|emb|Z83136.1| S.foetidissimum rbcL gene AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAA GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCG CGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCG TTACAAAGGGCGATGCTACCACATCGAGCCCGTNGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCT TATCCTTTAGACCTYTTTGAAGAAGGTTCTGTTACTAATATGTKNACTTCCATTGTGGGGAATGTATTTG GGTTCAAAGCCCTGCGTGCTTTACGTCTGGAAGATCTGCGAATCCCTCCTGCGTATTCTAAAACTTTCCA AGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGT ACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTG GACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTT ATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCT >gi|1834456|emb|Z83132.1| G.urceolata rbcL gene AACTAAAGCGGGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTAT GAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAG CGGGGGCCGCCGTAGCTGCCGAATCCTCCACTGGTACATGGACAACTGTGTGGACCGACGGACTTACTAG CCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATTTATTGCT TATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTA ATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCGTATGCTAA AACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAATAAGTATGGTCGTCCCCTG
Get Sequences ,[object Object],[object Object]
Get sequences DEMO
 
 
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
muscleDEMO
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Improved Tree Building Tools ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
RAxML DEMO
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Tree Visualization ,[object Object],[object Object],[object Object],[object Object],[object Object]
iPlant Tree Viewer http://portnoy.iplantcollaborative.org/
Live tree view demo
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Obstacles
Lopper DEMO
 
 
 
 
 
 
 
 
 
 
 
 
Lobelia kauaensis Lobelia villosa Galeatella gloria-montis Trematolobelia kauaiensis Trematolobelia macrostachys Lobelia hypoleuca Neowimmeria yuccoides Lobelia niihauensis Brighamia insignis Brighamia rockii Delissea rhytidosperma Delissea subcordata Cyanea acuminata Cyanea hirtella Cyanea coriacea Delissea leptostegia Clermontia kakeana Clermontia parviflora Clermontia arborescens Clermontia fauriei
The TNRS: A Taxonomic Name Resolution Service for Plants Tonight from 5:30 - 7:30 in Exhibit Hall A. Poster number  P21011 .
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
CACE DEMO
 
 
 
 
 
 
 
 
 

More Related Content

What's hot

Phylogenetic Tree evolution
Phylogenetic Tree evolutionPhylogenetic Tree evolution
Phylogenetic Tree evolution
Md Omama Jawaid
 
Bioinformatics.Assignment
Bioinformatics.AssignmentBioinformatics.Assignment
Bioinformatics.Assignment
Naima Tahsin
 
Molecular Phylogenetics
Molecular PhylogeneticsMolecular Phylogenetics
Molecular Phylogenetics
Meghaj Mallick
 
Survey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisSurvey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysis
Arindam Ghosh
 
Phylogenetic studies
Phylogenetic studiesPhylogenetic studies
Phylogenetic studies
Malla Reddy College of Pharmacy
 
MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)
Athar Mutahari
 
Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...
IAEME Publication
 
The tree of life
The tree of lifeThe tree of life
The tree of life
Ingrida Olendraite
 
Fasta
FastaFasta
PMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataPMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological data
Yiteng Dang
 
Protease Phylogeny
 Protease Phylogeny  Protease Phylogeny
Protease Phylogeny
Chris Southan
 
Phylogenetic analysis in nutshell
Phylogenetic analysis in nutshellPhylogenetic analysis in nutshell
Phylogenetic analysis in nutshell
Avinash Kumar
 

What's hot (12)

Phylogenetic Tree evolution
Phylogenetic Tree evolutionPhylogenetic Tree evolution
Phylogenetic Tree evolution
 
Bioinformatics.Assignment
Bioinformatics.AssignmentBioinformatics.Assignment
Bioinformatics.Assignment
 
Molecular Phylogenetics
Molecular PhylogeneticsMolecular Phylogenetics
Molecular Phylogenetics
 
Survey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisSurvey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysis
 
Phylogenetic studies
Phylogenetic studiesPhylogenetic studies
Phylogenetic studies
 
MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)
 
Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...
 
