Misconceptions About Ebola Virus Disease

Misconceptions About Ebola Virus Disease
MISCONCEPTIONS ABOUT EBOLA VIRUS DISEASE IN W. AFRICA
Whilst the virus was devastating and the United Nations and several countries stepped in to help,
there were lots of misconceptions about Ebola – how it spreads, the symptoms, risks and prevention,
and what it would mean if it became a global pandemic. Misconceptions were on some of the
following; Ebola is an airborne virus, if you contract Ebola, you'll die, anyone with the virus is
contagious, Someone infected in North America will lead to a worldwide epidemic, being around
someone infected is high risk, Ebola can be found in fruit, Antibiotics can cure Ebola, Ebola victims
die by bleeding out of their orifices, The disease is for the government to make money, and the virus
was ... Show more content on Helpwriting.net ...
".... I also heard that a doctor died of Ebola, what I asked myself is, this doctor protected himself
before attending to the Ebola patient so if Ebola is not in the air how can the doctor just get close to
the patient and contract the disease which affected him and he did. So I asked and I was told that it
is through the air the doctor got it" (FGD, Women, Rural, GAR).
"...and maybe if an infected person sneezes or coughs and the droplets come out and I happen to be
close by and through the air I breathe in I can also get it. That is the reason why health worker gets
infected" (FGD, Female, Nurse, AR).
"I am trained, but during our training, we were told that one could not get Ebola through the air but I
don 't believe that because some of the experts in the use of PPE still got the condition. So I think
they could have only been infected through the air" (FGD, Female, Nurse, GAR).
" For the mosquitoes, it is more serious because, they will suck the blood of the infected person, take
some of the blood, and when they bite you to suck your blood, then it will leave some of the
organisms in your blood. It is just like how the mosquito gives people malaria by biting people with
malaria in their blood and put malaria in another person 's blood to get the condition" (FGD, Female,
Rural NR).
"I agree with what number 5 has said, If
... Get more on HelpWriting.net ...

Lassa Fever: An Old World Arenavirus Essay
Lassa Fever: An Old World Arenavirus
ABSTRACT
A brief summary of lassa fever, its history, pathology and effects on the indigenous populations.
Also, lassa fever in the context of newly emerging diseases. LASSA FEVER
On January 12, 1969, a missionary nun, working in the small town of
Lassa, Nigeria, began complaining of a backache. Thinking she had merely pulled a muscle, she
ignored the pain and went on about her business. After a week, however, the nurse had a throat so
sore and so filled with ulcers, she couldn't swallow. Thinking she was suffering from one of the
many bacterial diseases endemic to the area, her sisters administered every antibiotic they had on
store in the town's Church of the ... Show more content on Helpwriting.net ...
These viruses, long hidden in the deepest recesses of rain forests, are making their presence felt as
much of the rain forest and other isolated areas become more and more accessible. Lassa fever is
mostly on the rise as its main vector, the rodent Mastomys natalensis, is increasing in numbers due
(indirectly) to an increase in poverty and scarcity of food.(Garrett, 1994) To be specific, when the
endemic region has a scarcity of food, the villagers kill and eat the larger rat, Rattus ra ttus, which is
a main competitor of the Mastomys natalensis, thereby allowing the smaller Mastomys to flourish.
The disease mainly effects the areas of western Africa, from Senegal to, of course, Zaire, although it
has been exported to the United States (about 115 cases). (Southern, 1996)
Lassa fever consists of two single strands of RNA enclosed within a spherical protein coat. The
RNA exists as two strands designated L (for long) and S (for short). The S segment is the more
abundant of the two as it codes for the major structural components such as the internal proteins and
the glycoproteins, while the L segment codes for RNA polymerase and perhaps a few structural
proteins. The protein coat has a number of T–shaped glycoproteins protruding from it, composed of
GP (glycoprotein)2 which is the base and GP1 which is the T–bar. (Southern, 1996) This structure is
what inserts itself into the receptors on the host cell. When the virus first gains entry into

Essay about Bioterrorism
Bioterrorism – Viral Hemorrhagic Fever
Abstract
Viral hemorrhagic fever is one of the most feared diseases of today's time. Although most people
have heard of anthrax, smallpox and the plague, viral hemorrhagic fever has become a potent
weapon used for bioterrorism, silently killing its victims and instilling fear in the rest of the
population. Viral hemorrhagic fever can be divided into 4 families. Although each family of viral
hemorrhagic fever may have some of its own unique characteristics, the four families are generally
fairly similar regarding the high fevers and hemorrhages they cause. Because of past outbreaks of
viral hemorrhagic fever, scientists have reason to believe that terrorists have easier access to the
deadly viruses ... Show more content on Helpwriting.net ...
The reason why the Ebola and Marburg viruses are grouped together is because they have similar
symptoms. The incubation period is about 1 week, which means it takes about 1 2 week for
symptoms to occur (Wener n.p.). The symptoms can range from something as mild as headaches and
sore throats to disseminated intravascular coagulation (DIC), which means clotting of the blood.
Other symptoms include fevers, arthritis, prostration, bleeding diathesis, thrombocytopenia and
platelet dysfunction. Some nonspecific clinical effects include nausea, pain in the stomach, diarrhea,
encephalitis and rashes (Schlossberg 53). Furthermore, viral hemorrhagic fever can potentially lead
to neurologic, hepatic, pulmonary, and renal disorders (Wener n.p.).
What makes Ebola such a serious disease is that fact that 90% of the people who are diagnosed with
this disease die, and the few surviving patients suffer from hair loss and sensory problems (Wener
n.p.). On the other hand, Marburg hemorrhagic fever has a 23–70% mortality rate. The history
behind the Marburg hemorrhagic fever helps explain why VHF is so dangerous to the public and can
easily be spread all across the globe. Marburg hemorrhagic fever was first discovered in 1967 in
Marburg, Germany when lab workers were contracted with the disease after handling imported
monkeys from Africa (Center for Disease Control n.p.). Because Ebola and Marburg hemorrhagic
fever are both zoonotic, they can be transmitted from

Write An Essay On Ebola Virus
Name: TaLissa Battieste_
Causative Agent: Ebola Hemorrhagic Fever
Disease: Ebola Virus
Classification of the causative agent:
The Ebola virus is a member if the family filoviridae and the order mononegavirales and is the
causative agent of the Ebola Hemorrhagic Fever. These are enveloped viruses that have mini–
genomes consisting of a single RNA molecule of negative or anti–MRNA sense. There are five
different Ebola virus genomes (BDBV, EBOV, RESTV, SUDV and TAFV) that differ in sequence
and the number and location of gene overlaps.
History:
Most cases of the Ebola virus are located on the African continent. It was first identified in a
province of Sudan and in a nearby region of Zaiire in 1976 after significant epidemics in Yambuku
and Nzara, both in Africa. ... Show more content on Helpwriting.net ...
Different strains of Ebola may have slight changes in their structure, indicating that virulence is
mutagenic. The virus contains a nucleocapsid which gives it some virulence as well.
Mode of transmission:
Ebola is transmitted in humans through the direct contact of blood or bodily fluids of a person
infected with the virus. Examples of these fluids include diarrhea, sweat, vomit, semen, urine, and
breast milk. The virus can enter through breaks in the skin or mucous membranes including the
nose, mouth and eyes. Ebola is not an airborne disease that is transmitted through sneezing and
coughing however large droplets from a person who is sick could be infectious.
Incubation Period of the Disease:
The time interval from infection with the virus to the onset of symptoms, better known as the
incubation period is 2–21 days. The average period is 8–10 days. Humans are not infections until
they develop symptoms. Ebola is an acute viral infection with a rapid onset, brief period of
symptoms and resolution within days.
Signs and

Ebola Hemorrhagic Fever
Ebola, once transmitted to a human is referred as Ebola hemorrhagic fever, is an uncommon viral
infection that deliberately targets every part of the human body with the exception of the skeletal
system. When this lethal disease enters the host, it will first cause pain throughout the body and
dramatically increase the body's temperature. Next, internal and external bleeding tends to occur,
specifically form the face. After that, it will simply destroy the bodily tissue that holds the host's
organs together. Aside from this, what the virus actually does and how it is transmitted, little to
nothing is known due to the complex structure of the infectious disease, as there are five identified
Ebola virus species. Four of the five affect humans ... Show more content on Helpwriting.net ...
However, that is more than likely the reason they are having these outbreaks. The use proper
technology plays a key role in containing and ending of the any disease and since these areas lack
severely in these field it males for the perfect breeding ground for terribly disease, such as Ebola.
This will ultimately stunt the technological grow of countries that have been heavily hit with the
epidemic. Also, the lack of general medical knowledge, such as common hygiene, in these states
only severed as a catalyst for the virus to spread. Another factor for those lives in these palaces is
that unless one live in close proximity to his or her family the chances that they will be able to see
one another are very slim. These restrains have lead to geographical issues as well. For instance, the
land in each of the differences areas must be used year–round for corps as farmers are restricted to
their own district to grow crop. This as resulted in some farmer having been forced to over use their
land and not allow for proper crop rotations as well trying hard to grow certain heathery crops in
more harsh

