This document provides an introduction to hidden Markov models (HMMs). It discusses that HMMs can be used to model sequential processes where the underlying states cannot be directly observed, only the outputs of the states. The document outlines the basic components of an HMM including states, transition probabilities, emission probabilities, and gives examples of HMMs for coin tossing and weather. It also briefly discusses the history of HMMs and their applications in fields like bioinformatics for problems such as gene finding.
Scoring system is a set of values for qualifying the set of one residue being substituted by another in an alignment.
It is also known as substitution matrix.
Scoring matrix of nucleotide is relatively simple.
A positive value or a high score is given for a match & negative value or a low score is given for a mismatch.
Scoring matrices for amino acids are more complicated because scoring has to reflect the physicochemical properties of amino acid residues.
Scoring system is a set of values for qualifying the set of one residue being substituted by another in an alignment.
It is also known as substitution matrix.
Scoring matrix of nucleotide is relatively simple.
A positive value or a high score is given for a match & negative value or a low score is given for a mismatch.
Scoring matrices for amino acids are more complicated because scoring has to reflect the physicochemical properties of amino acid residues.
Being able to identify genes, compare them, analyze them could be applied in various research areas from medical to industrial.
This ppt is designed for Health science and computational biology students to enable you understand the above mentioned topic.
Ab Initio Protein Structure Prediction is a method to determine the tertiary structure of protein in the absence of experimentally solved structure of a similar/homologous protein. This method builds protein structure guided by energy function.
I had prepared this presentation for an internal project during my masters degree course.
Automated sequencing of genomes require automated gene assignment
Includes detection of open reading frames (ORFs)
Identification of the introns and exons
Gene prediction a very difficult problem in pattern recognition
Coding regions generally do not have conserved sequences
Much progress made with prokaryotic gene prediction
Eukaryotic genes more difficult to predict correctly
Genomics is a discipline in genetics that applies recombinant DNA, DNA sequencing methods, and bioinformatics to sequence, assemble and analyze the function and structure of genomes
Gene prediction is the process of determining where a coding gene might be in a genomic sequence. Functional proteins must begin with a Start codon (where DNA transcription begins), and end with a Stop codon (where transcription ends).
Genome annotation, NGS sequence data, decoding sequence information, The genome contains all the biological information required to build and maintain any given living organism.
The experimental methods used by biotechnologists to determine the structures of proteins demand sophisticated equipment and time.
A host of computational methods are developed to predict the location of secondary structure elements in proteins for complementing or creating insights into experimental results.
Chou-Fasman algorithm is an empirical algorithm developed for the prediction of protein secondary structure
🔍 Unlocking the Secrets of Hidden Markov Models (HMM) - Your Guide to Probabilistic Modeling! 🤖
Welcome to another exciting episode of Machine Learning ! In this video, we dive deep into the fascinating world of Hidden Markov Models, demystifying their key concepts, applications, and inference techniques.
📚 In this video, we'll cover:
🔹 Introduction to HMM: Understanding the basics of what HMM is and how it works.
🔹 Key Concepts of the Model: Unraveling the inner workings of states, observations, and transitions in an HMM.
🔹 Applications of HMM: Discover how HMM is used in various real-world scenarios, from speech recognition to bioinformatics.
🔹 Inference in HMM: We'll walk you through both the Forward Algorithm and Viterbi Algorithm, which are essential for making predictions using HMMs.
🌦️ Plus, we've got a hands-on example demonstrating the prediction of weather for the next day based on the current day's conditions using Python and HMM. 🌤️
Whether you're a data science enthusiast or just curious about probabilistic modeling, this video will provide you with a solid foundation in Hidden Markov Models.
Don't forget to like, subscribe, and hit the notification bell to stay updated with our latest content on data science, machine learning, and more!
#HiddenMarkovModel #HMM #ProbabilisticModeling #DataScience #MachineLearning #Python #AI #WeatherPrediction #Tutorial
Enjoy the video and happy learning! 📊📈📉
Being able to identify genes, compare them, analyze them could be applied in various research areas from medical to industrial.
This ppt is designed for Health science and computational biology students to enable you understand the above mentioned topic.
