Download to read offline
![To run FastQC (provided it is installed):
-
‐ specify the files you want to process on the command line
-
‐ FastQC will generate an HTML report for each file (embeded graphs)
FASTQ FASTQC/…
DNA-Seq
‐ Analysis
The command-line
‐ environment
fastqc seqfile1 seqfile2 .. seqfileN
fastqc [-o
‐ output dir] [--
‐(no)extract]
‐
fastqc --
‐ help
‐
-o
‐ –outdir
Create all output files in the specified
output directory (dir must already exist).
-
-
‐ extract
‐
Uncompress the zipped output
file in the same dir after being
created.
-
-
‐ noextract
‐
Do not uncompress the output file
after creating it.
Introduction to Bioinformatics
Genomics| Dr KONATE](https://image.slidesharecdn.com/module5session1-250516072911-3e48fda7/75/Module5-Genomics-sequencing-technologies-and-NGS-pptx-85-2048.jpg)
Module5: Genomics sequençing technologies and NGS.pptx
- 1. Introduction to Bioinformatics Introductionto Bioinformatics Genomics| Dr KONATE Genomics Sequencing technologies and NGS Overview
- 2. Learning Objectives Session 1: Sequencingtechnologies and NGS Overview Part 1: Introduction to DNA Sequencing Part 2: DNA Sequencing in the NGS era Part 3: Overview of NGS Technologies Part 4: DNA-Seq ‐ Protocol : Overview Part 5: DNA-Seq ‐ Analysis Pipeline and File Formats Introduction to Bioinformatics Genomics| Dr KONATE
- 3. Learning Outcomes Session 1: Sequencingtechnologies and NGS Overview Understand basics of NGS technologies Understand different NGS file formats Navigate through database repositories to retrieve NGS datasets Introduction to Bioinformatics Genomics| Dr KONATE
- 4. Part 1 Introduction toDNA Sequencing Introduction to Bioinformatics Genomics| Dr KONATE
- 5. What is DNASequencing ? DNA Sequencing is the process of reading the nucleotides present in DNA : determining the precise order of nucleotides within a DNA molecule. DNA-Seq ‐ generally refers today to any NGS method or technology that is used to determine the order of the four bases (A, T, C, G) in a strand of DNA. Introduction to Bioinformatics Genomics| Dr KONATE
- 6. What is DNASequencing ? In fact, there are 2 main types of DNA sequencing technologies that are used today: Sanger sequencing and Next-Generation ‐ Sequencing (NGS). Each of these technologies has utility in today’s genetic analysis environment. Introduction to Bioinformatics Genomics| Dr KONATE
- 7. 1953 (Watson & Crick) DNAStructure as a double helix 1972-1976 ‐ (Min Jou et al., 1972; Fiers et al., 1976) sequence of the 1st complete gene and the complete genome of Bacteriophage MS2 (viral RNA 3,569 nt) 1977 (Sanger et al., Feb 1977) The first full DNA genome to be sequenced : bacteriophage φX174 1977 Maxam & Gilbert + Sanger sequencing 1987 ABI markets ABI370, the 1st fully automated sequencing machine 1995 (C.Venter) 1st complete genome of a free-living ‐ organism, the bacterium H. influenzae (circular chr >1,8Mb) 1995 First published use of WGS sequencing 1996 First NGS technology : 2001 Draft sequence of the human genome (shotgun sequencing methods). Public & Private (Lander et al., Feb 2001 Nature; Venter et al., Feb 2001 Science) Introd Pyrosequencing uction to Bioinformatics Genomics| Dr KONATE Main DNA sequencing technologies
- 8. The Human GenomeProject: the objectives The Human Genome Project (HGP)= a 13-years ‐ (1990-April ‐ 14, 2003) international effort to sequence of the 3 billion "letters” of human DNA. $300 million project, led by the U.S. DoE and the NIH. International Human Genome Sequencing Consortium (IHGSC)= group of publicly funded researchers At any given time, ≈ 200 labs in the United States supported these efforts + > 18 different countries from across the globe had contributed to the HGP. Chial, 2008 http://www.genome.gov/sequencingcosts/ Introduction to Bioinformatics OnwlinwewC.soanugresre.a:IcB.uTk Genomics| Dr KONATE
- 9. The Human GenomeProject: the objectives 2 groups competing for sequencing: - ‐ Public - ‐ Private (Celera Genomics) Opposing philosophies : - ‐ HGP Bermuda Agreement (1996) all information from the project would be made freely available to all within 24h. - ‐ Private access restricted to paying customers ! In February 2001, drafts of the human genome sequence were published simultaneously by both public-private ‐ groups in separate articles (Lander et al (IHGSC)., Feb 2001 Nature; Venter et al., Feb 2001 Science). Chial, 2008 http://www.genome.gov/sequencingcosts/ http://ww w.yourgen ome.org/ Introduction to Bioinformatics Onliwnwe wCo.suarnsgee:rI.BaTc.uk Genomics| Dr KONATE
- 10. The Human GenomeProject: the method (WGS) Hierarchical genome shotgun sequencing - ‐ Shotgun phase Genome fragmented into larger segments cloning into vectors clones sequencing shotgun sequences assembly relied on the physical map of the human genome established earlier. - ‐ Finishing phase : filling in gaps and resolving DNA sequences in ambiguous areas Whole-genome ‐ shotgun sequencing (Celera genomics) Genome sheared randomly into small fragments (appropriately sized for sequencing) Reassembly. The IHGSC and Celera used the same general method of termination chain for the DNA Introduction to Bioinformatics sequencing (Hood & Galas, 2003). Genomics| Dr KONATE
- 11. Sequencing Quality Sequencing qualitydepend upon the average number of times each base in the genome is 'read' during the sequencing process. For the Human Genome Project (HGP) : - ‐ 'draft sequence' (covering ~90% of the genome at ~99.9% accuracy) - ‐ 'finishedsequence' (covering >95% of the genome at ~99.99% accuracy). Producing truly high-quality ‐ 'finished' sequence by this definition is very expensive and labor-intensive. ‐ Several releases of the human genome sequences Introductih ott np: t/ o/ w Bw iow in.g fe on rmom ae ti. cg sov O/ nse liq nu ee Cn oci un rg sc eo :s It Bs T/
- 12. Finished Genome vsDraft Genome Variable degrees of completion of published genomes Draft Sequencing - ‐ high-throughput ‐ or shotgun phase (whole genome or clone-based ‐ approach) - ‐ Assembly using specific algorithms (whole-genome ‐ or single-clone ‐ assembly) lower accuracy than finished sequence; some segments are missing or in the wrong order or orientation. Finishing - ‐ Accuracy in bases identification + Quality Check + few if any gaps. - ‐ Contiguous segments of sequence are ordered and linked to one another - ‐ No ambiguities or discrepancies about segments order and orientation Complete Genome A Genome represented by a single contiguous sequence with no ambiguities The sequences available are finished to a certain high quality. (Mardis et al., 2002) Introduction to Bioinhfttoprm://awtiwcswO.innfloinrme aCtiocusr. jsaex:.IoBrTg /
- 13. The Human GenomeProject: the heritage The HGP project required that all human genome sequence information be freely and publicly available. The existing DNA sequences have been stored in databases available to anyone willing to exploit and analyze them. Dedicated databases house various data for model organisms such as sequences of known and hypothetical genes and proteins (GenBank, NCBI). Other databases (Ensembl http://www.ensembl.org) present additional data and annotation as well as powerful tools for visualizing and searching it. Community efforts for non-model ‐ organisms like Eukaryotic Pathogens : EuPathDB (http://eupathdb.org/eupathdb/). Computer programs have been developed to analyze and interpret the data. Introduction to Bioinformatics Genomics| Dr KONATE
- 14. The Human GenomeProject: the heritage The human genome contains only about 20,000 protein-coding ‐ genes, similar in number and with largely orthologous functions as those in nematodes that have only 1,000 somatic cells. The extent of non-protein- ‐ coding ‐ DNA increases with increasing complexity, reaching > 98% in humans. Encode Gencode Introduction to Bioinformatics Online(M Ca otti uc rk s, e2 :0 IB11 T) Genomics| Dr KONATE
- 15. The Human GenomeProject: the heritage Encode (https://www.encodeproject.org) The Encyclopedia of DNA Elements (ENCODE) Project aims to provide “a list of functional elements in the human genome, including elements that act at the protein and RNA levels, and regulatory elements that control cells and circumstances in which a gene is active. “ “the generation of such a catalogue is crucial for understanding genome function.” Gencode (http://www.gencodegenes.org) The human genome has been the focus of intensive manual annotation: The GENCODE Consortium aims to identify all gene features in the human and mouse genomes using a combination of computational analysis, manual annotation, and experimental validation. (Djebali et al., 2012) (Harrow et al., 2012) Introduction to Bioinformatics O(Bnirlinneey Ceot ualr.s, e2:0I0B7T) Genomics| Dr KONATE
- 16. The Human GenomeProject: the heritage Genetic differences in individual bases (SNPs) of a genome are by far the most common type of genetic variation. Goal: develop a Haplotype Map of the Human Genome = identification and cataloging of most of the millions of SNPs estimated to occur commonly in the human genome. Described variants are, their location, their distribution among people within populations and among populations in different parts of the world. designed to provide information to link genetic variants to the risk for specific diseases 1000 Genomes Project: has become more complete and reliable as many novel variants have been discovered !! Introduction to Bioinfh ott rmp:/ a/ tiha cp sm Oa np l. in nc ebi. Cn olm u. rn si eh. :g IBov T
- 17. Introduction to Bioinformatics hGttep:n//ohmapicmsa| p.Fnactbmi.nalmG.nuieh.rgfoavli TheHuman Genome Project: the heritage 1000 Genomes (www.1000genomes.org/) ►identify most genetic variants with frequencies of at least 1%. ►freely accessible ressource of human genetic variation. ►final data set = data for 2,504 individuals from 26 populations. (low coverage sequencing and exome sequence data for all) ►International Genome Sample Resource (IGSR) for ongoing usability of data generated by the 1000 Genomes Project. UK10K (www.uk10k.org/) ►identification of rare genetic variants through the study of the DNA of 4,000 individuals and their comparison to the protein- ‐ coding areas of 6,000 people with documented diseases. ►link between genetic variants and rare diseases.