Ebola Research Paper
The current Ebola virus breakout that is pervading West Africa and that recently surfaced in the
United States represents one of the largest viral pandemics known to date. Within three months, the
breakout set the record as the widest sweeping and most fatal of any known Ebola pandemic ("Ebola
Outbreak Sets Sobering Record" 1432). To date, there is no known cure or vaccination that has been
proven to treat the virus. Furthermore, the current regions of West Africa facing the brunt of the
outbreak are ill–equipped to face such a widespread and immersing plague. Despite the extensive
response from the global network, which has ranged anywhere from increases in aid workers and
medical supplies to heightened research and testing, the Ebola outbreak ... Show more content on
Helpwriting.net ...
Teams from the Centers for Disease Control and Prevention (CDC), in coordination with a response
by the Global Outbreak Alert and Response Network, also traveled to the affected regions following
the initial discovery to contribute to the cause (Dixon and Schafer, 548). Director–general of the
World Health Organization, Dr. Margaret Chan, has largely led the coordination of the global
response to the outbreak in Africa. On March 30, a little over a week following the initial detection
of the virus in Guinea, the organization dispatched an estimated 3.5 tons of infection management
supplies and resources to Conakry for distribution to other health facilities in the area. The WHO
also deployed over 50 staff members to support the affected regions ("Public Health Round–Up"
313). The organization further helped by launching a regional control center in Conakry ("Ebola
Control Centre" 549). Under the direction of the WHO, Ebola cases were initially analyzed, tested,
and confirmed by the Institut Pasteur located in both France and Senegal, in addition to the
Bernhard Nocht Institute of Tropical Medicine in Germany. When the Ebola virus continued to
inflict countless casualties, testing trials were further performed by teams of Pasteur Institute

Essay about Ebola Hemorrhagic Fever
Ebola Hemorrhagic Fever
Ebola hemorrhagic fever (Ebola HF) is a severe, often–fatal disease in humans and nonhuman
primates (monkeys and chimpanzees) that has appeared sporadically since its initial recognition in
1976.
The disease is caused by infection with Ebola virus, named after a river in the Democratic Republic
of the Congo (formerly Zaire) in Africa, where it was first recognized. The virus is one of two
members of a family of RNA viruses called the Filoviridae. Three of the four subtypes of Ebola
virus identified so far have caused disease in humans: Ebola–Zaire, Ebola–Sudan, and
Ebola–Ivory Coast. The fourth, Ebola–Reston, has caused disease in nonhuman primates, but not in
humans.
Where is Ebola virus ... Show more content on Helpwriting.net ...
Ebola HF typically appears in sporadic outbreaks, usually spread within a health–care setting (a
situation known as amplification). It is likely that sporadic, isolated cases occur as well, but go
unrecognized.
How is Ebola virus spread?
Infection with Ebola virus in humans is incidental –– humans do not "carry" the virus. Because the
natural reservoir of the virus is unknown, the manner in which the virus first appears in a human at
the start of an outbreak has not been determined. However, researchers have hypothesized that the
first patient becomes infected through contact with an infected animal. After the first case–patient in
an outbreak setting (often called the index case) is infected, the virus can be transmitted in several
ways. People can be exposed to Ebola virus from direct contact with the blood and/or secretions of
an infected person. This is why the virus has often been spread through the families and friends of
infected persons: in the course of feeding, holding, or otherwise caring for them, family members
and friends would come into close contact with such secretions. People can also be exposed to Ebola
virus through contact with objects, such as needles, that have been contaminated with

I think that Ebola is one of the worst diseases of all time. Ebola is responsible for hundreds of
thousands of deaths. That is why I think Ebola is one of the absolute worst diseases of all time.
Ebola was first identified in 1976. It first appeared in central Africa. Ebola then died off then it
somehow returned in 1989 in the town of Yambuku. Since then there has been separate occurrences
of Ebola min many other places. Humans and guinea pigs and humans were first vaccine. The
guinea pigs were injected with Ebola, and then were vaccinated to see if the vaccine worked. Not
surprising the guinea pigs were first thing tested on. The people that were first vaccinated were as
followed, Nancy Sullivan, Anthony Sanchez, Pierre E. Rollin, Zhi–Yong ... Show more content on
Helpwriting.net ...
Ebola is almost both bacterial and viral, but it is mostly a viral disease. In the early two thousands a
group of security let a young nurse infected with Ebola on a plane to America which led to America
with Ebola on our hands. The nurse and the people that she infected were put in complete isolation
in a Texas motel. The motel had plastic wrapped around it so that the disease could not get out and
harm people. The infected people were isolated in the area for twenty one days before they were let
go, turns out that only 2 were infected. There are many ways that Ebola can spread, including blood,
saliva, and all other bodily fluids. There were not as many drugs or treatments for the Ebola virus
when it first arrived. The very few ways to try to control it are, an IV, making sure that blood
pressure stays normal, and treat all other infections with antibiotics, aspirin, Tylenol, and
prescriptions. Also a few fun facts about Ebola that I think people should know. Ebola is formally
known as Ebola hemorrhagic fever. Ebola is not airborne, or water borne, it is transmitted. Ebola is
treated by keeping bodily fluids maintained and under

Ebola is a rare but deadly virus that causes bleeding inside and outside the body. In 1976, Ebola was
first spotted in Sudan and Zaire. The first outbreak of Ebola infected over 284 people. A few months
later, the second Ebola virus was found in patients from Yambuku, Zaire, Ebola–Zaire (EBOZ),
which infected 318 people. Despite the tremendous effort of experienced and dedicated researchers,
Ebola's natural reservoir was never identified. The third strain of Ebola, Ebola Reston (EBOR), was
first identified in 1989 when infected monkeys were imported into Reston, Virginia, from Mindanao
in the Philippines. Fortunately, the few people who were infected with EBOR (seroconverted) never
developed Ebola hemorrhagic fever (EHF). The last known strain ... Show more content on
Helpwriting.net ...
At first it may be hard to differiantie beteen Ebola and many other diseases. Early symptoms of
Ebola are similar to influenza, malaria, typhoid fever, fulminant hepatitis, sepsis, nontyphoidal
salmonellosis, and various forms of encephalitis, dengue fever, yellow fever, Lassa fever, Marburg,
and other hemorrhagic diseases. Since it is quite difficult to diagnosis Ebola the only way to
correctly diagnosis is to have laboratory confirmation of Ebola virus. Usually symptoms of Ebola is
sudden, with patients showing symptoms within 5 to 12 days Early symptoms can include acute
fever, chills, myalgia, head– ache, arthralgia, and anorexia. Nausea, vomiting, abdominal pain,
hypotension, tachypnea, relative bradycardia, conjunctivitis, conjunctival injection, pharyngitis, and
diarrhea, which may be bloody, are other evolving signs. Cutaneous flushing or rashes are also
common (World Health Organization 1997). Many women infected with Ebola decide to get
abortions because the virus can be passed down to the child. During the later stage of Ebola the
illness may become a hemorrhagic issue that consists of epistaxis, hematuria, hematemesis,
petechiae, melena, and mucous membrane and conjunctival hemorrhage (World Health Organization
1997). Hemorrhaging usually occurs from the gastrointestinal tract, lungs, and gingiva. Patients who
have a strong immune system, their body response to the virus will begin in 7 to 10 days and start a
period of slow recovery involving complications such as weakness, fatigue, hepatitis, uveitis, and
other clinical sequelae (Borio and others 2002). Patients who do not improve by the 1st week
usually experience multiorgan failure and die from hypovolemic shock, with or without blood loss
(World Health Organization