Ab Initio Protein Structure Prediction is a method to determine the tertiary structure of protein in the absence of experimentally solved structure of a similar/homologous protein. This method builds protein structure guided by energy function.
I had prepared this presentation for an internal project during my masters degree course.
Automated sequencing of genomes require automated gene assignment
Includes detection of open reading frames (ORFs)
Identification of the introns and exons
Gene prediction a very difficult problem in pattern recognition
Coding regions generally do not have conserved sequences
Much progress made with prokaryotic gene prediction
Eukaryotic genes more difficult to predict correctly
Genomics is a discipline in genetics that applies recombinant DNA, DNA sequencing methods, and bioinformatics to sequence, assemble and analyze the function and structure of genomes
Gene prediction is the process of determining where a coding gene might be in a genomic sequence. Functional proteins must begin with a Start codon (where DNA transcription begins), and end with a Stop codon (where transcription ends).
Genome annotation, NGS sequence data, decoding sequence information, The genome contains all the biological information required to build and maintain any given living organism.
The experimental methods used by biotechnologists to determine the structures of proteins demand sophisticated equipment and time.
A host of computational methods are developed to predict the location of secondary structure elements in proteins for complementing or creating insights into experimental results.
Chou-Fasman algorithm is an empirical algorithm developed for the prediction of protein secondary structure
🔍 Unlocking the Secrets of Hidden Markov Models (HMM) - Your Guide to Probabilistic Modeling! 🤖
Welcome to another exciting episode of Machine Learning ! In this video, we dive deep into the fascinating world of Hidden Markov Models, demystifying their key concepts, applications, and inference techniques.
📚 In this video, we'll cover:
🔹 Introduction to HMM: Understanding the basics of what HMM is and how it works.
🔹 Key Concepts of the Model: Unraveling the inner workings of states, observations, and transitions in an HMM.
🔹 Applications of HMM: Discover how HMM is used in various real-world scenarios, from speech recognition to bioinformatics.
🔹 Inference in HMM: We'll walk you through both the Forward Algorithm and Viterbi Algorithm, which are essential for making predictions using HMMs.
🌦️ Plus, we've got a hands-on example demonstrating the prediction of weather for the next day based on the current day's conditions using Python and HMM. 🌤️
Whether you're a data science enthusiast or just curious about probabilistic modeling, this video will provide you with a solid foundation in Hidden Markov Models.
Don't forget to like, subscribe, and hit the notification bell to stay updated with our latest content on data science, machine learning, and more!
#HiddenMarkovModel #HMM #ProbabilisticModeling #DataScience #MachineLearning #Python #AI #WeatherPrediction #Tutorial
Enjoy the video and happy learning! 📊📈📉
Stock Market Prediction using Hidden Markov Models and Investor sentimentPatrick Nicolas
This presentation describes hidden Markov Models to predict financial markets indices using the weekly sentiment survey from the American Association of Individual Investors.
The first section describes the hidden Markov model (HMM), followed by selection of features (investors' sentiment) and labeled data (S&P 500 index).
The second section dives into HMMs for continuous observations and detection of regime shifts/structural breaks using an auto-regressive Markov chain
The last section is devoted to alternative models to HMM.
Methods of Track Circuit Fault Diagnosis Based on HmmIJRESJOURNAL
ABSTRACT: A fault diagnosis method of track circuit based on HMM (Hidden Markov Model) was proposed. On the basis of division of failure mechanism of the track circuit, a training mechanism of multi - sample HMM model was established, and a track circuit fault diagnosis system was composed by multiple fault classifiers. Because of the universality of this system, taking the hump section of railway and a section of ZPW- 2000A non-insulated track circuit as examples, the correctness and effectiveness of the system were verified. The result shows that the fault diagnosis method of track circuit which is based on HMM can effectively achieve six kinds of track circuit fault diagnosis. And compared with BP Neural Network fault diagnosis, it has a higher accuracy rate and has a faster computing speed, which can be used as a new solution for fault diagnosis of track circuits.
Hello,
This is Tahsin Ahmed Nasim. I'm a student of Civil Engineering. My Own MARKOV CHAINS Presentation.
