DNA & RNA

1. Al-Mustaqbal College University
Department Of Medical Lab. Techniques
second Stage
Theoretical Part
Lec No. 1 & 2

2. Introduction to

3. Defining Molecular Biology
• The study of the formation, structure,
and function of macromolecules essential
to life, such as nucleic acids and
proteins, and their role in cell replication
and the transmission of genetic
information

5. The nucleic acid
1- Nucleotides
2- DNA
3- RNA

6. 1- NUCLEOTIDES
1- Importance of nucleotides
2- Structure of nucleotides
3- Metabolism of nucleotides
i. synthesis
ii. degradation

7. Importance of nucleotides
1- Building units for nucleic acids (DNA & RNA)
2- Other rules in metabolism & energy storage
(e.g. ATP is a nucleotide)

8. Structure of nucleotides
Nucleotides = nitrogenous base + sugar + phosphate group
Nucleoside = nitrogenous base + sugar
Nitrogenous base = Purine OR Pyrimidine
Sugar = Ribose OR Deoxyribose
Purine = Adenine OR Guanine
Pyrimidine = Thymine, Cytosine OR Uracil

11. • Purines : Adenine & Guanine
• Pyrimidines: Cytosine, Thymine & Uracil
• DNA contains Adenine & Guanine (purines)
Cytosine & Thymine (pyrimidines)
• RNA contains Adenine & Guanine (purines)
Cytosine & Uracil (pyrimidines)

12. Metabolism of nucleotides
1- Synthesis (anabolism)
i. sources of purine ring atoms
ii. sources of pyrimidine ring atoms
2- Degradation (catabolism)
i. end products of purine ring
ii. end product of pyrimidine ring

13. Degradation (catabolism):
End products of purine ring degradation
• In human cells purine nucleotides is finally degraded to URIC ACID
• Uric acid is transported in blood to kidneys
• Finally, Uric acid is excreted in urine
• If uric acid is increased in blood, the case is called HYPERURICEMIA
• Hyperuricemia may lead to GOUT
• GOUT is a disease affects joints (arthritis) & kidneys (kidney stones) caused
by deposition of uric acid in these tissues

14. DNA DeoxyriboNucleic Acid
1- Importance of DNA
2- Structure of DNA molecule
- Structure of a single strand of DNA
- Structure of double stranded DNA
- Linear & circular DNA

15. The history of DNA
 DNA as an acidic substance presentin nucleus was first
identified by Friedrich Meischer in 1868.
•
• He named it as ‘Nuclein’.

16. The history of DNA
Rosalind Franklin 1952
•She worked in same laboratory as Maurice Wilkins.
•She study X-ray diffraction to study wet fibers of DNA.
The diffraction pattern is interpreted
(using mathematical theory)
This can ultimately provide
information concerning the structure
of the molecule
X Ray
Crystallography
Rosalind
Franklin’s photo
X-ray diffraction of wet DNA fibers

17. The history of DNA
 She made marked advances in X-ray
diffraction techniques with DNA
 The diffraction pattern she obtained
suggested several structural features of DNA
 Helical
 More than one strand
 10 base pairs per complete turn

18. The history of DNA
In 1953 , James Watson and Francis Crick,
described a very simple and famous Double Helix
model for the structure of DNA.

19. Importance of DNA
1- Storage of genetic material & information
(material of GENES)
2- Transformation of genetic information to new cells
(template for REPLICATION)
i.e. synthesis of new DNA for new cells
3- Transformation of information for protein synthesis
in cytosol (template for TRANSCRIPTION)
i.e. synthesis of mRNA in nucleus

20. Structure of DNA molecule
• DNA molecule is formed of double helical strands.
• (Dounble helix)
• The two strands are held together by hydrogen bonds
• Each single strand is formed of polynucleotides
• Polyncleotides are mononucleotides bound to
each other by phosphodiester bonds