The World's Fight Against Microbes Essay
The World's Fight Against Microbes
Many infectious diseases that were nearly eradicated from the industrialized world, and newly
emerging diseases are now breaking out all over the world due to the misuse of medicines, such as
antibiotics and antivirals, the destruction of our environment, and shortsighted political action and/or
inaction. Viral hemorrhagic fevers are a group of diseases caused by viruses from four distinct
families of viruses: filoviruses, arenaviruses, flaviviruses, and bunyaviruses. The usual hosts for
most of these viruses are rodents or arthropods, and in some viruses, such as the Ebola virus, the
natural host is not known. All forms of viral hemorrhagic fever begin with fever and muscle ... Show
more content on Helpwriting.net ...
The patient develops chills, fever, headaches, muscle aches, and a loss of appetite. As the disease
progresses vomiting, diarrhea, abdominal pain, sore throat, and chest pain can occur. The blood fails
to clot and patients may bleed from injection sites as well as into the gastrointestinal tract, skin, and
internal organs (CDC I).
The Ebola virus is spread through close personal contact with a person who is very ill with the
disease, such as hospital care workers and family members. Transmisson of the virus can also occur
from the reuse of hypodermic needles in the treatment of patients. This practice is common in
developing countries where the health care system is underfinanced (CDC I).
Until recently, only three outbreaks of Ebola among people had been reported. The first two
outbreaks occurred in 1976. One was in western Sudan, and the other in Zaire. These outbreaks were
very large and resulted in more than 550 total cases and 340 deaths. The third outbreak occurred in
Sudan in
1979. It was smaller with only 34 cases and 22 deaths. Three additional outbreaks were identified
and reported between 1994 and 1996: a large outbreak in Kikwit, Zaire with 316 cases and 244
deaths; and two smaller outbreaks in the
Ivory Coast and Gabon. Each one of these outbreaks occurred under the challenging conditions of
the developing world. These conditions including a lack of adequate medical

Viral Hemorrhagic Fever and Ebola Virus Species
What is Ebola hemorrhagic fever? Ebola hemorrhagic fever (Ebola HF) is a severe, often–fatal
disease in humans and nonhuman primates (monkeys, gorillas, and chimpanzees) that has appeared
sporadically since its initial recognition in 1976. The disease is caused by infection with Ebola virus,
named after a river in the Democratic Republic of the Congo (formerly Zaire) in Africa, where it
was first recognized. The virus is one of two members of a family of RNA viruses called the
Filoviridae. There are five identified subtypes of Ebola virus. Four of the five have caused disease in
humans: Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast and Ebola–Bundibugyo. The fifth, Ebola–
Reston, has caused disease in nonhuman primates, but not in humans. ... Show more content on
Helpwriting.net ...
Persons tested later in the course of the disease or after recovery can be tested for IgM and IgG
antibodies; the disease can also be diagnosed retrospectively in deceased patients by using
immunohistochemistry testing, virus isolation, or PCR.
How is Ebola hemorrhagic fever treated?
There is no standard treatment for Ebola HF. Patients receive supportive therapy. This consists of
balancing the patient's fluids and electrolytes, maintaining their oxygen status and blood pressure,
and treating them for any complicating infections.
How is Ebola hemorrhagic fever prevented?
The prevention of Ebola HF in Africa presents many challenges. Because the identity and location
of the natural reservoir of Ebola virus are unknown, there are few established primary prevention
measures.
If cases of the disease do appear, current social and economic conditions often favor the spread of an
epidemic within health–care facilities. Therefore, health–care providers must be able to recognize a
case of Ebola HF should one appear. They must also have the capability to perform diagnostic tests
and be ready to employ practical viral hemorrhagic fever isolation precautions, or barrier nursing
techniques. These techniques include the wearing of protective clothing, such as masks, gloves,
gowns, and goggles; the use of infection–control measures, including complete equipment
sterilization; and the isolation of Ebola HF patients from contact with unprotected

Ebola is the better–known member of a small family of viruses known as Filoviridae. The other
lesser–known member is Marburg. The Ebola virus has five known subtypes, four of which are
highly pathogenic to humans. The fifth, Ebola Reston Virus was first isolated in a group of primates
that had been imported from the Philippines to a research laboratory in Reston, Virginia. According
to the Centers for Disease Control and Prevention, within weeks, the same virus was isolated during
similar outbreaks in labs in Pennsylvania, Texas and Siena, Italy. In each case, the affected animals
had been imported from a facility in the Philippines. (CDC, 2008) The four species that are
pathogenic to humans are Zaire, Sudan, Tai Forest and Bundibugyo. ... Show more content on
Helpwriting.net ...
After confirmation of samples tested by the United States National Reference Laboratories and the
CDC, the World Health Organization confirmed the presence of a new species. An epidemiological
study conducted by WHO and Uganda Ministry of Health scientists determined there were 116
confirmed and probable cases of the new Ebola species, and that the outbreak had a mortality rate of
34% (39 deaths). In 2012, there was an outbreak of Bundibugyo ebolavirus in a northeastern
province of the Democratic Republic of the Congo (DR Congo). There were 15 confirmed cases and
ten fatalities. (Wamala, 2010)
HISTORY
Many medical researchers speculate the Plague of Athens, which wiped out about a third of its
inhabitants during the Peloponnesian War, may have been caused by Ebola. As noted earlier, the
Ebola virus was first isolated in 1976 during an outbreak of the disease along the border of Zaire and
Sudan. (CDC, 2014) Of all the outbreaks since 1976 this initial outbreak carried the worst mortality
rate, roughly ninety percent of those affected did not survive. (CDC, 2014) Ebola was named after a
river in the Yambuku district of Democratic Republic of the Congo, which was then known as Zaire.
2007 to

The Ebola Virus Essay
In the year 1976, Ebola climbed out of its unknown hiding place, and caused the death of 340
people. Fear gripped the victims' faces, and uncertainty tortured their minds. The people of Zaire
waited outside clinics, churches and in their homes for a treatment of the horrible disease, but there
was no cure. They were forced to watch people die, hoping that they would be saved from the
violent death of the Ebola virus. From the year of 1976 to the present date of 1996, researchers have
searched for origin and cure of the virus. Scientist have carried out numerous studies and
investigations, but no one has been able to find the right explanations.
Prevention of a world wide outbreak lies within the education of what the virus is capable of ...
Show more content on Helpwriting.net ...
Ebola can spread by the reuse of hypodermic needles, which occurs frequently in underdeveloped
countries like Zaire and Sudan, but it is unlikely to become infected by close contact with persons
infected who show no symptoms. The Ebola virus spreads through the blood and is replicated in
organs, including the liver, lymphatic organs, and kidneys. The central lesions appear to be those
affecting the vascular endothelium and the platelets.
The resulting symptoms are bleeding, especially in the nose, abdomen, and pericardium. Capillary
leakage appears to lead to loss of intravascular volume, bleeding, shock and the acute respiratory
disorder seen in fatal cases. Patients basically die of intractable shock. Those with severe illness
often have fevers and are delirious, combative and difficult to control.Some victims of the Ebola
virus, one out of ten people infected, survive the virus's deadly operations. Due to its self–limiting
nature, the Ebola virus is known to sometimes die out within a person before killing the host
organism. Just like the history of wars and other social epidemics, the Ebola outbreaks need to be
remembered and learned from.
The first two Ebola outbreaks were in 1976, in the countries of Zaire and western Sudan. These were
large outbreaks, resulting in more than 550 cases and 340 deaths. In 1979, Ebola mysteriously
appeared in

Ebola Virus Research Paper
NAME: DANIEL DANAE
STUDENT NUMBER: 101420/1419102
MAJOR: LIFE SCIENCES (BIOMEDICAL SCIENCE) COURSE: MICROBIOLOGY
TOPIC: MECHANISM OF TRANSMISSION OF INFECTIOUS DISEASES (EBOLA VIRUS
DISEASE)
INTRODUCTION:
A disease is a change of functioning in the body that makes it not to function properly. It is a
disorder in the normal function of the body. There are different types of diseases such as Ebola virus
disease, cholera as well as other types.
Infection is the incursion of a microorganism to a cell or a body to cause harm or disable the body
from functioning properly. Infectious diseases are disorders from microorganisms such as bacteria
and pathogens that can be harmful to the human health that can be passed from one person to
another through ... Show more content on Helpwriting.net ...
FAVIPIRAVIR: Currently, neither a vaccine nor an effective antiviral treatment is available for use
in humans. The efficacy of pyrazine carboxamides derivative T–705(favipiravir) against Zaire Ebola
virus (EBOV) in vitro and in vivo (Oestereich et al., 2014). Its other name is Avigan which is an
experimental antiviral drug for the treatment of many RNA viruses such as yellow fever virus and
west Nile virus.
3. BRINCIDOFOVIR: Brincidofovir is an oral antiviral drug being developed as a potential
prevention or treatment for life–threatening viral diseases. It works by keeping viruses from creating
additional copies of themselves. Patients in the United States have been treated with Brincidofovir
for Ebola virus disease at the request of treating physicians (Bolt and Garza, 2014). Emergency
investigational new drugs applications have been approved by the United States food and drug
administration for the use of brincidofovir in patients with confirmed Ebola Disease.
Others include Triazavirin which is used for the treatment of Lassa fever and influenza, TKM–
EBOLA, BCX4430 and the ReEBOV test that is conducted on suspected patients to know the
viability of the virus in the blood stream. However, other experimental vaccines are still undergoing
medical procedures and testing.
PREVENTIVE MEASURES OF EBOLA VIRUS