This is the part of Probability of Statistic.
Hidden Markov model technique for dynamic spectrum accessTELKOMNIKA JOURNAL
Dynamic spectrum access is a paradigm used to access the spectrum dynamically. A hidden Markov model (HMM) is one in which you observe a sequence of emissions, but do not know the sequence of states the model went through to generate the emissions. Analysis of hidden Markov models seeks to recover the sequence of states from the observed data. In this paper, we estimate the occupancy state of channels using hidden Markov process. Using Viterbi algorithm, we generate the most likely states and compare it with the channel states. We generated two HMMs, one slowly changing and another more dynamic and compare their performance. Using the Baum-Welch algorithm and maximum likelihood algorithm we calculated the estimated transition and emission matrix, and then we compare the estimated states prediction performance of both the methods using stationary distribution of average estimated transition matrix calculated by both the methods.
The Hidden Markov model (HMM) is a statistical model that was first proposed by Baum L.E. (Baum and Petrie, 1966) and uses a Markov process that contains hidden and unknown parameters. In this model, the observed parameters are used to identify the hidden parameters. These parameters are then used for further analysis. The HMM is a type of Markov chain. Its state cannot be directly observed but can be identified by observing the vector series. Since the 1980s, HMM has been successfully used for speech recognition, character recognition, and mobile communication techniques. It has also been rapidly adopted in such fields as bioinformatics and fault diagnosis. The basic principle of HMM is that the observed events have no one-to-one correspondence with states but are linked to states through the probability distribution. It is a doubly stochastic process, which includes a Markov chain as the basic stochastic process, and describes state transitions and stochastic processes that describe the statistical correspondence between the states and observed values. From the perspective of observers, only the observed value can be viewed, while the states cannot. A stochastic process is used to identify the existence of states and their characteristics. Thus, it is called a “hidden” Markov model.
Statistical methods are used to build state changes in HMM to understand the most possible trends in the surveillance data. HMM can automatically and flexibly adjust the trends, seasonal, covariant, and distributional elements. HMM has been used in many studies on time series surveillance data. For example, Le Strat and Carrat used a univariate HMM to handle influenza-like time series data in France. Additionally, Madigan indicated that HMM needed to include spatial information based on existing states.
Builder.ai Founder Sachin Dev Duggal's Strategic Approach to Create an Innova...Ramesh Iyer
In today's fast-changing business world, Companies that adapt and embrace new ideas often need help to keep up with the competition. However, fostering a culture of innovation takes much work. It takes vision, leadership and willingness to take risks in the right proportion. Sachin Dev Duggal, co-founder of Builder.ai, has perfected the art of this balance, creating a company culture where creativity and growth are nurtured at each stage.
Accelerate your Kubernetes clusters with Varnish CachingThijs Feryn
A presentation about the usage and availability of Varnish on Kubernetes. This talk explores the capabilities of Varnish caching and shows how to use the Varnish Helm chart to deploy it to Kubernetes.
This presentation was delivered at K8SUG Singapore. See https://feryn.eu/presentations/accelerate-your-kubernetes-clusters-with-varnish-caching-k8sug-singapore-28-2024 for more details.
PHP Frameworks: I want to break free (IPC Berlin 2024)Ralf Eggert
In this presentation, we examine the challenges and limitations of relying too heavily on PHP frameworks in web development. We discuss the history of PHP and its frameworks to understand how this dependence has evolved. The focus will be on providing concrete tips and strategies to reduce reliance on these frameworks, based on real-world examples and practical considerations. The goal is to equip developers with the skills and knowledge to create more flexible and future-proof web applications. We'll explore the importance of maintaining autonomy in a rapidly changing tech landscape and how to make informed decisions in PHP development.
This talk is aimed at encouraging a more independent approach to using PHP frameworks, moving towards a more flexible and future-proof approach to PHP development.