- 18. The Human GenomeProject: the heritage Development of novel technologies to help increase the depth of sequencing: Next-Generation ‐ Sequencing (NGS) technologies Since their development, NGS technologies have gained increasing attention with a considerable potential application in both diagnostic and public health microbiology. Revolutionized the sequencing process: from Sanger to HT sequencing (Salipante et al., 2013) Introduction to Bioinformatics Genomics| Dr KONATE
- 19. Part 2 Introduction toBioinformatics Genomics| Dr KONATE DNA Sequencing in the NGS era
- 20. DNA Sequencing method: fromSanger to NGS Sanger sequencing is the method developed by Frederick Sanger in 1977. This method involves copying single-stranded ‐ DNA with chemically altered bases called dideoxynucleotides (ddNTPs). ddNTPs when incorporated at the 3' end of the growing chain, terminate the chain selectively at A, C, G, or T. The terminated chains are then resolved by capillary electrophoresis. Introduction to Bioinformatics Online Course www.the- scientist.c:oIBmT Genomics| Dr KONATE
- 21. DNA Sequencing method: fromSanger to NGS Applied Biosystems (Life Technologies), manufactured the automated capillary sequencers utilized by both Celera Genomics and The Human Genome Project. While capillary sequencing was the first approach to successfully sequence a full human genome, it was still too expensive and took too long for commercial purposes !!! Because of this, sequencing using Sanger technology has been displaced by technologies like pyrosequencing, or SMRT sequencing… Introduction to Bioinformatics Genomics| Dr KONATE
- 22. DNA-Seq ‐ DNA-Seq ‐ is nowadaysused as an effective sequencing strategy after the advent of rapid DNA sequencing methods that has greatly accelerated biological and medical research and discovery : de novo… DNA-Seq ‐ may be used to determine the sequence of individual genes, larger genetic regions, full chromosomes, or entire genomes. ‘DNA-Seq’ ‐ and other related ‘seq’ technologies allow to cover genome complexity : genomic DNA-Seq, ‐ Methyl-Seq, ‐ ChIP-Seq, ‐ exome sequencing… Introduction to Bioinformatics Genomics| Dr KONATE
- 23. NGS Next-generation ‐ sequencing (NGS),or high-throughput ‐ (HT) sequencing = catch-all ‐ term describing different modern sequencing technologies used by different platforms: - ‐ Illumina (Solexa) sequencing - ‐ Roche 454 sequencing - ‐ Ion torrent: Proton / PGM sequencing - ‐ … DNA sequence faster and cheaper than the Sanger sequencing = revolution for genomics and molecular biology. Introduction to Bioinformatics Genomics| Dr KONATE
- 24. NGS: Sequencing Technologies andPlatforms Technology Introduction to Bioinformatics Genomics| Dr KONATE Company Support Chemistry Massively Parallel Sequencing Solexa 454 SOLiD Ion Torren t Illumina Roche Applied Science AB / Life Technologies Life Technologies Bridge PCR on flowcell emPCR on beads emPCR on beads emPCR on beads Seq-By- ‐ Synthesis ‐ Pyrosequencing Seq-By- ‐ Ligation ‐ Proton detection Single Molecule Sequencing PacBio SMRT Nanopore Pacific Biosciences Oxford Nanopore Tech/McNally Pol performance Translocation Real-time- ‐ Seq ‐ NA
- 25. NGS: Principles of DNASequencing: SBS Tracking the addition of labeled nucleotides as the DNA chain is copied The DNA template is immobilized. Solutions of A, nucleotides C , G and T sequentially added and removed. Light is generated when a nucleotide complements the first unpaired base. Chemiluminescent signal detected to determine the sequence. Introduction to Bioinformatics Online Course:IBT Genomics| Dr KONATE
- 26. NGS: In brief :emPCR (454/SOLiD/Ion Torrent) vs Bridge PCR (Illumina) Bridge PCR (Shendure & Ji, 2008) Introduction to Bioinformatics Genomics| Dr KONATE - ‐ The adaptor-flanked ‐ shotgun library is PCR amplified on a flow cell - ‐ both primers coat the surface of a solid substrate - ‐ Amplification products from any given member of the library remain locally fixed near the point of origin = cluster - ‐ The PCR produces clonal clusters contains copies of a single DNA.
- 27. NGS: Introduction to Bioinformatics Genomics|Dr KONATE Principles of DNA Sequencing: Pyrosequencing Incorporation of dNTPs by DNApol releases pyrophosphate (PPi). ATP sulfurylase converts PPi to ATP in the presence of APS. ATP = substrate for the luciferase-mediated ‐ conversion of luciferin to oxyluciferin This conversion generates light in amounts proportional to the amount of ATP detected by a camera. Unincorporated nucleotides and ATP are degraded by the apyrase, and the reaction can restart with another nucleotide APS : adenosine 5´phosphosulfate PPi : Pyrophosphate DNApol: DNA Polymerase (https:// en.wikipedia.org)
- 28. NGS: In brief :emPCR (454/SOLiD/Ion Torrent) vs Bridge PCR (Illumina) emPCR - ‐ The adaptor-flanked ‐ shotgun library is PCR amplified in the context of a water- ‐ in-oil ‐ emulsion. - ‐ PCR primer is 5'-attached ‐ on micron-scale ‐ beads. - ‐ 1 bead-containing ‐ compartments = 0 or 1 template DNA. - ‐ PCR amplicons are captured to the surface of the bead. - ‐ 1 clonally amplified bead = PCR products corresponding to amplification of a single molecule from the library. (Shendure & Ji, 2008) Introduction to Bioinformatics Genomics| Dr KONATE
- 29. Part 3 Introduction toBioinformatics Genomics| Dr KONATE Overview of NGS Technologies
- 30. NGS: Sequencing Technologies andPlatforms Technology Introduction to Bioinformatics Genomics| Dr KONATE Company Support Chemistry Massively Parallel Sequencing Solexa 454 SOLiD Ion Torren t Illumina Roche Applied Science AB / Life Technologies Life Technologies Bridge PCR on flowcell emPCR on beads emPCR on beads emPCR on beads Seq-By- ‐ Synthesis ‐ Pyrosequencing Seq-By- ‐ Ligation ‐ Proton detection Single Molecule Sequencing PacBio SMRT Nanopore Pacific Biosciences Oxford Nanopore Tech/McNally Pol performance Translocation Real-time- ‐ Seq ‐ NA
- 31. Solexa The input samplemust be cleaved into short sections. Fragments are ligated to adaptors and annealed to the slide using the adaptors. Fragments are separated into single strands to be sequenced. Nucleotides are modified so that each emits a different coloured light when excited by a laser. + they have a terminator, so that only one base is added at a time. PCR, process repeated in cycles, images analyzed. Flow cell Introduction to(BmiooindfiofiremdatifrcosmOnGlinilechCroiusr ts,e2:I0B1T0)
- 32.