The Social Inequalities And The Biosocial Ecology
Viral hemorrhagic fevers (VHFs) are found around the world that is one group of illness caused by
virus of five distinct families: Arenaviridae, Bunyaviridae, Filoviridae, Flaviviridae, and
Paramyxoviridae (Center for Disease Control and Prevention, 2013). These include the Ebola and
Marburg, Lassa fever, and yellow fever virus (U.S National Library of Medicine, 2016). Garrett
point out that less than a decade ago, one of the biggest problem in the world was the lack of
resources available to combat the multiple scourges ravaging the world's poor and sick. (Garrett, p.
171). Today, thanks to private donations, more money is being assigned toward pressing health
challenges. But because the efforts of this money is paying for a largely uncoordinated and directed
mostly at specific high profile diseases resulting a problem because the world is poised to spend
enormous resources to conquer the diseases of the poor (Garrett, p. 171). This paper will discuss the
epidemiology of VHFs., the social inequalities and the biosocial ecology. The five families of
viruses that cause viral hemorrhagic fever are most found over the world. The Arenaviridae are a
family of virus whose members are generally associated with rodent– transmitted disease in humans
causing severe illnesses (Center for Disease Control and Prevention, 2013). Flaviviridae are a family
of positive, single stranded, enveloped RNA virus. They are found in arthropods, primarily ticks and
mosquitoes, and can infect

A Short History Of Disease Chapter Summary
As the second part of this reflection paper, I selected a book 'A Short History of Disease' by Sean
Martin. He is a writer and filmmaker also known for his other famous books like The Knights
Templar, Alchemy and alchemists, the Gnostics. His films include Lanterna Magicka: Bill Douglas
& the secret history of cinema. The most alluring thing which conceives me to cull this book is a
history of the disease, as a medical professional, it's always tantalizing to know from where all these
begins and this book reaches up to my expectations as it started from the first ever recorded disease
in the history of mankind. He isn't lying when he say this a history of the disease. He starts from the
earliest bacteria to evolve on the earth, long before there was anything around to infect. This book is
divided into seven chapters, each chapter describes the history of diseases in a particular era.
Chapter One: Prehistory, Chapter Two: Antiquity, Chapter Three: The Dark and Middle Ages,
Chapter Four: The New World, Chapter ... Show more content on Helpwriting.net ...
Smallpox believed to be brought by a Portuguese explorer in 1506 who also bring tuberculosis. This
disease brings to America by African slaves which kill more than half of the population of Indians,
from there this disease spread to Mexico, Colombia, Cuba, Peru, Puerto Rico, Venezuela, and
Yucatan. In the 17th century, this disease spread to North America killing large numbers of people.
Great pox which is known as syphilis nowadays is another disease after smallpox which dominates
this era. This disease is supposed to be traveled with a crew of Columbus who introduce this disease
in Europe. This disease traveled to India with Vasco de Gama who also introduce the world with a
new type of skin disease which is known as scurvy. Another disease which shows its glimpse is
epilepsy. Arabs consider it as 'divine disease' and Babylonian consider it was caused by 'touch of

The Ebola Virus In Today's Society
IEbola is one of the most common viruses that is highly contagious and it is still a major threat in
today's society. Ebola was one of the extremely deadly viruses that was first found in Africa. It took
hundreds of lives when the victims was left disoriented, exhausted, and collapsed in a fever. The
Ebola virus is well known that causes hemorrhagic fever in humans, which is distinguished by
massive bleeding in internal and external and destruction of internal tissues and organs. People were
lying on their deathbed, craving and sobbing for a miracle to happen, but eventually their bodies
were slowly lead into the grave in peace. In this essay, it will contain information on the following
questions: What is Ebola and what causes it? What are ... Show more content on Helpwriting.net ...
The virus is covered by a diameter enveloped in a cell ,which is about 80nm and the size can expand
to about 100nm x 300–1500nm. The virus has a variety of structures such as a branch–shaped, U–
shaped, ring–shaped or 6–shaped.The membrane contains a long spike that is formed with a helical
ribosome and has four structural proteins in the virion. Ebola from different countries has diverse
biological characteristics. The nucleocapsid protein in virus particles derives from the center of the
spiral winding structure in genomic RNA. The viral protein score–shell protein contains the virus
glycoprotein depth from the surface of virus particles, its 10nm long. The other 10nm set out to
highlight the membrane surface, and the layer of the host cell membrane is from the region between
the mantle and the nucleocapsid protein,which is called

Essay on The Marburg Hemorrhagic Fever Description
According to the World Health Organization (WHO), the Marburg Virus, or the Marburg
hemorrhagic fever (MHF), is a very deadly virus. It has a fatality rate anywhere from 24% all the
way up to 88% if an outbreak occurs. The Marburg virus takes its name from Marburg, Germany;
which is the place where it was initially detected in the year of our Lord 1967. There were other
outbreaks of this virus in Frankfurt, Germany and also in Belgrade, Serbia. The main carrier of this
virus is believed to be the rousettus aegypti, or fruit bat. Once a human has come into contact with
this virus it is easily spread among other humans. Most notably through through bodily fluids
exchanged through sexual intercourse or when coming into contact with the ... Show more content
on Helpwriting.net ...
The areas where bleeding can start are the intravenous areas. This can be very problematic as a
patient will continue to bleed when being given fluids through an IV. You can bleed from the nose,
and the gums around your teeth. In females bleeding can also occur from the vagina. During this
extreme phase of the virus, the patient will continue to have a high fever. This can result in the
patient becoming confused, easily frustrated and quick to anger. Once this high fever has set in,
males can suffer from a symptom called orchitis; which the inflammation of one or both of the
testicles. Death usually happens around the eighth or ninth day after the first of the symptoms,
usually due to severe blood loss and shock.
Often times the Marburg Virus can be misdiagnosed with as other illnesses such as: malaria, typhoid
fever, shigellosis, cholera, leptospirosis, plague, rickettsiosis, relapsing fever, meningitis, hepatitis
and other viral haemorrhagic fevers. The Marburg virus can only be diagnosed definitively by a
laboratory using the the following tests: enzyme–linked immunosorbent assay (ELISA), antigen
detection tests serum neutralization test, reverse–transcriptase polymerase chain reaction (RT–PCR)
assay, and a virus isolation by cell culture. Because of the severity of this virus tests are sent to
laboratories that have only the highest of biological agent protection. There is currently no treatment
or vaccine for the Marburg

What´s The Ebola Virus?
Ebola is defined as a virus that causes severe bleeding, organ failure, and can lead to death (Mayo
Clinic). Ebola was first discovered in 1976 near the Ebola River in the Democratic Republic of the
Congo (CDC). It was previously known as Ebola Hemorrhagic Fever and is a very rare and deadly
disease caused by infection with a strain of the Ebola virus (CDC). The Ebola virus has a 50% to
90% fatality rate (Visual Science Company). In 2014, there were only 6 cases in the U.S (Mayo
Clinic). It is most common in African countries and appears sporadically. The disease can occur in
humans and nonhuman mammals, such as monkeys, bats, and apes (CDC). There are five different
identified species of the Ebola virus and all belong to the genus Ebolavirus. Four of the species are
known to cause disease in humans: Ebolavirus zaire; Ebolavirus sudan; Ebolavirus taī forest; and
Ebolavirus bundibugyo. The fifth virus, Ebolavirus reston, has only infected ... Show more content
on Helpwriting.net ...
Early symptoms are headache, fever, muscle pain, weakness, fatigue, diarrhea, and abdominal pain
(CDC). As the illness progresses, Ebola can cause multiple organ failures, severe bleeding, seizures,
coma, jaundice (yellowing of the skin), delirium (intoxicated state of mind),and shock (Mayo
Clinic). Ebola can lead to death for a high percentage of people who are infected. One reason that
the virus is so deadly is because it interferes with the immune system's ability to mount a defense
(CDC). Scientists can't wrap their heads around the fact that some people recover and others don't.
For those who survive, recovery is slow. It may take months to regain weight and strength, and the
virus remains in the body for weeks (CDC). People may experience hair loss, sensory changes, liver
inflammation (hepatitis), weakness, fatigue, headaches, eye inflammation, and testicular
inflammation (Mayo