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...UiPathCommunity
💥 Speed, accuracy, and scaling – discover the superpowers of GenAI in action with UiPath Document Understanding and Communications Mining™:
See how to accelerate model training and optimize model performance with active learning
Learn about the latest enhancements to out-of-the-box document processing – with little to no training required
Get an exclusive demo of the new family of UiPath LLMs – GenAI models specialized for processing different types of documents and messages
This is a hands-on session specifically designed for automation developers and AI enthusiasts seeking to enhance their knowledge in leveraging the latest intelligent document processing capabilities offered by UiPath.
Speakers:
👨🏫 Andras Palfi, Senior Product Manager, UiPath
👩🏫 Lenka Dulovicova, Product Program Manager, UiPath
The Art of the Pitch: WordPress Relationships and SalesLaura Byrne
Clients don’t know what they don’t know. What web solutions are right for them? How does WordPress come into the picture? How do you make sure you understand scope and timeline? What do you do if sometime changes?
All these questions and more will be explored as we talk about matching clients’ needs with what your agency offers without pulling teeth or pulling your hair out. Practical tips, and strategies for successful relationship building that leads to closing the deal.
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...Jeffrey Haguewood
Sidekick Solutions uses Bonterra Impact Management (fka Social Solutions Apricot) and automation solutions to integrate data for business workflows.
We believe integration and automation are essential to user experience and the promise of efficient work through technology. Automation is the critical ingredient to realizing that full vision. We develop integration products and services for Bonterra Case Management software to support the deployment of automations for a variety of use cases.
This video focuses on the notifications, alerts, and approval requests using Slack for Bonterra Impact Management. The solutions covered in this webinar can also be deployed for Microsoft Teams.
Interested in deploying notification automations for Bonterra Impact Management? Contact us at sales@sidekicksolutionsllc.com to discuss next steps.
Neuro-symbolic is not enough, we need neuro-*semantic*Frank van Harmelen
Neuro-symbolic (NeSy) AI is on the rise. However, simply machine learning on just any symbolic structure is not sufficient to really harvest the gains of NeSy. These will only be gained when the symbolic structures have an actual semantics. I give an operational definition of semantics as “predictable inference”.
All of this illustrated with link prediction over knowledge graphs, but the argument is general.
Let's dive deeper into the world of ODC! Ricardo Alves (OutSystems) will join us to tell all about the new Data Fabric. After that, Sezen de Bruijn (OutSystems) will get into the details on how to best design a sturdy architecture within ODC.
"Impact of front-end architecture on development cost", Viktor TurskyiFwdays
I have heard many times that architecture is not important for the front-end. Also, many times I have seen how developers implement features on the front-end just following the standard rules for a framework and think that this is enough to successfully launch the project, and then the project fails. How to prevent this and what approach to choose? I have launched dozens of complex projects and during the talk we will analyze which approaches have worked for me and which have not.
UiPath Test Automation using UiPath Test Suite series, part 4DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 4. In this session, we will cover Test Manager overview along with SAP heatmap.
The UiPath Test Manager overview with SAP heatmap webinar offers a concise yet comprehensive exploration of the role of a Test Manager within SAP environments, coupled with the utilization of heatmaps for effective testing strategies.
Participants will gain insights into the responsibilities, challenges, and best practices associated with test management in SAP projects. Additionally, the webinar delves into the significance of heatmaps as a visual aid for identifying testing priorities, areas of risk, and resource allocation within SAP landscapes. Through this session, attendees can expect to enhance their understanding of test management principles while learning practical approaches to optimize testing processes in SAP environments using heatmap visualization techniques
What will you get from this session?
1. Insights into SAP testing best practices
2. Heatmap utilization for testing
3. Optimization of testing processes
4. Demo
Topics covered:
Execution from the test manager
Orchestrator execution result
Defect reporting
SAP heatmap example with demo
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Smart TV Buyer Insights Survey 2024 by 91mobiles.pdf91mobiles
91mobiles recently conducted a Smart TV Buyer Insights Survey in which we asked over 3,000 respondents about the TV they own, aspects they look at on a new TV, and their TV buying preferences.
2. HIDDEN MARKOV MODEL(HMM)
Real-world has structures and processes which have
observable outputs.
– Usually sequential .
– Cannot see the event producing the output.
Problem: how to construct a model of the structure or
process given only observations.