- 33. 454 Technology As inIllumina, the DNA is fragmented. Adaptors added, end annealed to beads. 1 DNA fragment = 1 bead. Fragments amplified by PCR using adaptor-specific ‐ primers. The sequence can then be determined computationally. Longer reads than Illumina, different lengths. Introduction to Bioinformati(chsttOpn:/l/inwewCwo.eubrsi.ea:cI.BuT k)
- 34. Introduction to Bioinformatics Genomics|(wFawtwm.a45G4u.ceormfa/l)i 454Technology Intra-Platform ‐ Comparison Features combination of long reads, accuracy and high-throughput, making the system well suited for larger genomic projects. brings the power of 454 Sequencing Systems directly to the laboratory benchtop GS FLX+ System GS Junior System Read lengths: GS Junior (up to 400bp) GS Junior + (700-800bp) Read lengths: GS FLX Titanium XL+ (up to 1,000bp) GS FLX Titanium XLR70 (up to 600bp)
- 35. SOLID In the SOLiDsequencing method, unlike other NGS technologies (which base detection of DNA fragments is performed through polymerase reaction) sequencing is achieved by Sequencing-By- ‐ Ligation ‐ . Sequencing is performed with a ligase, rather than a polymerase. Each sequencing cycle introduces a partially degenerated population of fluorescently labeled octamers. The population is structured such that the label correlates with the identity of the central 2 bp in the octamer. After ligation and imaging in four channels, the labeled portion of the octamer (that is, 'zzz') is cleaved leaving a free end for another cycle of ligation. Adapted from (Shendure & Ji, I2n0t0r8o)dauncdti(hottnpt:/o/wBwiowin.sfporirnmgearti.ccosmO/9n7l8in-1 ‐ e- ‐ 4C6o14u- ‐r7s7e2:5IB-9 ‐ T) Genomics| Dr KONATE
- 36. Ion Torrent As inother kinds of NGS, the input DNA is fragmented. Adaptors are added and one molecule is placed onto a bead. Amplification on the bead by emulsion PCR. Each bead is placed into 1 well of a slide. The pH is detected is each of the wells, as each H+ ion released will decrease the pH. The changes in pH allow us to determine if that base, and how many thereof, was added to the sequence read. The dNTPs are washed away, and the process is repeated in cycles. Adapted from (http://www.ebi.ac.uk) a I n n d tr ( o htt d p u : c // ti w o w n w t . o sp B ri i n o g i e n r f .c o o r m m / a 9 ti 78 c - ‐ s 1- ‐ O 46 n 1 li 4 n - ‐ e 77 C 2 o 5- ‐ u 9 r ) s e : I B T
- 37. PacBio Single Molecule RealTime (SMRT) DNA Sequencing technology a DNA polymerase molecule is tethered to the bottom of a nanowell ZMW design ensures only one nucleotide- ‐ linked dye can be directly excited at a time. b Each incorporated phospholinked nucleotide will reside on the enzyme’s active site for a few milliseconds, which is enough time for a fluorescent signal to be recorded. NB: In other systems, the fluorescent label is attached to the base in nucleotides. In SMRT technology, the fluorescent label is attached to the phosphate chain The released labled pentaphosphates will diffuse quickly. Introduction to Bioinformation Genomics| Dr KONATE
- 38. Nanopore Schematic representation ofnanopore sequencing system. Upper protein ssDNA. 2nd protein - ‐ forms a nanopore in a membrane. - ‐ contains an adaptor molecule reduce the speed of passing DNA through the pore. Each base obstructs the flow to a different degree. PromethION… Single Molecule Real Time (SMRT) DNA Sequencing technology: How it works (http://www.springer.com/978-1- ‐ 4614- ‐ 7725- ‐ 9 ‐ ) Introduction (tpoicBtuioreinffroormmMatiITc’ss OTenclhinneolCooguy rRseev:iIeBwT) Genomics| Dr KONATE
- 39. Inter-Platform ‐ Comparison Introduction toB( ih ott inp fs o:/ r/ mflx al tie cxb s l Oog n. lw ino erd Cp ore us rs s. ec :o Im BT) Genomics| Dr KONATE
- 40. The four mainadvantages of NGS over classical Sanger sequencing Speed NGS is quicker than Sanger sequencing in two ways. - ‐ Chemical reaction may be combined with the signal detection, whereas in Sanger sequencing these are two separate processes. - ‐ 1 read can be taken at a time in Sanger sequencing, whereas NGS is massively parallel. Cost The human genome sequence cost $300M. Sequencing a human genome with Illumina allows to approach the $1,000 expected. Sample size needs significantly less starting amount of DNA/RNA Accuracy More repeats than with Sanger sequencing greater coverage, higher accuracy and sequence reliability (individual reads less accurate for NGS). Introduction to Bioinformatics Genomics| Dr KONATE
- 41. DNA Sequencing costs (Datafrom the NHGRI Genome Sequencing Program (GSP) Accurately determining the cost for sequencing a given genome (e.g., a human genome) is not simple. Introductih ott np: t/ o/ w Bw iow in.g fe on rmom ae ti. cg sov O/ nse liq nu ee Cn oci un rg sc eo :s It Bs T/
- 42. Comparison of humangenome sequencing methods HGP vs. ~ 2016 Introductih ott np: t/ o/ w Bw iow in.g fe on rmom ae ti. cg sov O/ nse liq nu ee Cn oci un rg sc eo :s It Bs T/
- 43. Part 4 Introduction toBioinformatics Genomics| Dr KONATE DNA-Seq ‐ Protocol : Overview
- 44. DNA-Seq ‐ Protocol for LibraryConstruction END REPAIR + A A A A A A Genomic DNA Purification End repair and A - ‐ tailing Adapter Ligation Size Selection & PCR Sequencing STEP 01 roduction to Bioinformatics Int | Dr KONATE STEP Genomic DNA Fragmentation 02 STEP 03 STEP 04 STEP 05 STEP 06
- 45. (https://www.kapabiosystems.com/product- ‐applications/producItns/tnroexdtu- ‐gcetinoernatitoonB- ‐sieoqinuefoncrimnga- ‐ 2ti/cdsnOa- ‐lniblirnarey- ‐Cporeuprasrea:tiIoBnT/ DNA-Seq ‐ Kits for DNAseqLibrary prep Illumina-compatible ‐ DNA-Seq ‐ Library Prep Kits NEXTflex™ Rapid DNA-Seq ‐ Kit - ‐ DNA-Seq ‐ library prep kit, 1 ng - ‐ 1 µg input DNA NEXTflex mtDNA-Seq ‐ Kit - ‐ mtDNA libraries NEXTflex™ DNA Sequencing Kits - ‐ DNA-Seq ‐ library prep kit, 1 µg of input DNA NEXTflex™ PCR-Free ‐ DNA Sequencing Kit - ‐ Amplification-free ‐ DNA-Seq ‐ library prep kit for sequencing 0.5 µg – 3 µg of input DNA NEXTflex™ PCR-Free ‐ Barcodes - ‐ Up to 48 barcodes for use with the NEXTflex™ PCR-Free ‐ DNA-Seq ‐ Kits and other DNA-Seq ‐ protocols KAPA HyperPlus Kits - ‐ input DNA from 1 ng – 1 µg KAPA Hyper Prep Kits - ‐ 250 ng FFPE DNA or less + fewer cycles of amplification with KAPA HiFi DNA Polymerase (duplication rates + coverage) (http://www.biooscientific.com/Next- ‐Gen-Sequencing/Illumina- ‐ DNA- ‐ Library- ‐ ‐ Prep-Kits/à ‐
- 46. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 01 GENOMIC DNA PURIFICATION AAA A A END REPAIR + A Starting material: QC Quality Control ►gel visualization, Bioanalyzer (Agilent, Bio-rad) ‐ Quantity Control ►Nanodrop, Qubit… Experimental design ►SR (single read) or PE (paired-end) ‐ ►Multiplexing or not ►de novo or not ►… Introduction to Bioinformatics Genomics| Dr KONATE
- 47. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 01 GENOMIC DNA PURIFICATION AAA A A END REPAIR + A Experimental design ►SR (single-end ‐ reads) or PE (paired-end ‐ reads) https://www.biostars.org/p/162806/ SR PE INSERT SIZE Introduction to Bioinformatics Genomics| Dr KONATE