21. Structure of Single strand of DNA
• Building Units: Polynucleotide
• sugar: deoxyribose
• Base: Purine: A or G OR Pyrimidine: T or C
• Phosphoric acid
• Mononucleotides are bound together by phosphodiester bonds
• In linear DNA Strand : two ends (5` = phosphate & 3` = OH of deoxyribose)
• In circular strand: no ends

22. Structure of double stranded DNA
Two strands are anti-parallel (in opposite
directions)
Hydrogen bonds between bases of opposite
strands (A & T , C & G)
Denaturation
breakdown (loss) of hydrogen bonds between two
strands leading to formation of two separate
single strands)
Causes of denaturation : heating or change of pH
of DNA
link the two single strands together

23. DNA Double Helix & Hydrogen bonding
 The bases in two strands are paired through hydrogen bond (H-bonds)
forming base pairs (bp). Adenine forms two hydrogen bonds with
Thymine from opposite strand and vice-versa. Similarly, Guanine is
bonded with Cytosine with three H-bonds.
 Based on the observation of Erwin Chargaff that for a double stranded
DNA, the ratios between Adenine and Thymine; and Guanine and
Cytosine are constant and equals one.
 Hydrogen bond:-A chemical bond consisting of a hydrogen atom
between two electronegative atoms (e.g., oxygen or nitrogen) with
one side be a covalent bond and the other being an ionic bond.

24.  Chargaff’s Rule
 The compelling observation was that:
 Percentage of adenine=percentage of
thymine
 Percentage of Cytosine=percentage of
Guanine
 EX:
A G C C T T A G A
Erwin Chargaff

25. Structure of Double-helix
Three major forms:
B-DNA
A-DNA
Z-DNA
 B-DNA
• is biologically THE MOST COMMON
 It is a -helix meaning that it has a Right handed, orclockwise,
spiral.
 Complementary base pairing
• A-T
• G-C
 Ideal B-DNA has 10 base pair per turn(360o rotation of helix)
 So each base is twisted 36o relative to adjacent bases.
 Base pair are 0.34 nm apart.
 So complete rotation of molecule is 3.4 nm.
• Axis passes through middle of each basepairs.

26. Homework
•Is this strand a DNA?
TACTCCGGAATCTGGACCATGAATT

27. Structure of Double-helix
B-DNA
 Minor Groove is Narrow, Shallow.
 Major Groove is Wide, Deep.
 This structure exists when plenty of water surrounds
molecule and
• there is no unusual base sequencein DNA-Condition that
are likely tobe present in the cells.
 B-DNA structure is most stable configuration for a
random sequence of nucleotides underphysiological
condition.

28. Structure of Double-helix
Property B-DNA A-DNA Z-DNA
Strand Antiparallel Antiparallel Antiparallel
Type of Helix Right-handed Right-handed Left-handed
Overall shape Long andnarrow Short and wide Elongated and narrow
Base pair per turn 10 11 12
Major Groove Wide & Deep Narrow & Deep No discrenible
Minor Groove Narrow,shallow Broad, Shallow Narrow, Deep

29. Linear & Circular DNA
1- Linear DNA
in nucleus of eukaryotes (including human cells)
i.e. DNA of chromosomes
2- Circular DNA
i. in eukaryotes: mitochondria
ii. in prokaryotic chromosomes (nucleoid of bacteria)
iii. in plasmids of bacteria (extrachromosomal element)
iv. in plant chroroplasts

31. DNA packaging
• The pross of DNA compaction is supercoiling.
• In the first level of compaction, short stretches of the DNA double
helix wrap around a core of eight molecules of histone proteins
called a nucleosome, and DNA connecting the nucleosomes is called
linker DNA.
• The second level of compaction occurs as the six nucleosomes and
the linker DNA between them are coiled into a 30-nm call solenoid.
• In the third level of packing, a variety of fibrous proteins is used to
pack the chromatin fiber
• The fourth level of packing is chromatids, the chromosomes have
two sister chromatids both of them form chromosome the final
level of packing.

33. DNA supercoiling
DNA supercoiling refers to the over or under-winding of
strands.
DNA supercoiling is important for DNA packaging within all
cells. Because the length of DNA can be of thousands of
times that of a cells, packaging this material into the cell or
nucleus (in Eukaryotes) is a difficult feat.
Supercoiling of DNA reduces the space and allows for much
more DNA to be packaged.

