The document discusses the basics of nucleotides, nucleic acids, and DNA structure. It defines nucleotides as consisting of a nitrogenous base, a 5-carbon sugar (ribose in RNA, deoxyribose in DNA), and phosphate groups. Nucleotides combine to form nucleic acids like DNA and RNA. DNA has a double helix structure formed by two anti-parallel strands linked by complementary base pairing between adenine-thymine and cytosine-guanine. This structure provides stability and a mechanism for replication.

1. Molecular Biology & Genetics-I
Lecture 1
By Dr. Iqra Munir

2. Nucleotides and Nucleosides
BASE NUCLEOSIDE DEOXYNUCLEOSIDE
Adenine Adenosine 2-deoxyadenosine
Guanine Guanosine 2-deoxyguanosine
Cytosine Cytodine 2-deoxycytodine
Uracil Uridine Not usually found
Thymine Not usually found 2-deoxythymidine
Nucleotides are nucleosides + phosphate

3. make up 13-34% of the dry weight in bacteria
deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)
O
C C
C C
Base
H
H or OH
H H
H
H
CH2
O
P
OH
O
HO
Nucleotide: a building block
Sugar:
• RNA – ribose (OH)
• DNA – deoxyribose (H)
Bases:
• adenine (A), cytosine (C), guanine (G),
thymine (T)
• RNA uses uracil (U) instead of thymine
Nucleoside: base + sugar
• certain nucleotides serve as a storage of energy and reducing power
e.g. ATP -> ADP -> AMP
hydrolysis (energy is released)
Nucleic Acids

4. DNA Stabilization– Complementary
Base Pairing

5. The Double Helix
•A DNA molecule consists of two strands of nucleotide
monomers running in opposite directions and coiled into
a double helix

6. • DNA nucleotide
• A five-carbon sugar (deoxyribose)
• Three phosphate groups
• One nitrogen-containing base (adenine, thymine, guanine, or cytosine)

7. The Double Helix
• Two double-helix strands are held together by hydrogen bonds
between nucleotide bases

8. • Chargaff’s rules
• Bases of the two DNA strands in a double helix pair in a consistent way:
• A = T and C = G
• Proportions of A and G vary among species

9. Patterns of Base Pairing
• The order of bases (DNA sequence) varies among species
and among individuals
• Each species has characteristic DNA sequences

10. • DNA sequence
• The order of nucleotide bases in a strand of DNA
• ATGGGGCTTACCTTAGTACCAA

11. DNA Stabilization-Base Stacking

12. • Figure . Base stacking in a single strand of B form
DNA.
• Space filling spheres are used to indicate the van der
Waals surfaces.
• Carbon atoms are highlighted in black, nitrogen in
blue, phosphorous in yellow and oxygen in red.
• The phosphodiester backbone is indicated with a
yellow ribbon.

13. • The tight spacing between the van der Waals
surfaces of adjacent bases indicates the close
proximity of their electron densities.
• It is also important to note that hydrogen atoms
are not displayed and as a result, the actual
spacing between stacks is closer than indicated
by this figure.

14. DNA Stabilization--H-bonding between
DNA base pair stacks

15. • Figure . Hydrogen bonding between DNA base pair stacks.
• Hydrogen bonding is indicated by the green dotted line.
• Hydrogen bonds occur not only between complimentary base pairs,
but adjacent nucleotide pairs as well.
• The hydrogen bonds indicated by the black arrows are between
stacked base pairs.
• Hydrogen bonding between base pair stacks could be responsible for
the tight base pair stacking observed in DNA molecules.

17. Advantages to Double Helix
• Stability---protects bases from attack by H2O soluble
compounds and H2O itself.
• Provides easy mechanism for replication

19. • each strand of DNA has a “direction”
• at one end, the terminal carbon atom in the
backbone is the 5’ carbon atom of the terminal
sugar
• at the other end, the terminal carbon atom is
the 3’ carbon atom of the terminal sugar
• therefore we can talk about the 5’ and the 3’ ends
of a DNA strand
• in a double helix, the strands are antiparallel
(arrows drawn from the 5’ end to the 3’ end go in
opposite directions)

20. • Chains are anti-parallel (i.e in opposite directions)
• Diameter and periodicity are consistent
• 2.0 nm
• 10 bases/ turn
• 3.4 nm/ turn
• Width consistent because of pyrimidine/purine pairing

21. Physical Structure (cont’d)

22. • The glycosidic bonds do not lie directly opposite each
other.
• the sugar phosphate backbones are not equally spaced
along the helical axis and the grooves that form between
the backbones are not of equal size, i.e we see a major
and minor groove
• these grooves provide a topography and allow
recognition by proteins
•  The structure of DNA is such that the bases are
protected (backbone, complementary H-bonds, base-
stacking), but also accessible.

23. G-C Content
• A=T, G=C, but AT≠GC
• Generally GC~50%, but extremely variable
• EX.
• Slime mold~22%
• Mycobacterium~73%
• Distribution of GC is not uniform in genomes

24. Consequences of GC content
• GC slightly denser
• Higher GC DNA moves further in a gradient
• Higher # of base pairs=more stable DNA, i.e. the strands don’t
separate as easily.

25. FORMS OF DNA

26. • The A-DNA conformation (left) is favored when DNA is
dehydrated. B-DNA (center) is the conformation
normally found inside cells.
• the Z-DNA conformation (right) is favored in certain GC-
rich sequences.
• Notes---The base pairs in Z-DNA are clearly
perpendicular to the axis of the helix and show very little
propeller twist. This conformation relieves some steric
hindrances found in certain GC-rich sequences.

29. DNA Can Undergo Reversible
Strand Separation
• During replication and transcription of DNA, the strands of
the double helix must separate to allow the internal edges of
the bases to pair with the bases of the nucleotides to be
polymerized into new polynucleotide chains.

30. •The unwinding and separation of DNA strands,
referred to as
• denaturation,
• or “melting,”
•can be induced experimentally by increasing the
temperature of a solution of DNA.

31. • As the thermal energy increases, the resulting increase in
molecular motion eventually breaks the hydrogen bonds
and other forces that stabilize the double helix; the
strands then separate, driven apart by the electrostatic
repulsion of the negatively charged deoxyribose-
phosphate backbone of each strand.

32. Reference Material
• 1. Molecular Cell Biology by Harvey Lodish.
• 2. Molecular Biology of the Cell, Volume 2 by Bruce Albert
• 3. Cell and Molecular Biology by Gerald Karp