- 48. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 01 GENOMIC DNA PURIFICATION AAA A A END REPAIR + A Experimental design ►Multiplexing or not ? multiplexing = attach to a specific barcode sequence to identify later the sample from which it originates. Libraries pooled and sequenced in parallel. Reads from each library are differenciated by using barcode to de-multiplex ‐ Each set is aligned to the reference genome Introduction to Bioinformatics Ownlwinwe.iClluomurinsea.:cIBoTm Genomics| Dr KONATE
- 49. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 02 GENOMIC DNA FRAGMENTATION AAA A A END REPAIR + A Fragmentation Can be included in the kit ►Optimization of fragmentation parameters Several methods ►Enzymatic, Nebulization, acoustic shearing… Starting material: input Low Quality DNA ►Caution in size selection High Quality DNA ► Size selection Introduction to Bioinformatics Genomics| Dr KONATE
- 50. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 03 END REPAIR AND A -TAILING ‐ AAA A A END REPAIR + A Repair ends Converts overhangs: Blunt ends + Phosphorylates 5’-end ‐ Reagents: dNTP, T4 DNA pol, Klenow – Kinase/ATP (T4 PNK) Simple enzymatic reaction BLUNT ENDING BY EXONUCLEASE 5’-END ‐ PHOSPHORYLATION Introduction to Bioinformatics Genomics| Dr KONATE
- 51. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 03 END REPAIR AND A -TAILING ‐ AAA A A END REPAIR + A A-tailing ‐ (Adenylation) Adds ‘A’ base to the 3' end of the blunt phosphorylated DNA fragments Prevents ►Formation of adapters dimers ►Concatemers Reagents 1 mM dATP, Klenow exo (3' to 5' exo minus) A-OVERHANG ‐ Introduction to Bioinformatics Genomics| Dr KONATE
- 52. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 04 ADAPTER LIGATION AAA A A END REPAIR + A Adapter Ligation Provided or custom-designed ‐ Adapter concentration affects ligation, adapter and adapter-dimer ‐ carryover Robust Ligation efficiency for adapter:insert molar ratios between 10:1 and >200:1 Adapter ratio >200:1 for low-input ‐ applications. Adapter quality Post-Ligation ‐ cleanup Introduction to Bihottinpfso:/r/mwawtiwc.skaOpnalbinioesyCsoteumrs se.c:IoBmT/
- 53. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 05 SIZE SELECTION AND PCR AAA A A END REPAIR + A Size selection : Read length considerations Size select 300 – 400 bp or 350 – 500 bp, post- ‐ ligation Ensures maximum coverage of most inserts Problem of non-uniform ‐ genome coverage Problem of material loss Strategy to focus read lengths during sample and library preparation Introduction to Bihottinpfso:/r/mwawtiwc.skaOpnalbinioesyCsoteumrs se.c:IoBmT/
- 54. Introduc DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 05 SIZE SELECTION AND PCR AAA A A END REPAIR + A Size selection : Read length considerations Double solid-phase ‐ reverse immobilization (SPRI) selection methods allow to reshape the input fragment distribution into well-defined ‐ ranges. SPRI + Reverse-SPRI ‐ FRAGMENTS ON BEADS FRAGMENTS IN SUPERNATANT tion to Bihottinpfso:/r/mwawtiwc.skaOpnalbinioesyC soteumrsse.c:IoBmT/
- 55. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 05 SIZE SELECTION AND PCR AAA A A END REPAIR + A Library Amplification (PCR) ► Amplifies the amount of DNA in the library ►Selectively enrich DNA fragments with adapter molecules on both ends ►Post-amplification ‐ cleanup QC ► Quality & Quantity & size check Introduction to Bihottinpfso:/r/mwawtiwc.skaOpnalbinioesyCsoteumrs se.c:IoBmT/
- 56. DNA-Seq ‐ Critical steps inDNAseq Library prep STEP 06 SEQUENCING AAA A A END REPAIR + A DNA Sequencing ► input : Library constructed - ‐ Whole-genome ‐ - ‐ Whole-exome ‐ - ‐ Target region ►Cluster amplification + sequencing + base calling ► QC (run report) ► output : sequenced « reads » (fastq files) Introduction to Bihottinpfso:/r/mwawtiwc.skaOpnalbinioesyCsoteumrs se.c:IoBmT/
- 57. Part 5 Introduction toBioinformatics Genomics| Dr KONATE DNA-Seq ‐ Analysis Pipeline and File Formats
- 58. Raw Sequencing Reads ReadsAlignment Genomic Coverage SV/CNV/Variant Calling Biological Interpretation STEP 01 STEP 02 STEP 03 STEP 04 STEP 05 FASTQ SAM/BAM BAI/BED VCF CSV/XLS/TXT DNA-Seq ‐ Analysis Pipeline and associated files KEY STEPS OF THE ANALYSIS PIPELINE KEY FILES INDEXING MARKING DUPLICATES MAPPED/UNMAPPED Introduction to Bioinformatics Genomics| Dr KONATE
- 59. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 01 RAW SEQUENCING READS Sequencing output ►FASTQ (text) format. ►Potentially SRA (binary), but rather used for public data online. Fastq file ►Improvement of the Sanger breakthrough (associating each nucleotide to a quality score) ►Hundreds of millions of lignes/rows ►Blocks of 4 lignes (@) ►Example FASTQ SEQUENCING RUN/QC Introduction to Bioinforhmttapti:/c/smOaqn.lsinoeurCceofuorrsgee:. InBeTt
- 60. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 01 RAW SEQUENCING READS FastQC FASTQ SEQUENCING RUN/QC http://maq.sourceforge.net Introduction to Bioinformhatttipcss:/O/wnliikni.ehpCcocu.mrsseu:.IeB dTu
- 61. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 01 RAW SEQUENCING READS FastQC + Trimming + bad reads removal FASTQ SEQUENCING RUN/QC Introduction to Bioinformatics Online Course http://maq.sourceforge.net https://wiki.hpcc.msu:.IeBdTu Genomics| Dr KONATE
- 62. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 02 READS MAPPING/ ALIGNMENT SAM/BAM BWA/BOWTIE…/SAMTOOLS Input files ►.fastq ►Reference Genome (.fasta, .fa, .fai) ►GFF/GTF, GFF3 Reads alignment ►BWA / BOWTIE (Burrows-Wheeler ‐ transform) ►de novo: NEWBLER (454)… Output files ►.sam / .bam Introduction to Bioinformatics Genomics| Dr KONATE
- 63. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 02 READS MAPPING/ ALIGNMENT SAM/BAM BWA/BOWTIE…/SAMTOOLS GFF3 ►1 line for 1 feature ►tab-separated ‐ columns ►9 columns + optional additional information SEQ-ID ‐ Introduction to Bioinformhatttipc:s//Ownwliwn.eenCsoeumrsbel.:oI BrgT/ SOURCE TYPE START-END ‐ SCORE STRAND PHASE ATTRIBUTES
- 64. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 02 READS ALIGNMENT SAM/BAM BWA/BOWTIE…/SAMTOOLS SAM / BAM ►Header lines + Alignments sections ►tab-separated ‐ columns ►11 columns ►Samtools (view, sort, index…) ►Removal of duplicated reads that affects Variant Calling http://samtools.sourceforge.net/SAM1.pdf QNAME FLAG RNEXT PNEXT TLEN SEQ RNAME POS MAPQ Introductionhtttop:B// iogeinnfoomrme.asptihc.sumOniclhin.eedCuo/ wuirksie/S:IABMT CIGAR QUAL
- 65. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 03 GENOMIC COVERAGE Coverage ►IGV = Integrative Genomics Viewer (https:// www.broadinstitute.org/igv/) ►other useful file formats BED = (Browser Extensible Data) ( http://genome.ucsc.edu/FAQ/FAQformat) ►Coverage associated to 3 different concepts: - ‐ Fold Coverage (number + X ) - ‐ Breadth of Coverage - ‐ Depth of Coverage BAI/BED SAMTOOLS/BEDTOOLS Introduction to Bioinformatics Genomics| Dr KONATE
- 66. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 04 SV/CNV/VARIANT CALLING VCF PROPERLY MAPPED PAIR SV/CNV/Variant Calling ►Structural variations (SV) Deletions, duplications, copy-number ‐ variations, insertions, inversions, translocations… ►Copy number Variations (CNV) Deletions or duplications of genes or relatively large regions of the genome that affect chromosomes► Variant Calling (SNPs and small InDels) - ‐ SNPs: affects only 1 nucleotide - ‐ InDels: affects 1 or several nucleotides SPLIT MAPPING OR DIFFERENT DISTANCE OR ORIENTATION FOR THE PAIR Introduction to Bioinformatics Genomics| Dr KONATE