The tree of life
The tree of lifeThe tree of life
The tree of life
 
Fasta
FastaFasta
Fasta
 
PMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataPMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological data
 
Protease Phylogeny
 Protease Phylogeny  Protease Phylogeny
Protease Phylogeny
 
Phylogenetic analysis in nutshell
Phylogenetic analysis in nutshellPhylogenetic analysis in nutshell
Phylogenetic analysis in nutshell
 

Similar to Phylogenetic Workflows

Post-tree Analyses Workflow
Post-tree Analyses WorkflowPost-tree Analyses Workflow
Post-tree Analyses Workflow
Naim Matasci
 
iPlant Tree of Life
iPlant Tree of LifeiPlant Tree of Life
iPlant Tree of Life
Naim Matasci
 
Functionally annotate genomic variants
Functionally annotate genomic variantsFunctionally annotate genomic variants
Functionally annotate genomic variants
Denis C. Bauer
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Spark Summit
 
Omics Integration
Omics IntegrationOmics Integration
Omics Integration
Rosemary McCloskey
 
Thesis def
Thesis defThesis def
Thesis def
Jay Vyas
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
Naim Matasci
 
Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Carleton Biology talk : March 2014
Carleton Biology talk : March 2014
Karen Cranston
 
2 md2016 annotation
2 md2016 annotation2 md2016 annotation
2 md2016 annotation
Scott Dawson
 
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Anubis Hosein
 
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Natalio Krasnogor
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Nils Gehlenborg
 
phy prAC.pptx
phy prAC.pptxphy prAC.pptx
Inference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldInference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' world
Joe Parker
 
Transcript detection in RNAseq
Transcript detection in RNAseqTranscript detection in RNAseq
Transcript detection in RNAseq
Denis C. Bauer
 
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Denis C. Bauer
 
Utility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticUtility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogenetic
EdizonJambormias2
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012
gregcaporaso
 
Introduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisIntroduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysis
Josh Neufeld
 
Network Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsNetwork Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systems
Ganesh Bagler
 

Similar to Phylogenetic Workflows (20)

Post-tree Analyses Workflow
Post-tree Analyses WorkflowPost-tree Analyses Workflow
Post-tree Analyses Workflow
 
iPlant Tree of Life
iPlant Tree of LifeiPlant Tree of Life
iPlant Tree of Life
 
Functionally annotate genomic variants
Functionally annotate genomic variantsFunctionally annotate genomic variants
Functionally annotate genomic variants
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
 
Omics Integration
Omics IntegrationOmics Integration
Omics Integration
 
Thesis def
Thesis defThesis def
Thesis def
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
 
Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Carleton Biology talk : March 2014
Carleton Biology talk : March 2014
 
2 md2016 annotation
2 md2016 annotation2 md2016 annotation
2 md2016 annotation
 
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
 
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient Stratification
 
phy prAC.pptx
phy prAC.pptxphy prAC.pptx
phy prAC.pptx
 
Inference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldInference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' world
 
Transcript detection in RNAseq
Transcript detection in RNAseqTranscript detection in RNAseq
Transcript detection in RNAseq
 
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1
 
Utility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticUtility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogenetic
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012
 
Introduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisIntroduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysis
 
Network Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsNetwork Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systems
 

More from Naim Matasci

iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3
Naim Matasci
 
iPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopiPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio Workshop
Naim Matasci
 
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesThe iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
Naim Matasci
 
iPlant TNRS
iPlant TNRSiPlant TNRS
iPlant TNRS
Naim Matasci
 
Phylotastic reconciliation
Phylotastic reconciliationPhylotastic reconciliation
Phylotastic reconciliation
Naim Matasci
 
Phylogenetic Workflows
Phylogenetic WorkflowsPhylogenetic Workflows
Phylogenetic Workflows
Naim Matasci
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
Naim Matasci
 
The TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsThe TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for Plants
Naim Matasci
 

More from Naim Matasci (8)

iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3
 
iPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopiPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio Workshop
 