Emerging Infectious Diseases Essay
Emerging Infectious Diseases
Emerging infectious diseases (EIDs) are the third leading cause of death in the United States and the
first leading cause of death worldwide (3). Thus, should EID's be considered an oncoming threat to
human existence or is it God's response to our unbiblical stewardship of the Earth or is it nature's
practical solution to overpopulation.
Past EIDs
Since the beginning of time, human existence has been overwhelmed by threatening diseases. To
begin with, leprosy and other highly contagious skin diseases affected humanity as early as in the
days of the Old Testament. Due to its rapidly infectious manner and its degrading and dehumanizing
results, skin–diseased victims were often ostracized ... Show more content on Helpwriting.net ...
In 1994, Gloucestershire, England was assailed by the infamous and unstoppable "flesh–eating
bacteria" or Necrotizing Fasciitis, which virtually devoured its victims to death (2). In March of
1996, 2.6 million cows were slaughtered in the United Kingdom in an effort to rid themselves of the
invasion of the Mad Cow disease. Another term for Mad Cow disease is Bovine Spongiform
Encephalopathy (BSE), which is a disease observed solely in cattle. Mad Cow disease or BSE is
transmitted to humans via the consumption of infected beef resulting in a fatal human brain disorder
known as Creutzfeldt–Jacob (CJD). As a result of this "British beef scare" 32 people died of CJD, of
whose deaths were linked to Mad Cow disease (10.e). Similarly, 1 million chickens were gassed to
death in Hong Kong in 1997 in order to prevent the already undertaking spread of Influenza A
(H5N1) or "Bird Flu". The worst Influenza A epidemic occurred in the United States killing 20
million people in 1918 (10.b). In New York last month, five people died of a rare encephalitis
disease caused by a West Nile–like virus, which is believed to have been transmitted from birds,
who researchers found to have died from the West Nile virus (8). Finally, and probably the most
menacing disease ever in human history would have to be HIV and AIDS, which is still infecting the
human population worldwide in gross amounts.

Informative Speech Outline On Ebola
Ashton Nicholas
SPC 205
Informative Speech Outline
Ebola Virus
General Purpose: To inform.
Specific Purpose: To explain to my audience research and facts about what Ebola is, what the
symptoms and treatments are, how Ebola is spread, and where Ebola is in the world today.
Central Idea: Research is helping us to discover and learn all the facts about Ebola.
Introduction
I. Attention–Getter: Over 2,000 people have died since the first discovery of Ebola.
II. Other: According to Wen Zhiyuan, the Ebola Virus causes a fatality rate of up to 90%. (Verbal
Citation)
III. Central Idea: Research today is helping us to discover and learn more about the Ebola Virus.
IV. Credibility: In preparation for this speech, I have read four articles to ... Show more content on
Helpwriting.net ...
As of right now, patients are being given fluids, antibiotics, and blood transfusions to help increase
their immune system.
E. The World Health Organization, or WHO, said that although half of the people infected have
died, those that have survived carry blood that is in demand. (Verbal Citation)
1. The blood contains antibodies that have already fought off the virus.
(Internal Transition: Since we know that the virus is not highly contagious, let's see how the virus
can be contracted.
III. Because Ebola is not highly contagious, we should know how the virus is spread.
A. It is believed that fruit bats may be the natural host of the virus in Africa.
B. The virus was passed from the bat to other animals.
C. Humans contract the virus through contact with bodily fluids of infected animals or infected
humans.
(Internal Transition: Now that we know what Ebola is, let's finally look at where the virus is in the
world.
IV. The Ebola Virus, today, is worldwide.
A. In the article by Susannah Cullinane it is said that there have been more than 3,000 cases of the
virus and more than 2,000 deaths since 1976. (Verbal Citation)
B. The region of Gue´cke´dou in Guinea is where the virus started in its recent

A Brief Note On Lujo Hemorrhagic Fever
Lujo Hemorrhagic Fever is caused by a bi–segmented negative RNA virus that is one of the several
viruses known to cause viral hemorrhagic fever. The Lujo virus is part of the Arenaviridae family,
that consist of several viruses categorized into two primary groups. The Lujo virus is categorized in
the "Old World" group, which signifies that the virus in question was discovered in the Eastern
Hemisphere, specifically in Africa. The majority of the arenaviruses that are categorized in the "Old
World" group do not cause severe illness, with the exception of a few including the Lassa and Lujo
virus. As of 2012, the Lujo virus is classified as a select agent as it is distinguished to possess the
potential to severely threaten the US public's health and safety when the mortality rate and modes of
transmission is taken into consideration.
Lujo Hemorrhagic Fever at the time being has been reported in five patients, in the time span
ranging from September to October in 2008. The cases originated in Southern Africa, in the cities of
Lusaka and Johannesburg. The cities are the basis for the naming of the virus; the first two letters of
both cities were utilized to name the virus. The first patient, a 36–year–old female in Lusaka was
reported to be infected with the Lujo virus prior to September 2nd. Symptoms manifested on said
day, and the patient was admitted to a clinic on the sixth day of the illness; Patient one expired on
illness day 10. No source of infection was determined,

Ebola Virus Disease And Its Effects
Ebola Virus Disease is often referred to as a virus that causes severe bleeding, organ failure, and can
lead to death. It was formally known as Ebola hemorrhagic fever. Ebola can cause disease in
humans and also in non–human species, such as monkeys, gorillas, and chimpanzees. Altogether,
information about Ebola Virus Disease will include: the background, transmission, symptoms and
diagnosis, and treatment and prevention.
Ebola Virus Disease was given it 's name from the Ebola River in the Democratic Republic of the
Congo. The disease first appeared in 1976 in two outbreaks occurring simultaneously. One occurred
in South Sudan and the other in the Democratic Republic of the Congo. In the Democratic Republic
of Congo it took place in a village near the Ebola River, hence its name. The most current outbreak
in occurring in West Africa. Reports say that it is the most complex and largest outbreak since it first
appeared. This current outbreak of the Ebola Virus Disease has had more deaths than all other
appearances of the disease combined. The most effected countries include Guinea, Liberia and
Sierra Leone. These countries have weakened health systems and very limited resources. With
limited resources it makes it extremely difficult to stop the spread of such diseases. Therefore, Ebola
appears in mainly in underdeveloped counties with limited resources and weak health systems.
The transmission of the Ebola Virus Disease occurs in many different ways. Transmission of

The Ebola Virus Essay
Disease name Ebola hemorrhagic fever (Ebola HF)
Four identified subtypes of Ebola: (4)
· Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast (cause disease in humans)
· Ebola–Reston (cause disease in non–human primates only) Means of Transmission Person–to–
person transmission
Direct contact of blood, secretions, semen, vomit, diarrhea (1) or organs of infected person
Sexually transmitted – "Transmission through semen may occur up to 7 weeks after clinical
recovery, as with Marburg haemorrhagic fever." (2)
Direct contact of deceased body at burial ceremonies (3)
Indirect Contact: touching contaminated objects such as needles
Aerosol transmission:
"Not implicated in human outbreaks, although transmission in ... Show more content on
Helpwriting.net ...
They, like humans, are believed to be infected directly from the natural reservoir or through a chain
of transmission from the natural reservoir." (3) Etiological agent: Filoviridae
"Together with Marburg virus, Ebola makes up the family Filoviridae, of the order Mononegavirales
( the non–segmented, negative–sense, single–stranded RNA viruses" (5)
Four identified subtypes of Ebola: (4)
· Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast (cause disease in humans)
· Ebola–Reston (cause disease in non–human primates only) General Characteristics: Appearance:
thin and filamentous; comma shaped or branched (1)
"Both Ebola and Lassa virus exhibit the following characteristics: (5)
· insensitivity to antiviral effects of INF
· dominant role of cellular immunity in recovery
· highly glycosylated proteins affecting immune recognition
· moderate cytopathic effects after isolation in mammalian cell culture
· proclivity for infecting macrophages
· immunosuppressive effects following infection