- 67. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 04 SV/CNV/VARIANT CALLING SV/CNV/Variant Calling SUB-CHROMOSOMAL ‐ TO MICROSCOPIC 2bp TO 1kb REFERENCE REFERENCE SINGLE NUCLEOTIDE A C A B C A B C REFERENCE 1kb TO SUB- ‐ MICROSCOPIC A A B C A E F VCF Introdu(dcetifionnititoonBsiaodinafpotermd fartiocms SOcnhleinreer Cetoaulr.,se20:I0B7T) Genomics| Dr KONATE
- 68. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 04 SV/CNV/VARIANT CALLING SV/CNV/Variant Calling ►VCF (Variant Call Format) - ‐ Text file format storing SNPs and InDels information - ‐ http://www.1000genomes.org/node/101 - ‐ Obtaining variants listed in this format is a multistep procedure involving different tools but standardized - ‐ Headers (meta-information) ‐ + data lines - ‐ 8 required fields, tab-delimited ‐ VCF Introduction tohttBpio:/i/nwfowrwm.1a0ti00cgseOnonmlinese.oCrgo/ unrosdee:/I1B0T1
- 69. DNA-Seq ‐ Analysis Pipeline andassociated files STEP 05 BIOLOGICAL INTERPRETATION CSV/XLS/TXT From Variant annotation to data mining ►web-based ‐ ►available packages Aim ►Functional impact of variants (synonymous or not…) ►Gene Ontology Annotation (BP, MF, CC) ►Pathway / Network information ►Predictions of pathogenicity / severity NB: DAVID (Database for Annotation, Visualization and Integrated Discovery) to switch between databases https://david.ncifcrf.gov/ Introduction to Bioinformatics Genomics| Dr KONATE
- 70. DNA-Seq ‐ Analysis Take-home ‐ messages Biologicalquestion ►need to be clearly defined first, so that the design of the experiment, the library construction and the pipeline of analysis could be prepared accordingly Platfom ►Each one has its own specificities that needs to be understood before choosing one ►Different technologies, short reads (Illumina…) vs long reads (PacBio…) ►Rapidly evolving, several limitaions (PCR bias for GC rich regions…) ►Combination of different platforms possible (de novo…) Input / Output files ►Companion indexed files needed (.fa & .fai / .bam & .bai / .vcf & .vcf.idx…) ►text based (FASTA, FASTQ, SAM, GTF/GFF, BED, VCF, WIG) or binary (BAM, BCF, SFF) ►1-based ‐ (GFF/GFT, SAM/BAM, WIG) or (0-based ‐ : BED) Introduction to Bioinformatics Genomics| Dr KONATE
- 71. DNA-Seq ‐ Analysis The command-line ‐environment Understand see how these files are generated practically (no demo) Give you an idea about how to deal with these files easily once they are generated and given to you by your sequencing plateform. Make you work a bit on one specific file (a vcf file), using the command line interface (assignment). Introduction to Bioinformatics Genomics| Dr KONATE
- 72. DNA-Seq ‐ Analysis The command-line ‐environment Reminder of the command line syntax and some basic commands to manipulate files the same syntax is used for NGS analysis…but…using other specific commands (algorithms, tools…) Examples of command lines to generate or retrieve data from NGS data files using these specific commands Basic linux command lines can be useful to parse files: How to interrogate a vcf file using basic linux command lines? Introduction to Bioinformatics Genomics| Dr KONATE
- 73. DNA-Seq ‐ Analysis The command-line ‐environment The NGS datasets: reminder ►Outputs large files ►Output files contains various kinds of informations that you need to parse - ‐ fastq: quality associated to each read… - ‐ sam/bam: quality of the mapping… - ‐ vcf: variants, annotation of the effects that these variants can have… The command-line ‐ environment ►UNIX Operating System: able to deal with multi-task ‐ & multi-user ‐ needs ►i.e. can even handle multiple files at a time (useful if multiple samples) ►Brings flexibility to handle large files ►Allows to easily parse the content of a (big) file Introduction to Bioinformatics Genomics| Dr KONATE
- 74. DNA-Seq ‐ Analysis The command-line ‐environment The basic commands you have seen are useful for NGS Remember that many kind of files are generated through the NGS analysis pipeline ►So you should know at this stage the file system basics that allows you to work with many files and classify them Introduction to Bioinformatics Genomics| Dr KONATE
- 75. DNA-Seq ‐ Analysis The command-line ‐environment What you know about the command-line ‐ environment should allow you to: ►Create directories and move through file system ►At this stage you should be able to handle easily queries to parse large files - ‐ able to search for a particular pattern - ‐ able to select specific information columns Easily interrogate the large amount of information in the output files Introduction to Bioinformatics Genomics| Dr KONATE
- 76. cat view thecontent of a short file Introduction to Bioinformatics Genomics| Dr KONATE more view the content of a long file, step by step less view the content of a long file, by portions $ cat file1 $ more file1 $ less file1 DNA-Seq ‐ Analysis The command-line ‐ environment Viewing & Manipulating
- 77. head view thefirst lines of a (long) file Introduction to Bioinformatics Genomics| Dr KONATE NB: By default (without options), displays the 10 first lines tail view the last lines of a (long) file NB: By default (without options), displays the 10 last lines $ head file1 $ tail file1 DNA-Seq ‐ Analysis The command-line ‐ environment Viewing & Manipulating
- 78. cut Extract specificfields from a file $ cut -d’ ‐ ‘ -f1,2 ‐ file1 Field separator Field specifier DNA-Seq ‐ Analysis Introduction to Bioinformatics Genomics| Dr KONATE The command-line ‐ environment Viewing & Manipulating
- 79. gre p Introduction to Bioinformatics Genomics|Dr KONATE search for the occurrence of a specific pattern in a file (regular expression using the wildcards…) Careful : grep displays the whole line containing this specific pattern XXX Could be used to display all lines that DO NOT contain a specific pattern $ grep XXX file1 $ grep -v ‐ XXX file1 DNA-Seq ‐ Analysis The command-line ‐ environment Viewing & Manipulating
- 80. wc Prints differentkind of counts for a file $ wc -l ‐ file1 Prints line counts DNA-Seq ‐ Analysis Introduction to Bioinformatics Genomics| Dr KONATE The command-line ‐ environment Viewing & Manipulating
- 81. | The “|” characterallows to combine several commands, by sending the result of one command to another $ grep XXX file1 | wc -l ‐ Prints line counts instead of displaying the result on the screen DNA-Seq ‐ Analysis Introduction to Bioinformatics Genomics| Dr KONATE The command-line ‐ environment Redirecting characters
- 82. > The “>” characterallows to redirect the result of a command to a new file $ grep XXX file1 > file2 Prints line counts instead of displaying the result on the screen Redirecting characters Introduction to Bioinformatics Genomics| Dr KONATE DNA-Seq ‐ Analysis The command-line ‐ environment
- 83. DNA-Seq ‐ Analysis The command-line ‐environment Command-line ‐ syntax $ command -options arguments space space path_to_Directory/ file No capital letter Useful commands: $ man NameOfTheCommand $ pwd Introduction to Bioinformatics Genomics| Dr KONATE
- 84. FASTQ FASTQC/… SAM/BAM BWA/BOWTIE…/SAMtools VCFVCFtools/jannovar Introduction to Bioinformatics Genomics| Dr KONATE DNA-Seq ‐ Analysis The command-line ‐ environment