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesThe iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
 
iPlant TNRS
iPlant TNRSiPlant TNRS
iPlant TNRS
 
Phylotastic reconciliation
Phylotastic reconciliationPhylotastic reconciliation
Phylotastic reconciliation
 
Phylogenetic Workflows
Phylogenetic WorkflowsPhylogenetic Workflows
Phylogenetic Workflows
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
 
The TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsThe TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for Plants
 

Recently uploaded

dbms calicut university B. sc Cs 4th sem.pdf
dbms  calicut university B. sc Cs 4th sem.pdfdbms  calicut university B. sc Cs 4th sem.pdf
dbms calicut university B. sc Cs 4th sem.pdf
Shinana2
 
TrustArc Webinar - 2024 Global Privacy Survey
TrustArc Webinar - 2024 Global Privacy SurveyTrustArc Webinar - 2024 Global Privacy Survey
TrustArc Webinar - 2024 Global Privacy Survey
TrustArc
 
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
saastr
 
GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)
Javier Junquera
 
5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides
DanBrown980551
 
HCL Notes and Domino License Cost Reduction in the World of DLAU
HCL Notes and Domino License Cost Reduction in the World of DLAUHCL Notes and Domino License Cost Reduction in the World of DLAU
HCL Notes and Domino License Cost Reduction in the World of DLAU
panagenda
 
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...
alexjohnson7307
 
Programming Foundation Models with DSPy - Meetup Slides
Programming Foundation Models with DSPy - Meetup SlidesProgramming Foundation Models with DSPy - Meetup Slides
Programming Foundation Models with DSPy - Meetup Slides
Zilliz
 
Taking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdfTaking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdf
ssuserfac0301
 
Monitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdfMonitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdf
Tosin Akinosho
 
Presentation of the OECD Artificial Intelligence Review of Germany
Presentation of the OECD Artificial Intelligence Review of GermanyPresentation of the OECD Artificial Intelligence Review of Germany
Presentation of the OECD Artificial Intelligence Review of Germany
innovationoecd
 
A Comprehensive Guide to DeFi Development Services in 2024
A Comprehensive Guide to DeFi Development Services in 2024A Comprehensive Guide to DeFi Development Services in 2024
A Comprehensive Guide to DeFi Development Services in 2024
Intelisync
 
WeTestAthens: Postman's AI & Automation Techniques
WeTestAthens: Postman's AI & Automation TechniquesWeTestAthens: Postman's AI & Automation Techniques
WeTestAthens: Postman's AI & Automation Techniques
Postman
 
Serial Arm Control in Real Time Presentation
Serial Arm Control in Real Time PresentationSerial Arm Control in Real Time Presentation
Serial Arm Control in Real Time Presentation
tolgahangng
 
System Design Case Study: Building a Scalable E-Commerce Platform - Hiike
System Design Case Study: Building a Scalable E-Commerce Platform - HiikeSystem Design Case Study: Building a Scalable E-Commerce Platform - Hiike
System Design Case Study: Building a Scalable E-Commerce Platform - Hiike
Hiike
 
Best 20 SEO Techniques To Improve Website Visibility In SERP
Best 20 SEO Techniques To Improve Website Visibility In SERPBest 20 SEO Techniques To Improve Website Visibility In SERP
Best 20 SEO Techniques To Improve Website Visibility In SERP
Pixlogix Infotech
 
Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...
Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...
Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...
saastr
 
“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...
“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...
“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...
Edge AI and Vision Alliance
 
Columbus Data & Analytics Wednesdays - June 2024
Columbus Data & Analytics Wednesdays - June 2024Columbus Data & Analytics Wednesdays - June 2024
Columbus Data & Analytics Wednesdays - June 2024
Jason Packer
 
Azure API Management to expose backend services securely
Azure API Management to expose backend services securelyAzure API Management to expose backend services securely
Azure API Management to expose backend services securely
Dinusha Kumarasiri
 

Recently uploaded (20)

dbms calicut university B. sc Cs 4th sem.pdf
dbms  calicut university B. sc Cs 4th sem.pdfdbms  calicut university B. sc Cs 4th sem.pdf
dbms calicut university B. sc Cs 4th sem.pdf
 