3. HISTORY OF HMM
• Basic theory developed and published in 1960s and 70s
• No widespread understanding and application until late
80s
• Why?
– Theory published in mathematic journals which were
not widely read.
– Insufficient tutorial material for readers to understand
and apply concepts.
4. Andrei Andreyevich Markov
1856-1922
Andrey Andreyevich Markov was a Russian
mathematician.
He is best known for his work on stochastic
processes.
A primary subject of his research later became
known as Markov chains and Markov processes .
5. HIDDEN MARKOV MODEL
• A Hidden Markov Model (HMM) is a statical model in
which the system is being modeled is assumed to be
a Markov process with hidden states.
• Markov chain property: probability of each
subsequent state depends only on what was the
previous state.
6. EXAMPLE OF HMM
• Coin toss:
– Heads, tails sequence with 2 coins
– You are in a room, with a wall
– Person behind wall flips coin, tells result
– Coin selection and toss is hidden
– Cannot observe events, only output (heads, tails) from events
– Problem is then to build a model to explain observed
sequence of heads and tails.
7. EXAMPLE OF HMM
• Weather
– Once each day weather is observed
– State 1: rain
– State 2: cloudy
– State 3: sunny
– What is the probability the weather for the next 7 days will be:
– sun, sun, rain, rain, sun, cloudy, sun
– Each state corresponds to a physical observable event
8. HMM COMPONENTS
• A set of states (x’s)
• A set of possible output symbols (y’s)
• A state transition matrix (a’s)
– probability of making transition from one state to the
next
• Output emission matrix (b’s)
– probability of a emitting/observing a symbol at a
particular state
• Initial probability vector
– probability of starting at a particular state
– Not shown, sometimes assumed to be 1
9. EXAMPLE OF HMM
0.3
0.7
Rain
Dry
0.2
• Two states : ‘Rain’ and ‘Dry’.
• Transition probabilities: P(‘Rain’|‘Rain’)=0.3 ,
P(‘Dry’|‘Rain’)=0.7 , P(‘Ra’)=0.6 .
• in’|‘Dry’)=0.2, P(‘Dry’|‘Dry’)=0.8
• Initial probabilities: say P(‘Rain’)=0.4 , P(‘Dry
0.8
12. COMMON HMM TYPES
• Ergodic (fully connected):
– Every state of model can be reached in a single step from
every other state of the model.
• Bakis (left-right):
– As time increases, states proceed from left to right
13. HMM IN BIOINFORMATICS
• Hidden Markov Models (HMMs) are a
probabilistic model for modeling and
representing biological sequences.
• They allow us to do things like find genes, do
sequence alignments and find regulatory
elements such as promoters in a principled
manner.
14. PROBLEMS OF HMM
• Three problems must be solved for HMMs to be
useful in real-world applications
●
1) Evaluation
●
2) Decoding
●
3) Learning
15. EVOLUTION OF PROBLEM
Given a set of HMMs, which is the one most
likely to have produced the observation sequence?
GACGAAACCCTGTCTCTATTTATCC
p(HMM-3)?
p(HMM-1)?
p(HMM-2)?
HMM 1
HMM 2
HMM 3
p(HMM-n)?
…
HMM n
18. HMM-APPLICATION
• DNA Sequence analysis
• Protein family profiling
• Predprediction
• Splicing signals prediction
• Prediction of genes
• Horizontal gene transfer
• Radiation hybrid mapping, linkage analysis
• Prediction of DNA functional sites.
• CpG island
19. HMM-APPLICATION
• Speech Recognition
• Vehicle Trajectory Projection
• Gesture Learning for Human-Robot Interface
• Positron Emission Tomography (PET)
• Optical Signal Detection
• Digital Communications
• Music Analysis
22. Refrences
• Rabiner, L. R. (1989). A Tutorial on Hidden Markov
Models and Selected Applications in Speech
Recognition. Proceedings of the IEEE, 77(2), 257-285.
• Essential bioinformatics, Jin Xion
• http://www.sociable1.com/v/Andrey-Markov108362562522144#sthash.tbdud7my.dpuf