The Ebola Virus: History, Occurrences, and Effects Essay
"The only sound is a choking in his throat as he continues to vomit while unconscious. Then comes
a sound like a bed sheet being torn in half, which is the sound of his bowels opening at the sphincter
and venting blood. The blood is mixed with his intestinal lining. He has sloughed off his gut. The
lining of his intestines have come off and are being expelled along with huge amounts of blood"
(Preston 17).
Ebola, a virus which acquires its name from the Ebola River (located in Zaire, Africa), first emerged
in September 1976, when it erupted simultaneously in 55 villages near the headwaters of the river. It
seemed to come out of nowhere, and resulted in the deaths of nine out of every ten victims.
Although it originated over 20 years ... Show more content on Helpwriting.net ...
Because Ebola was unknown and never seen before, doctors and citizens in Ebola–infected cities
did not know what kind of precautions to take when handling an Ebola–exposed person. As a direct
effect to this, the virus spread tremendously fast through the city of Zaire, and eventually spread to
many other countries due to the lack of knowledge of the infectious disease. Hospital workers
dealing with Ebola–exposed patients took few precautions when handling blood and test tubes.
Family members held funerals to those who died from the virus, which spread the disease among the
family members. In fact, an article was published in the Houston Chronicle on October 19, 2000,
stating that the 9 month child of Esther Awete, who died from infection of the Ebola virus, came
down with the infection himself, just days after attending her funeral. Her other son, however, did
not attend her funeral and ironically did not come down with Ebola. It is believed that if the virus
can find a host quickly, then it can still survive after it's previous host dies.
Ebola is classified as a type of viral hemorrhagic fever, filivirus. The natural host for Ebola is still
yet to be defined, but in most cases of a viral hemorrhagic fever, arthropods and rodents, such as
ticks and mosquitoes, are the common hosts.
Symptoms– there are 2 main

Essay about The Ebola Virus
"You have to admire its simplicity. It's one billionth our size and it's beating us." – – Spoken by
Colonel Sam Daniels, a character in the fictional movie about Ebola, Outbreak.
The Ebola virus is the most feared virus of our time. What exactly is Ebola? Ebola is a viral
hemorrhagic fever actually named after the River Ebola in Zaire, Africa, where it was first
discovered. It belongs to a genus of ribonucleic viruses called filoviruses, under the family
Filofiridae, which are characterized by their filament–like (thread–like) appearance with a little
hook or loop at the end. Only five viruses exist in this family: the not–as–deadly Marburg, and the
four Ebola strains: Ebola Zaire, Ebola Sudan, Ebola Tai and Ebola Reston. The latter ... Show more
content on Helpwriting.net ...
(Tables I and II)
The viruses in this family range from 800 to 1000 nanometers in length. Marburg and Ebola are
distinguished by their length after purification. Infectivity depends on particular lengths: the longer,
the more infectious. All Ebola viruses measure up to about the same length. Each virus particle
consists of a helical–coiled tube made of four virally encoded proteins. This strand of RNA is found
in an envelope formed from the host's plasma cell membrane, which is now spiked with another
carbohydrate–coated viral protein. Differences in gene sequence and very small differences in
serological nature are what make each Ebola virus unique from each other, with its own antigenic
and biological properties.
The time needed for Ebola virus replication in infected body cells takes less than eight hours.
Hundreds to thousands of new viral particles can be produced and released from the host cell within
days or even hours before the host cell dies. This replication process is repeated several times in an
Ebola patient before symptoms begin to show.
The diagnosis of Ebola is made by the detection of Ebola antibodies, antigens or genetic material, or
by the culture of the virus, in blood or other bodily fluid specimens that are examined in specialized
laboratory tests. Such tests present a very extreme biohazard, so they are conducted in special high–
containment laboratories to ensure maximum protection for scientists.

Course Project Paper: Ebola
Ebola virus disease (EVD), formerly known as the Ebola hemorrhagic fever, is a highly infectious,
deadly disease. Ebolavirus is from the virus family of Filoviridae, which also includes Cuevavirus
and Marburgvirus. Five species of Ebolavirus have been identified: Zaire, Bundibugyo, Sudan,
Reston, and Tai Forest.
The Ebola virus was first discovered in 1976 near the Ebola River, in what is now the Democratic
Republic of Congo, and is now currently found in many African countries. The first EVD outbreaks
occurred in small, remote villages in Central Africa near rainforests, but the recent 2014 outbreak
began in West Africa, involving more urban areas than before. The most severely affected countries
include Guinea, Liberia, and Sierra Leone, largely due to the fact that they lack strong health and
sanitation systems. The Zaire, Bundibugyo, and Sudan species, previously mentioned, have been
associated with the outbreaks in Africa. The recent 2014 outbreak belongs to the Zaire species.
In 2014, the largest Ebola epidemic in history affected multiple countries in West Africa. There were
also two imported cases, including one death, and two locally acquired cases in healthcare providers
reported in the United States. The epidemic was ... Show more content on Helpwriting.net ...
Within a few days after symptoms begin, the diagnostic tests that confirm Ebola virus infection are
the following: antigen–capture enzyme–linked immunosorbent assay (ELISA) testing, IgM ELISA,
polymerase chain reaction (PCR), electron microscopy and virus isolation by cell culture. Later in
the disease course, IgM and IgG antibody testing can be done. Retrospectively,
immunohistochemistry testing, PCR, and virus isolation can be done in deceased patients. During
laboratory test, samples are extreme biohazard risk and should be conducted under maximum
containment

Viruses Plague And History Book Review
Viruses, Plagues, and History, written by Michael Oldstone, is an insightful and highly educational
book that details the history of, that's right, viruses and plagues. Through typically dry, yet engaging
prose, Oldstone recounts what seems like all of it while simultaneously bringing to light the
contributions of those brave scientists who asked themselves, "why." He focuses his attention on
some of the most notable viruses such as smallpox, yellow fever, measles, polio, and later he
focuses on more contemporary battles against disease. Oldstone begins by explaining the study of
viruses, virology, and its importance in understanding diseases. In informing the reader of what the
study of viruses is, he establishes what variolation and immunization are and the role they play in
keeping the public safe from what can be very serious ailments. After explaining the study itself,
Oldstone ... Show more content on Helpwriting.net ...
After explaining the danger and lack of means to prevent the spread of these severe ailments,
Oldstone proceeds to go in depth about the aforementioned ailments. He begins with Lassa fever by
describing the name, and then describing a case in which the fever presented on several different
patients, effectively killing them in a very "The Last Stand" way. Oldstone repeats this in separate
chapters about Ebola and Hantavirus, HIV, and Mad Cow disease, highlighting the complexity of the
maladies of modern day and the effect they have on their

Outbreak of Ebola
Ebola was first recognized in 1976 as the cause of outbreaks of disease in the Democratic Republic
of the Congo (then known as Zaire) and in Sudan. About three hundred people in each of the two
nations were infected with the virus, resulting in a mortality rate of 88% in Zaire, and 53% in Sudan
(Bulletin of the WHO 1978). The disease as it was discovered spread through direct contact of
unmans to humans, and then thought, from non–human primates to humans. The epidemic was a
result of unsafe and unsanitary hospital practices, and non–sterilized medical equipment. The
disease was then contained, however sporadic outbreaks of the Zaire and Sudan Ebola subtypes
have risen in the Democratic Republic of the Congo, Gabon, Uganda, and Sudan; one of the latest
outbreaks was in the Democratic Republic of the Congo in September of 2007. Therefore we ask
ourselves, why is it important to discuss the Ebola virus? The answer is simple; because we need to
know how the disease infects humans, and how researchers and medical professionals can prevent
the virus from entering the organism. It is important to know that humans are not the host organism,
or Ebola's natural reservoir; humans simply become infected when they come in contact with the
infected host, such as non–human primate, pigs, or even insects. In 2005, it was reported that fruit
bats may serve as the natural reservoir of Ebola. Fruit bats live in regions of Africa that include
areas where Ebola outbreaks have occurred and