- 85. To run FastQC(provided it is installed): - ‐ specify the files you want to process on the command line - ‐ FastQC will generate an HTML report for each file (embeded graphs) FASTQ FASTQC/… DNA-Seq ‐ Analysis The command-line ‐ environment fastqc seqfile1 seqfile2 .. seqfileN fastqc [-o ‐ output dir] [-- ‐(no)extract] ‐ fastqc -- ‐ help ‐ -o ‐ –outdir Create all output files in the specified output directory (dir must already exist). - - ‐ extract ‐ Uncompress the zipped output file in the same dir after being created. - - ‐ noextract ‐ Do not uncompress the output file after creating it. Introduction to Bioinformatics Genomics| Dr KONATE
- 86. FASTQ FASTQC/… DNA-Seq ‐ Analysis Thecommand-line ‐ environment Trimming Trimming low Quality Bases Low quality base reads from the sequencer can cause an otherwise mappable sequence not to align different open source tools can trim off 3' bases produce a FASTQ file of the trimmed reads to use as input to the alignment program. e.g.: FASTX-Toolkit ‐ gunzip -c ‐ Sample_R1.cat.fastq.gz | fastx_trimmer -l ‐ 50 -Q ‐ 33 > trimmed.fq Trim down to 50 bases (last base is 50) option that specifies how base qualities on the 4th line of each fastq entry are encoded https://wikis.utexas.edu/ Introduction to Bioinformatics Genomics| Dr KONATE
- 87. Trimming Trimming Adapters A3' adapter contamination can cause the insert sequence not to align (adapter sequence ≠ bases at the 3' end of the reference genome sequence). Unlike general fixed-length ‐ trimming, adapter trimming removes different numbers of 3' bases depending on where the adapter sequence is found. e.g.: cutadapt FASTQ FASTQC/… https://wikis.utexas.edu/ Introduction to Bioinformatics Genomics| Dr KONATE DNA-Seq ‐ Analysis The command-line ‐ environment cutadapt -a ‐ AAAT test.fastq -o ‐ test_new.fastq cutadapt -m ‐ 22 -O ‐ 10 -a ‐ AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m22 ‐ = discard any sequence that is smaller than 22 bases after trimming -O10 ‐ = says not to trim 3' adapter sequences unless at least the first 10 bases of the adapter are seen at the 3' end of the read
- 88. DNA-Seq ‐ Analysis The command-line ‐environment SAM/BAM BWA/BOWTIE…/SAMtools http://genome.sph.umich.edu/wiki/SA M Mapped and unmapped reads are imported and stored into SAM/BAM format samtools : A suite of useful commands to visualize or get informations from .sam/.bam #from SAM to BAM conversion samtools view test.sam > test.bam # for sorting and indexing alignment samtools sort file.bam -o file.sorted.bam samtools index file.sorted.bam file.sorted.bam.bai #all reads mapping on a certain portion of chr1 or all the chr1 in another bam samtools index test.bam samtools view test.bam chr1:200000-500000 samtools view -b test.bam chr1 > Introduction to Bioinformatics Genomics| Dr KONATE
- 89. Mapped and unmappedreads are imported and stored into SAM/BAM format samtools The flagstat command provides simple statistics on a BAM file DNA-Seq ‐ Analysis The command-line ‐ environment SAM/BAM BWA/BOWTIE…/SAMtools #from SAM to BAM conversion samtools flagstat file.bam Introduction to Bioinformatics Genomics| Dr KONATE
- 90. VCF files containsinformation about variants VCF can be used as input and output file for many tools Variant calling can be done using many available tools and methods (GATK, samtools…) and the output used by many others (VCFtools, VCFminer, snpeff…) When a mapped read shows a mismatch from the reference genome is the mismatch due to a real SNP??? e.g. How does samtools detect SNPs? Samtools computes statistics to incorporate different types of information such as: - ‐ number of different reads that share a mismatch from the reference - ‐ the sequence quality data - ‐ the expected sequencing error rates DNA-Seq ‐ Analysis The command-line ‐ environment VCF VCFtools/SNPEff http://samtools.sourceforge.net/mpileup.shtml Introduction to Bioinformatics Genomics| Dr KONATE
- 91. VCF files containsinformation about variants VCF can be used as input and output file for many tools e.g.samtools & bcftools: 2 steps are required using these commands : 1.samtools - ‐ collect summary information in the input BAMs - ‐ compute the likelihood of data given each possible genotype - ‐ and store the likelihoods in the BCF format (see below). It does not call variants at this stage. 2. Bcftools - ‐ applies the prior and does the actual calling - ‐ can also concatenate BCF files, index BCFs for fast random access and convert BCF to VCF. DNA-Seq ‐ Analysis The command-line ‐ environment VCF VCFtools/jannovar http://samtools.sourceforge.net/mpileup.shtml Introduction to Bioinformatics Genomics| Dr KONATE
- 92. Suppose we have: - ‐ a reference sequence in genome.fasta, indexed by samtools faidx - ‐ position sorted alignment files aln1.sorted.bam and aln2.sorted.bam. you can call SNPs and short INDELs using: DNA-Seq ‐ Analysis The command-line ‐ environment #1.Generate a BCF file (binary data format : information about sequence variants (SNPs…) samtools mpileup -uD ‐ -f ‐ genome.fasta aln1.sorted.bam aln2.sorted.bam | bcftools view -bvcg ‐ - ‐ > file.bcf VCF -u ‐ output into an uncompressed bcf file -D ‐ keep read depth for each sample -f ‐ next argument is reference genome file -b ‐ output to BCF format -v ‐ only output potential variant sites (i.e., exclude monomorphic ones) -c ‐ do SNP calling -g ‐ call genotypes for each sample in addition to just calling SNPs VCFtools/jannovar http://samtools.sourceforge.net/mpileup.shtml Introduction to Bioinformatics Genomics| Dr KONATE
- 93. DNA-Seq ‐ Analysis The command-line ‐environment #2.Convert BCF into VCF (flat text file rather than a binary = easier to view) bcftools view file.bcf | vcfutils.pl varFilter -D100 ‐ > file.filt.vcf VCF -D100 ‐ filters out SNPs that had read depth higher than 100 Suppose we have : - ‐ a reference sequence in genome.fasta, indexed by samtools faidx - ‐ position sorted alignment files aln1.sorted.bam and aln2.sorted.bam. you can call SNPs and short INDELs using: VCFtools/jannovar http://samtools.sourceforge.net/mpileup.shtml Introduction to Bioinformatics Genomics| Dr KONATE
- 94. DNA-Seq ‐ Analysis The command-line ‐environment #Download the RefSeq transcript database for the release hg19/GRCh37. $ java -jar ‐ jannovar-cli-0.23-SNAPSHOT.jar download -d ‐ hg19/refseq #Annotate the test.vcf file $ java -jar ‐ jannovar-cli-0.23-SNAPSHOT.jar annotate-vcf -d ‐ hg19_refseq.ser -i ‐ test.vcf -o ‐ test.jv.vcf VCF VCFtools/jannovar http://charite.github.io/jannovar/ Many ways to nnotate the VCF file (vcftools, jannovar…) e.g. jannovar Jannovar identifies all transcripts affected by a given variant, and provides HGVS-compliant ‐ annotations for diiferent types of variants. Introduction to Bioinformatics Genomics| Dr KONATE
- 95. ►all these commandscan be run as part of an analysis pipeline ►all files generated can be parsed using specific tools (samtools…) ►text-based ‐ files generated can be parsed using basic linux commands ►At this stage you should be able to handle easily queries to parse large files - ‐ able to search for a particular pattern - ‐ able to select specific information columns Introduction to Bioinformatics Genomics| Dr KONATE DNA-Seq ‐ Analysis The command-line ‐ environment Assignment !