35. 4
Nucleosome Structure
 Nucleosome are the basic unit of the chromatin organization.
 In Eukaryotes DNA associated with Proteins.
(In prokaryotes DNA is naked)
 Nucleosomes= basic bead like unit of DNA packing
 Made of segment of DNA wound around a protein core
that is composed of 2 copies of each 4 types of Histones.
 Nucleosomes have:
 8 Histones in the core
 DNA wrapped twice around
the core
 One Histone holding the
Nucleosome together
 A DNA ‘linker’ continues
towards the next nucleosome.
 The DNA has a negatively charged
backbone(because of PO 3- group)
 The Protein(Histones) are positively
charged.
 The DNA and Protein are
Electromagnetically attracted to

36. DNA packaging
• There are three types of Chromatin (a complex of DNA and protein found
in eukaryotic cells)
1. Euchromatin is a lightly packed form of chromatin about 30 nm.
2. scaffold loop is a medium packed form of chromatin about 300 nm.
3. Heterochromatin is a tightly packed form of DNA or condensed DNA about
700 nm.
The differences between Heterochromatin and Euchromatin
Heterochromatin Euchromatin
More condensed Less condensed
Diameter 700 nm Diameter 30 nm
Gene poor (high AT content) Gene rich (higher GC content)
Stains darker Stains lighter

38. RNA RiboNucleic Acid
1- Structure (differences from DNA)
3- Types
4- Importance of each type

39. Structure of RNA
• Building units: Polynucleotides (bound together by PDE)
• Single strand
• Linear (but may fold into complex structure)
• with two ends: 5`(phosphate) & 3`(-OH end)
• Sugar: Ribose
• Purine bases: Adenine & Guanine
• Pyrimidine bases: Cytosine & Uracil

40. • synthesized in the nucleus (by transcription):
DNA (the gene) is used a template for mRNA synthesis
mRNA is synthesized complementary to DNA but in RNA language i.e. U instead of T
So, if A in DNA it will be U in RNA , if T in DNA it will be A in mRNA….etc
• Carries the genetic information from the nuclear DNA (gene) to the cytosol
• In the cytosol, mRNA is used as a template for protein biosynthesis by ribosomes
(with help of tRNA)….
This is called Translation or Protein Biosynthesis)
Transcription + Translation = GENE EXPRESSION
Messenger RNA (mRNA)

41. Transfer RNA (tRNA)
• Smallest of RNAs in cell: 4S
• Location: cytosol
• At least one specific tRNA for each
of the 20 amino acids found in
proteins
• with some unusual bases
• with intrachain base-pairing (to
provide the folding structure of
tRNA)
• Function:
1- recognizes genetic code word on
mRNA
2- then, carries its specific amino
acid for protein biosynthesis

42. Types & Functions of RNA

43. Ribosomal RNA (rRNA)
80% of total RNA in the cell (most abundant RNA)
Location: cytosol
Function: machine for protein biosynthesis
Types:

44. complementary base-pair between DNA & RNA
in transcription

45. Types of mRNA
• Polycistronic mRNA:
One single mRNA strand carries information from more than one
gene (in prokaryotes)
• Monocistronic mRNA:
one single mRNA strand carries information from only one gene
(in eukaryotes)

46. Eukaryotic mRNA
5`-end: cap of 7-methylguanosine
3`-end: poly-A tail

47. The Genetic Code
• is a dictionary that identifies the correspondence between a sequence of
nucleotide bases & a sequence of amino acids
• Each individual word of the code
is called a codon
a codon is composed three nucleotide bases
in mRNA language (A, G, C & U)
in 5`-3` direction e.g. 5`-AUG-3`
• The four bases are used by three at a time to produce 64 different combinations of bases
61 codons: code for the 20 common amino acids
3 codons UAG, UGA & UAA: do not code for amino acids but are
termination (stop) codons.

48. Genetic Code Table