TrustArc Webinar - 2024 Global Privacy Survey
TrustArc Webinar - 2024 Global Privacy SurveyTrustArc Webinar - 2024 Global Privacy Survey
TrustArc Webinar - 2024 Global Privacy Survey
 
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
 
GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)
 
5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides
 
HCL Notes and Domino License Cost Reduction in the World of DLAU
HCL Notes and Domino License Cost Reduction in the World of DLAUHCL Notes and Domino License Cost Reduction in the World of DLAU
HCL Notes and Domino License Cost Reduction in the World of DLAU
 
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...
leewayhertz.com-AI in predictive maintenance Use cases technologies benefits ...
 
Programming Foundation Models with DSPy - Meetup Slides
Programming Foundation Models with DSPy - Meetup SlidesProgramming Foundation Models with DSPy - Meetup Slides
Programming Foundation Models with DSPy - Meetup Slides
 
Taking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdfTaking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdf
 
Monitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdfMonitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdf
 
Presentation of the OECD Artificial Intelligence Review of Germany
Presentation of the OECD Artificial Intelligence Review of GermanyPresentation of the OECD Artificial Intelligence Review of Germany
Presentation of the OECD Artificial Intelligence Review of Germany
 
A Comprehensive Guide to DeFi Development Services in 2024
A Comprehensive Guide to DeFi Development Services in 2024A Comprehensive Guide to DeFi Development Services in 2024
A Comprehensive Guide to DeFi Development Services in 2024
 
WeTestAthens: Postman's AI & Automation Techniques
WeTestAthens: Postman's AI & Automation TechniquesWeTestAthens: Postman's AI & Automation Techniques
WeTestAthens: Postman's AI & Automation Techniques
 
Serial Arm Control in Real Time Presentation
Serial Arm Control in Real Time PresentationSerial Arm Control in Real Time Presentation
Serial Arm Control in Real Time Presentation
 
System Design Case Study: Building a Scalable E-Commerce Platform - Hiike
System Design Case Study: Building a Scalable E-Commerce Platform - HiikeSystem Design Case Study: Building a Scalable E-Commerce Platform - Hiike
System Design Case Study: Building a Scalable E-Commerce Platform - Hiike
 
Best 20 SEO Techniques To Improve Website Visibility In SERP
Best 20 SEO Techniques To Improve Website Visibility In SERPBest 20 SEO Techniques To Improve Website Visibility In SERP
Best 20 SEO Techniques To Improve Website Visibility In SERP
 
Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...
Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...
Deep Dive: AI-Powered Marketing to Get More Leads and Customers with HyperGro...
 
“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...
“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...
“Temporal Event Neural Networks: A More Efficient Alternative to the Transfor...
 
Columbus Data & Analytics Wednesdays - June 2024
Columbus Data & Analytics Wednesdays - June 2024Columbus Data & Analytics Wednesdays - June 2024
Columbus Data & Analytics Wednesdays - June 2024
 
Azure API Management to expose backend services securely
Azure API Management to expose backend services securelyAzure API Management to expose backend services securely
Azure API Management to expose backend services securely
 