Editor's Notes
- #5 Le séquençage de l’ADN est le processus qui consiste à lire les nucléotides présents dans l’ADN, c’est-à-dire à déterminer l’ordre précis des nucléotides au sein d’une molécule d’ADN Le DNA-Seq désigne aujourd’hui, de manière générale, toute méthode ou technologie de séquençage de nouvelle génération (NGS) utilisée pour déterminer l’ordre des quatre bases (A, T, C, G) dans un brin d’ADN.
- #6 En réalité, il existe deux principaux types de technologies de séquençage de l’ADN utilisées aujourd’hui : le séquençage de Sanger et le séquençage de nouvelle génération (NGS). Chacune de ces technologies a son utilité dans le contexte actuel de l’analyse génétique.
- #7 Dans les années 1960-1970, les scientifiques étaient encore en train de comprendre comment les gènes et les génomes fonctionnent, surtout chez les virus à ARN. Le bactériophage MS2 est un virus qui infecte des bactéries (notamment Escherichia coli) et qui possède un génome à ARN simple brin (monocaténaire). 1972 – Min Jou et al. : Ces chercheurs ont séquencé pour la première fois un gène complet codant pour une protéine (celui de la protéine de la capside) d’un organisme vivant, ici un virus. C’était une étape historique dans la biologie moléculaire, car c’était la première fois que les scientifiques pouvaient lire le code génétique complet d’un gène (nucléotide par nucléotide). 1976 – Fiers et al. Ce groupe a poursuivi le travail en séquençant l’ensemble du génome du bactériophage MS2, soit 3 569 nucléotides (nt). C’était le tout premier génome complet jamais séquencé dans l’histoire de la science. Cela a permis de comprendre entièrement l’organisation génétique du virus, y compris les gènes, leur ordre, leurs séquences et leurs fonctions. En 40 ans, les techniques de séquençage sont devenues plus performantes et moins couteuses. Le développement des technologies de séquençage de nouvelle génération ou NGS (Next Generation Sequencing) durant les 10 dernières années est une révolution technologique sans précédent. Alors que le séquençage d’un seul génome humain aura nécessité 13 ans de collaborations internationales de 1990 à 2003 et 3 milliards de dollars, il est désormais possible, en l’espace de quelques semaines, voire de quelques jours, pour des coûts inférieurs à 1000 €, de séquencer l’intégralité de la région codante des 23 000 gènes humains, l’exome, représentant 34 mil lions de paires de bases de l’ADN. Le séquençage de génomes humains entiers dans un but médical (3 milliards de paires de bases) a déjà été réalisé par quelques équipes aux États-Unis, au Royaume-Uni, aux Pays-Bas et en France. Cette révolution technologique est à l’origine d’une révolution médicale : la médecine de précision ou génomique dont l’objectif est d’optimiser le diagnostic, la prévention et le traitement des maladies humaines en fonction des variations génétiques individuelles
- #8 Le Projet Génome Humain (PGH) Un effort international de 13 ans (de 1990 au 14 avril 2003) visant à séquencer les 3 milliards de "lettres" de l’ADN humain. Projet d’un coût de 300 millions de dollars, dirigé par le Département de l’Énergie des États-Unis (DoE) et les Instituts Nationaux de la Santé (NIH). Le Consortium international de séquençage du génome humain (IHGSC) regroupait des chercheurs financés par des fonds publics. À tout moment, environ 200 laboratoires aux États-Unis soutenaient ces efforts, et plus de 18 pays du monde entier ont contribué au Projet Génome Humain.
- #10 Séquençage hiérarchique par méthode shotgun Phase "shotgun" : -Le génome est fragmenté en segments plus larges -Clonage de ces segments dans des vecteurs -Séquençage des clones -Assemblage des séquences shotgun -Cette méthode repose sur la carte physique du génome humain, établie auparavant. -Phase de finition : Comblement des lacunes Résolution des séquences ambiguës d’ADN Séquençage shotgun du génome entier (Celera Genomics) Le génome est fragmenté aléatoirement en petits morceaux (de taille adaptée au séquençage) Puis, réassemblage des fragments pour reconstituer le génome.
- #11 La qualité du séquençage dépend du nombre moyen de fois que chaque base du génome est « lue » au cours du processus de séquençage. Pour le Projet Génome Humain (PGH) : Séquence brouillon : couvre environ 90 % du génome avec une précision d’environ 99,9 %. Séquence finale : couvre plus de 95 % du génome avec une précision d’environ 99,99 %. Produire une véritable séquence finale de haute qualité, selon cette définition, est très coûteux et demande beaucoup de travail. Plusieurs versions de la séquence du génome humain ont été publiées au fil du temps.
- #12 Degrés variables de complétion des génomes publiés Séquençage brouillon (Draft Sequencing) Phase shotgun ou à haut débit (approche sur l’ensemble du génome ou basée sur des clones) Assemblage à l’aide d’algorithmes spécifiques (assemblage de tout le génome ou d’un clone individuel) ➔ Précision plus faible que celle d’une séquence finalisée ; certains segments peuvent être manquants, mal ordonnés ou mal orientés. Finition (Finishing) Précision dans l’identification des bases, contrôle de qualité, et peu voire aucune lacune Les segments de séquence sont contigus, ordonnés et reliés les uns aux autres Aucune ambiguïté ni erreur d’orientation ou d’ordre des segments Génome complet (Complete Genome) Un génome représenté par une seule séquence contiguë, sans ambiguïtés ➔ Les séquences disponibles sont finalisées avec une qualité très élevée.
- #13 Le Projet Génome Humain (PGH) exigeait que toutes les informations sur les séquences du génome humain soient librement et publiquement accessibles. Les séquences d’ADN existantes ont été stockées dans des bases de données accessibles à toute personne désireuse de les exploiter et de les analyser. Des bases de données spécialisées contiennent diverses informations pour les organismes modèles, telles que les séquences de gènes et protéines connues ou hypothétiques (ex. : GenBank, NCBI). D'autres bases comme Ensembl (http://www.ensembl.org) offrent des données supplémentaires, des annotations, ainsi que des outils puissants pour visualiser et rechercher ces informations. Des efforts communautaires ont été mis en place pour les organismes non modèles, comme les pathogènes eucaryotes, via des plateformes telles que EuPathDB (http://eupathdb.org/eupathdb/). Des programmes informatiques ont été développés pour analyser et interpréter ces données.
- #14 Le génome humain ne contient qu’environ 20 000 gènes codant pour des protéines, un nombre similaire à celui des nématodes, qui ne possèdent pourtant que 1 000 cellules somatiques. Les fonctions de ces gènes sont largement orthologues entre les deux espèces (c’est-à-dire qu’elles ont des fonctions équivalentes issues d’un ancêtre commun). La proportion d’ADN non codant pour des protéines augmente avec la complexité de l’organisme, atteignant plus de 98 % chez l’humain. ➔ ENCODE ➔ GENCODE
- #15 ENCODE (https://www.encodeproject.org) Le projet ENCODE (Encyclopedia of DNA Elements) vise à fournir « une liste des éléments fonctionnels du génome humain », incluant : des éléments agissant au niveau des protéines et de l’ARN, ainsi que des éléments régulateurs qui contrôlent les cellules et les conditions dans lesquelles un gène est actif. « La création d’un tel catalogue est cruciale pour comprendre le fonctionnement du génome. » GENCODE (http://www.gencodegenes.org) Le génome humain a fait l’objet d’une annotation manuelle intensive. Le consortium GENCODE a pour objectif d’identifier toutes les caractéristiques des gènes dans les génomes humain et murin, en combinant : analyses informatiques, annotations manuelles, et validations expérimentales.
- #16 Les différences génétiques au niveau des bases individuelles d’un génome (SNPs – Single Nucleotide Polymorphisms) sont de loin le type de variation génétique le plus courant. Objectif : développer une carte des haplotypes du génome humain = identifier et cataloguer la majorité des millions de SNPs estimés comme courants dans le génome humain. Les variants décrits incluent : leur position dans le génome, leur répartition entre les individus au sein des populations, et entre les populations dans différentes régions du monde. ➔ Ce travail est conçu pour fournir des informations permettant de relier les variantes génétiques au risque de maladies spécifiques. Projet des 1000 Génomes Ce projet est devenu plus complet et plus fiable à mesure que de nombreux nouveaux variants ont été découverts !