Ebola Virus Disease
Ebola Virus Disease
Richard Wakeland
St. Petersburg College
Ebola Virus Disease
Ebola virus disease (EVD) formerly known as Ebola hemorrhagic fever is an often fatal disease
caused by a virus. This virus can cause severe hemorrhagic fever in humans (Occupational Safety &
Health Administration [OSHA], N.D.). With world worldwide attention for its high mortality rate,
lack of effective treatment or vaccination EVD has become an important public health pathogen
(Feldmann & Geisbert, 2011).
Since 1976, there have been 26 outbreaks of EVD resulting in an estimated 18,000 cases that has led
to mortality rate of approximately 7100 individuals (Centers for Disease Control and Prevention
[CDC], 2014a). Cases of EVD have been sporadic and limited ... Show more content on
Helpwriting.net ...
(2014a). Outbreaks chronology: Ebola virus disease. Retrieved November 25, 2014, from
http://www.cdc.gov/vhf/ebola/outbreaks/history/chronology.html#modalIdString_outbreaks
Centers for Disease Control and Prevention. (2014b). Guidelines for Evaluation of US Patients
Suspected of Having Ebola Virus Disease. Retrieved November 27, 2014, from
http://emergency.cdc.gov/han/han00364.asp
Centers for Disease Control and Prevention. (2014c). Guidance on Personal Protective Equipment
To Be Used by Healthcare Workers During Management of Patients with Ebola Virus Disease in
U.S. Hospitals, Including Procedures for Putting On (Donning) and Removing (Doffing). Retrieved
November 27, 2014, from http://www.cdc.gov/vhf/ebola/hcp/procedures–for–ppe.html
Chertow, D., Kleine, C., Edwards, J., Scaini, R., Giuliani, R., & Sprecher, A. (2014). Ebola virus
disease in West Africa – Clinical manifestations and management. Retrieved November 25, 2014,
from http://www.nejm.org/doi/pdf/10.1056/NEJMp1413084
Dowell, S., Mukunu, R., Ksiazek, T., Khan, A., Rollins, P., & Peters, C. J. (1999). Transmission of
Ebola hemorrhagic fever: A study of risk factors in family members, Kikwit, Democratic Republic
of the Congo, 1995. The Journal of Infectious Diseases, 179(Supplement 1), S87–S91. Retrieved
from

Ebola Spread
Every time you turn on the news or pick up a newspaper, there is something being reported about
the spread of Ebola. The Ebola outbreaks occurring in Guinea, Sierra Leone and Liberia are growing
larger and larger. This is the largest outbreak with more cases and deaths since Ebola was first
discovered nearly four decades ago. United States doctors and missionaries have traveled to these
countries to help treat infected people. However, there have now been cases where U.S. citizens
have contracted the disease and have been brought back to the United States to be treated. This has
caused raised concerns about the disease spreading in the U.S. as well. The physical, cultural,
economic, political and religious geography of Africa have all played ... Show more content on
Helpwriting.net ...
Now that Ebola patients are being treated in the U.S. and missionary doctors are returning from
Africa, new procedures and guidelines are being developed.
Kaci Hickox is a nurse who recently returned to the U.S. from treating Ebola patients in Sierra
Leone. She was quarantined for 21 days because she had a slight fever, which is one of the
symptoms of Ebola. Ms. Hickox stated that she is "scared about how health care workers will be
treated at airports when they declare that they have been fighting Ebola in West Africa. I am scared
that, like me, they will arrive and see a frenzy of disorganization, fear and, most frightening,
quarantine." It is essential that we balance helping those in need in Africa with how we protect the
health and well being of those in

The Ebola Virus
The Ebola Virus
A virus is an ultramicroscopic infectious organism that, having no independent metabolic activity,
can replicate only within a cell of another host organism. A virus consists of a core of nucleic acid,
either RNA or DNA, surrounded by a coating of antigenic protein and sometimes a lipid layer
surrounds it as well. The virus provides the genetic code for replication, and the host cell provides
the necessary energy and raw materials. There are more than 200 viruses that are know to cause
disease in humans. The Ebola virus, which dates back to 1976, has four strains each from a different
geographic area, but all give their victims the same painful, often lethal symptoms. The Ebola virus
is a member of a family of ... Show more content on Helpwriting.net ...
Close contact and dirty needles spread the Ebola virus. The center of the epidemic in Zaire involved
a missionary hospital where they reused needles and syringes without sterilization. Most of the staff
of the hospital got sick and died. This outbreak infected 318 with a death rate of 93% (Le
Guenno et al. 1271). Another fatal case was reported one year later in Zaire but nothing major ever
became of it. The most recent case recorded was the infamous breakout in Kikwit, Zaire. This
breakout had the world in an uproar about the possibility of this virus spreading out globally. This
outbreak appeared to have started with a patient who had surgery in Kikwit on April 10,
1995. Members of the surgical team then developed symptoms similar to those of a viral
hemorrhagic fever disease (Ebola Info. from the CDC 2). From there, the disease spread to more
than 300 others. The most frequent symptoms at the onset were fever (94%), diarrhea (80%), and
server weakness (74%); other symptoms included dysphagia (41%) and hiccups (15%). Clinical
signs of bleeding occurred in 38% of cases (JAMA 274: 373). The World Heath Organization
declared on
August 24, 1995 that the outbreak of Ebola Zaire in Kikwit was officially over after killing 244 of
its 315 known victims ("Ebola Outbreak Officially Over" 1).
This outbreak had a rate of death over 75%. Ebola Sudan also occurred in 1976 about the same time
as Ebola Zaire.
The number of cases was 284 with a death rate of 53% (Le

Ebola Essay
Ebola Impact on Human Health & Hygiene Essay
Historically Ebola has had a serious impact on human health and hygiene and still does due to the
fact of no vaccine or treatment being discovered, but thanks to improvements in scientific and
medical knowledge the virus itself is now controllable.
Ebola is the virus Ebolavirus (EBOV), a viral genus, and the disease Ebola hemorrhagic fever
(EHF), a viral hemorrhagic fever (VHF). The virus is named after the Ebola River Valley in the
Democratic Republic of the Congo (formerly Zaire), which is near the site of the first recognized
outbreak in 1976 at a mission hospital run by Flemish nuns. It has remained largely obscure until
1989 when several widely publicized outbreaks occurred among ... Show more content on
Helpwriting.net ...
In 2003 a vaccine using an adenoviral vector carrying the Ebola spike protein was tested on crab–
eating macaques. The monkeys were challenged with the virus twenty–eight days later, and
remained resistant.
Outbreaks of Ebola, with the exception of Reston Ebolavirus, have mainly been restricted to Africa.
* The Zaire virus, formerly named Zaire Ebolavirus, has the highest case–fatality rate, up to 90% in
some epidemics, with an average case fatality rate of approximately 83% over 27 years. The first
outbreak took place on 26 August 1976 in Yambuku. * The Sudan Ebolavirus was the second
species of Ebola emerging simultaneously with the Zaire virus. It was believed to have originated
amongst cotton factory workers in Nzara, Sudan. The most recent outbreak occurred in May 2004 in
Yambio County, Sudan. The average fatality rates for SEBOV were 54% in 1976, 68% in 1979, and
53% in 2000 and 2001. * The Reston Ebolavirus was discovered during an outbreak of Simian
hemorrhagic fever virus (SHFV) in crab–eating macaques from Hazleton Laboratories (now
Covance) in 1989. Since the initial outbreak in Reston, Virginia, it has emerged in Siena Italy, Texas,
and among pigs in the Philippines. Despite its status as a Level–4 organism, it is non–pathogenic to
humans although hazardous in monkeys. * The Ivory Coast Ebolavirus also referred to as Tai
Ebolavirus, was first discovered among chimpanzees from the Tai

EBOLA
WHAT IS EBOLA
Ebolavirus is a member of the Filoviridae virus family and there are five strains known. Zaire
ebolavirus (EBOV) is the virus currently being battled in west africa and across the world. Ebola is a
deadly and rare disease that is caused by infection with one of the five Ebola Virus strains. Ebola is
considered a viral disease that can be highly contractible when in contact with bodily fluids of the
infected. EBOV is the most deadly of the five strains with a mortality rate between fifty and ninety
percent. Ebolavirus is a zoonosis, which is an innocuous agent that lives in animals, only infecting
humans on rare occasions. The disease originated in Africa, but has effected many areas around the
world.
Origin
Ebola was ... Show more content on Helpwriting.net ...
Although there are no known treatments, treating the side effects are crucial in patient survival.
Also, in diagnosing the disease is important in controlling the spread by limiting contact between the
healthy and those infected. While early symptoms can strongly resemble flu like effects, the later
effects have a much more drastic effect. The later symptoms of ebola can be confused with signs of
Malaria, Typhoid fever, or meningitis. Those showing signs should seek immediate attention from
an Ebola assigned treatment center and refrain from contact with any other