Phylogenetic Workflows

  • 1. Phylogenetic Workflows: Tree Building and Post-tree Analyses Naim Matasci The iPlant Collaborative Plant Biology 2011 August 6-10, 2011
  • 2. Why is the tree of life important? “ Knowledge of evolutionary relationships is fundamental to biology, yielding new insights across the plant sciences, from comparative genomics and molecular evolution, to plant development, to the study of adaptation, speciation, community assembly, and ecosystem functioning.”
  • 3. Nothing in biology makes sense except in the light of evolution. T. G. Dobzahnsky
  • 4. Scalability Ackerly, 2009; J. Felsenstein, ca. 1980; Ranger Cluster at TACC
  • 5.
  • 6. Ancestral state of Hawaiian lobelioids Lobelia niihauensis (Image: David Eickhoff) Cyanea leptostegia (Image: Karl Magnacca)
  • 7.  
  • 8. Continuous Ancestral Character Estimation (Schulter et al. 1997, Paradis 2004) ?
  • 9.
  • 10.
  • 11. >gi|1835233|emb|Z83147.1| S.nepaulensis rbcL gene TTATTATACTCCTGAATAYGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAGCCT GGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGT GGACCGATGGACTTACTAACCTTGATCGTTACAAAGGGCGATGCTACAACATAGAGCCCGTTGCTGGAGA AGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATG TTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAA TCCCTACTGCGTATTGTAAAACTTTCCAAGGACCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAA CAAGTATGGTCGTCCCTTGCTGGGATGTACTATTAAACCTAAATTGGGGTTATCGGCTAAAAACTACGGT AGAGCAGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAAC CATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTTTAAAGCACAGTCTGAAACAGG TGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTATATTT >gi|1835227|emb|Z83136.1| S.foetidissimum rbcL gene AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAA GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCG CGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCG TTACAAAGGGCGATGCTACCACATCGAGCCCGTNGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCT TATCCTTTAGACCTYTTTGAAGAAGGTTCTGTTACTAATATGTKNACTTCCATTGTGGGGAATGTATTTG GGTTCAAAGCCCTGCGTGCTTTACGTCTGGAAGATCTGCGAATCCCTCCTGCGTATTCTAAAACTTTCCA AGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGT ACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTG GACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTT ATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCT >gi|1834456|emb|Z83132.1| G.urceolata rbcL gene AACTAAAGCGGGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTAT GAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAG CGGGGGCCGCCGTAGCTGCCGAATCCTCCACTGGTACATGGACAACTGTGTGGACCGACGGACTTACTAG CCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATTTATTGCT TATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTA ATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCGTATGCTAA AACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAATAAGTATGGTCGTCCCCTG
  • 12.
  • 14.  
  • 15.  
  • 16.  
  • 17.  
  • 18.  
  • 19.  
  • 20.  
  • 21.  
  • 22.
  • 24.  
  • 25.  
  • 26.  
  • 27.  
  • 28.  
  • 29.  
  • 30.
  • 31.
  • 33.  
  • 34.  
  • 35.  
  • 36.  
  • 37.  
  • 38.  
  • 39.
  • 40.
  • 41. iPlant Tree Viewer http://portnoy.iplantcollaborative.org/
  • 43.  
  • 44.  
  • 45.  
  • 46.  
  • 47.  
  • 48.  
  • 49.
  • 52.  
  • 53.  
  • 54.  
  • 55.  
  • 56.  
  • 57.  
  • 58.  
  • 59.  
  • 60.  
  • 61.  
  • 62.  
  • 63.  
  • 64. Lobelia kauaensis Lobelia villosa Galeatella gloria-montis Trematolobelia kauaiensis Trematolobelia macrostachys Lobelia hypoleuca Neowimmeria yuccoides Lobelia niihauensis Brighamia insignis Brighamia rockii Delissea rhytidosperma Delissea subcordata Cyanea acuminata Cyanea hirtella Cyanea coriacea Delissea leptostegia Clermontia kakeana Clermontia parviflora Clermontia arborescens Clermontia fauriei
  • 65. The TNRS: A Taxonomic Name Resolution Service for Plants Tonight from 5:30 - 7:30 in Exhibit Hall A. Poster number P21011 .
  • 66.
  • 68.  
  • 69.  
  • 70.  
  • 71.  
  • 72.  
  • 73.  
  • 74.  
  • 75.  
  • 76.  

Editor's Notes

  1. Our understanding of the phylogeny of the half million known species of green plants has expanded dramatically over the past two decades, The task of assembling a comprehensive "tree of life" for them presents a Grand Challenge. Also part of the grand challenge is developing the necessary infrastructre to view and use the tree of life, to put it into the hands of plant biologists
  2. Left tree: Maple tree phylogeny from D. Ackerly Left picture: Joe Felsenstein, ca. 1980 Right picture: Ranger cluster at TACC
  3. Distance matrix calculation compared to FASTREE