Ebola (EBO) virus has made its presence around April and May in 1995 (7). The virus, at first, was
medically diagnosed as epidemic dysentery but was suspected by other medical providers to
something else (7). The specimens of the patients were then sent to the Centers for Disease Control
and Prevention (CDC) in which was diagnosed as Ebola viral hemorrhagic fever, to conform their
suspicion (7). This was the first large outbreak of the virus and has since then been a topic of study
because of its high mortality.
Diagnosis of EBO virus is accomplished in a variety of ways. The biosafety hazards accompanying
the handling and testing of EBO virus makes only a few specialized laboratories capable of testing it
through serologic assays, virus isolation, polymerase chain reaction (PCR), and antigen detection
(4,7). Specific testing can be done by viral particles in the blood or measuring the antibody response
to the virus (4). The virus is detected in the blood after the onset of symptoms (5). If a patient is
suspected of EBO virus and the ... Show more content on Helpwriting.net ...
RT–PCR is used for confirmation of acute infections (5). The RT–PCR is a one step process with the
use of SYBR green I dye and the primer set "Filo–A (5'–ATCGGAATTTTTCTTTCTCATT–3') and
Filo–B (5'–ATGTGGTGGGTTATAATAATCACTGACATG–3')," which is used to amplify the L
genes of EBO virus (6). Other PCR methods include TaqMan probe–based that uses a probe that is
labeled at the 5' end with the reporter dye 6–carboxyfluorescein and a quencher tag at the 3' end (6).
These primer sets are used to identify the virus but there are more primer sets available for
identification of the target gene of specific strains in question for the virus (see Table 2. "Primers
used for RT–PCR amplification..."

Ebola Virus Disease : History, Transmission & Pathogenesis
Ebola Virus Disease: History, Transmission & Pathogenesis
The Ebola virus disease (EVD) was initially discovered in 1976; which originated from the Ebola
River Valley in the Democratic Republic of Congo (DRC). EVD is a severe, often fatal disease
affecting humans, and nonhuman primates. Outbreaks occur in Africa affecting mostly the central
and western portions of the continent. Formerly known as Ebola hemorrhagic fever, but the recent
outbreak illustrates viruses' ability to manifest itself without hemorrhaging. While EVD can be a
deadly disease, its spread can be stymied rather quickly with properly trained, and well equipped
personnel, effective disposal of dead bodies, and changes in burial practice.
History
During the 70's, the DRC and Sudan were affected by Ebola viruses causing 637 human cases and
454 deaths. The first two major epidemics occurred in Africa in 1976. There were no EVD
outbreaks reported within a 15–year period. (Galan–Huerta, 2014)
When a new epidemic was detected in the DRC in the spring of 1995, it was widely perceived as a
threat to the West. The amount of public attention was intense. A massive intervention, led by UN
and US agencies, followed and put an end to the epidemic within less than two months. (Benini,
1996)
In April 1995, members of a rapid response team, handling a patient mis–diagnosed for typhoid,
were infected. Rapid infection of unprotected health workers and of other hospital patients ensued,
eventually prompting most patients

Ebola Virus Disease ( Ebv )
Ebola virus disease (EBV), or just Ebola, is an acute, often fatal illness, with a case fatality rate of
up to 90%. It is one of a number of haemorrhagic fever diseases. Ebola is a single–stranded RNA
virus with an unusual, variable–length, branched morphology. The helical capsid is enclosed inside a
membrane.. It is one of the world's most virulent diseases. The Ebola virus is a member of the
Filoviridae family. There are 5 known subtypes of Ebola. The infection is transmitted by direct
contact with the blood, body fluids and tissues of infected animals or people. The current hypothesis
is that fruit bats are the original host of the virus. Ebola was introduced into the human population
through close contact with the blood, secretions, ... Show more content on Helpwriting.net ...
The virus also inhibits interferon which is a molecule that cells make use of to further retard viral
reproduction.
The exact process what happens next is not fully known but the virus attacks the connective tissue
and reproduces at an extremely fast rate in the collagen, digesting the tissue as it goes. The virus can
ultimately cause viral hemorrhagic fever. When the macrophages in our body register the virus and
consume it, they end up becoming infected and are manipulated to release proteins that trigger
coagulation – create small clots in the blood. This leads to the blood slowly thickening and therefore
a decreased blood flow. As the clots begin to get stuck in the blood vessels, the patient begins to
exhibit red spots on the skin–the rash. As the disease progresses, these clots and their spots increase
in size. Another more serious effect of the Ebola virus's clotting factor is the decreased blood supply
to the vital areas of the body such as the liver, brain, kidneys, lungs, intestines, testicles and
extremities ultimately causing a multi–organ failure or septic shock.
The macrophages also produce other inflammatory signalling proteins and nitric oxide, which
damage the lining of blood vessels, causing them to leak and sometimes burst. The content leaks
out, and the damage and presence of the virus particles activates

Comparison Of The Ebola Virus
Essay 1;2014 Comparison of the Ebola outbreak and the CDC study module for "Gastroenteritis at a
University in Texas"
1) Ebola Virus– Belongs to the family Filoviridae. It has a single–stranded –sRNA genome, so it
uses a RNA polymerase to create the +sRNA template, which acts as mRNA inside the host cell.
The envelope is made up of peptidoglycan; the structure is made up of 7 structural proteins and 1
non–structural protein. This means it is an enveloped and susceptible to the outside environment.
The Ebola virus replicates in Monocytes, Macrophages and Dendritic Cells. When the Ebola virus is
ready to leave the host cell it buds out and takes part of the cell membrane with it. Ebola has an
incubation period of 8–10 days. (CDC) Norovirus– ... Show more content on Helpwriting.net ...
These symptoms are also similar to the symptoms caused by the common cold or the flu. Most
people are not going to be running to the emergency room if they have a slight fever, headache, or
nausea. This can make it difficult to contain these viruses once an initial infection happens in the
host. An infected person may travel to another area unaware that they are carrying one of these
diseases. Both of these viruses do not have a vaccine or real treatment. The best ways to "treat"
these are to let them pass and allow the immune system to fight the virus off. Norovirus is not as
serious as the Ebola and most of the persons infected can fight it off in a few days. Getting rest and
keeping the body healthy. The Ebola is more serious, the fatality rate according to WHO is 50%.
The best way to handle this is to isolate the person and give them IVs and hope their immune system
is strong enough to fight off the virus. If they can fight off the virus they will recover, but if not then
the virus kills the host. Since Ebola has no cure this plays to the advantage of controlling the virus.
When someone has contracted the virus action is taken very quickly to isolate and quarantine. The
source of the virus is put as top priority to stop the spread. Because it is so serious controlling it
when it arises is the number one objective. The Norovirus is foodborne virus. So tracking the source
and removing it in

The Ebola virus is the causative agent of Ebola Hemorrhagic Fever (Ebola HF).
Ebola is severe and often fatal among both humans and animals with mortality rates reaching as
high as 90% in some outbreaks. Ebola was named for the river in the
Democratic Republic of Congo (Zaire) in Africa where it was first recognized in 1976. Four strains
of Ebola have since been identified: Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast, and Ebola–
Reston. All but Ebola–Reston are known to cause disease in humans. (
https://web.stanford.edu/group/virus/filo/2005/profiles.html) When an infection occurs in humans,
the virus can be spread to others through direct contact through broken skin or mucous. Also in the
blood or body fluids of a person who is sick
with ... Show more content on Helpwriting.net ...
Samples from the patient can then be collected and tested to confirm infection. Ebola virus is
detected in blood only after onset of symptoms, most notably fever, which accompany the rise in
circulating virus within the patient's body. It may take up to three days after symptoms start for the
virus to reach detectable levels. (https://www.cdc.gov/vhf/ebola/diagnosis/)
There is no vaccine available to prevent Ebola infection. The point of all prevention techniques is to
avoid contact with the blood or body fluids of infected persons. This includes avoiding travel to
areas where Ebola outbreaks are occurring, and taking precautions when providing health care for
potentially infectious persons. Precautions may include wearing protective clothing (such as masks,
gloves, gowns, and goggles), using infection–control measures (such as complete equipment
sterilization and routine use of disinfectant), and isolating patients with Ebola from contact with
unprotected persons.
(http://www.sfcdcp.org/ebola.html)
Currently, no specific therapy is available that has demonstrated consistency in the treatment

Misconceptions About Ebola Virus Disease

Recommended

Recommended

More Related Content

More from Sarah Jimenez

More from Sarah Jimenez (20)

Recently uploaded

Recently uploaded (20)

Misconceptions About Ebola Virus Disease