- #17 1000 Genomes (www.1000genomes.org/) Le projet 1000 Genomes a pour objectif d'identifier la majorité des variantes génétiques ayant une fréquence d'au moins 1 %. Il s'agit d'une ressource libre d'accès sur la variation génétique humaine. Le jeu de données final inclut les données de 2 504 individus provenant de 26 populations. (séquençage à faible couverture et séquençage de l'exome pour tous). International Genome Sample Resource (IGSR) assure la pérennité de l’utilisation des données générées par le projet 1000 Genomes. UK10K (www.uk10k.org/) Le projet UK10K vise l'identification des variantes génétiques rares à travers l'étude de l'ADN de 4 000 individus et leur comparaison avec les régions codantes des protéines de 6 000 personnes atteintes de maladies documentées. Il établit des liens entre les variantes génétiques et les maladies rares.
- #18 Développement de nouvelles technologies pour augmenter la profondeur du séquençage : les technologies de séquençage de nouvelle génération (NGS) Depuis leur développement, les technologies NGS ont attiré une attention croissante en raison de leur potentiel considérable d’application en microbiologie diagnostique et en santé publique. Elles ont révolutionné le processus de séquençage, passant du séquençage Sanger au séquençage à haut débit.
- #20 Le séquençage de Sanger est la méthode développée par Frederick Sanger en 1977. Cette technique consiste à copier un brin d’ADN simple à l’aide de bases chimiquement modifiées appelées didéoxynucléotides (ddNTPs). Lorsque les ddNTPs sont incorporés à l’extrémité 3' de la chaîne en croissance, ils interrompent sélectivement l’élongation de la chaîne à la base A, C, G ou T. Les chaînes ainsi arrêtées sont ensuite séparées par électrophorèse capillaire.
- #21 Applied Biosystems (Life Technologies) a fabriqué les séquenceurs capillaires automatisés utilisés à la fois par Celera Genomics et le Projet Génome Humain. Bien que le séquençage capillaire ait été la première méthode à permettre le séquençage complet d’un génome humain, il s’est révélé trop coûteux et trop long pour une utilisation commerciale à grande échelle !!! Pour cette raison, le séquençage basé sur la technologie de Sanger a été supplanté par d'autres technologies, telles que le pyroséquençage ou le séquençage SMRT (Single Molecule Real Time)…
- #22 Le DNA-Seq est aujourd’hui utilisé comme stratégie de séquençage efficace depuis l’apparition de méthodes rapides de séquençage de l’ADN, qui ont considérablement accéléré la recherche et les découvertes en biologie et en médecine, notamment le séquençage de novo… Le DNA-Seq peut être utilisé pour déterminer la séquence de gènes individuels, de régions génétiques plus vastes, de chromosomes entiers ou même de génomes complets. Le DNA-Seq et les autres technologies apparentées dites « seq » permettent d’aborder la complexité du génome, telles que : le séquençage de l’ADN génomique (genomic DNA-Seq), le Methyl-Seq, le ChIP-Seq, le séquençage de l’exome, etc.
- #23 Le séquençage de nouvelle génération (NGS), ou séquençage à haut débit (HT), est un terme générique désignant différentes technologies modernes de séquençage utilisées par diverses plateformes, telles que : le séquençage Illumina (Solexa), le séquençage Roche 454, le séquençage Ion Torrent : Proton / PGM, etc. Ces technologies permettent de séquencer l’ADN plus rapidement et à moindre coût que le séquençage de Sanger, ce qui représente une véritable révolution pour la génomique et la biologie moléculaire.
- #25 Principes du séquençage de l’ADN : SBS (Sequencing by Synthesis) Suivi de l’ajout de nucléotides marqués lors de la copie de la chaîne d’ADN : Le brin d’ADN matrice est immobilisé. Des solutions de nucléotides A, C, G et T sont ajoutées et retirées successivement. Une lumière est émise lorsqu’un nucléotide est complémentaire à la première base non appariée. Le signal chimioluminescent est détecté pour déterminer la séquence.
- #26 La bibliothèque shotgun encadrée par des adaptateurs est amplifiée par PCR sur une cellule de flux (flow cell). Les deux amorces recouvrent la surface d’un substrat solide. Les produits d’amplification issus d’un même fragment de la bibliothèque restent localement fixés près de leur point d’origine = cluster. La PCR produit des clusters clonaux contenant des copies d’un seul brin d’ADN.
- #27 Principes du séquençage de l’ADN : Pyroséquençage L’incorporation de dNTPs par l’ADN polymérase libère du pyrophosphate (PPi). L’ATP sulfurylase convertit le PPi en ATP en présence d’APS. L’ATP sert ensuite de substrat pour la conversion de la luciférine en oxyluciférine, catalysée par la luciférase. Cette conversion génère une lumière dont l’intensité est proportionnelle à la quantité d’ATP, détectée par une caméra. Les nucléotides non incorporés et l’ATP sont dégradés par l’apyrase, permettant à la réaction de redémarrer avec un autre nucléotide.
- #28 La banque d’ADN de type shotgun, flanquée d’adaptateurs, est amplifiée par PCR dans le contexte d’une émulsion eau-dans-huile. L’amorce de PCR est fixée en 5' sur des billes de taille micrométrique. Chaque compartiment contenant une bille renferme zéro ou une molécule d’ADN matrice. Les amplicons PCR sont capturés à la surface de la bille. Une bille amplifiée de façon clonale contient des produits PCR correspondant à l’amplification d’une seule molécule issue de la banque.
- #30 Plateforme Sanger Séquenceurs capillaires 3730XL (Applied Biosystems®) Plateforme de séquençage de seconde génération (NGS) Accès à l’ensemble des plateformes basées sur la technologie Illumina (Miseq, Novaseq, etc.) Plateforme de séquençage de troisième génération GridION (Oxford Nanopore Technologies) Sequel IIe (PacBio) Plateforme de PCR quantitative et de génotypage 7900 HT (Applied Biosystem)
- #31 L'échantillon d'entrée doit être coupé en sections courtes. Les fragments sont ligaturés à des adaptateurs et hybridés sur la lame à l'aide des adaptateurs. Les fragments sont séparés en brins simples pour être séquencés. Les nucléotides sont modifiés de manière à émettre une lumière de couleur différente lorsqu'ils sont excités par un laser. De plus, ils possèdent un terminateur, de sorte qu'un seul nucléotide est ajouté à la fois. Le processus de PCR est répété en cycles, puis les images sont analysées.
- #33 Comme dans Illumina, l'ADN est fragmenté. Les adaptateurs sont ajoutés, et les extrémités sont hybridées aux billes. 1 fragment d'ADN = 1 bille. Les fragments sont amplifiés par PCR à l'aide de primers spécifiques aux adaptateurs. La séquence peut ensuite être déterminée de manière informatique. Les lectures sont plus longues que celles d'Illumina, avec des longueurs variées.
- #35 Le séquençage est effectué avec une ligase, plutôt qu'une polymérase. Chaque cycle de séquençage introduit une population partiellement dégénérée d'octamères étiquetés fluorescent. La population est structurée de manière à ce que l'étiquette soit corrélée avec l'identité des 2 bases centrales dans l'octamère. Après la ligature et l'imagerie sur quatre canaux, la portion étiquetée de l'octamère (c'est-à-dire 'zzz') est clivée, laissant une extrémité libre pour un autre cycle de ligature.
- #36 Comme dans d'autres types de NGS, l'ADN d'entrée est fragmenté. Les adaptateurs sont ajoutés et une molécule est placée sur une bille. L'amplification se fait sur la bille par PCR en émulsion. Chaque bille est placée dans un puits d'une lame. Le pH est détecté dans chacun des puits, car chaque ion H+ libéré va diminuer le pH. Les variations de pH permettent de déterminer si une base a été ajoutée à la séquence, et combien de bases ont été ajoutées. Les dNTPs sont ensuite lavés, et le processus est répété en cycles.
- #37 **Technologie de séquençage ADN à molécule unique en temps réel (SMRT) a → Une molécule de polymérase ADN est fixée au fond d'un nanopuits → Le design ZMW garantit qu'un seul nucléotide lié à un colorant peut être excité directement à la fois. b → Chaque nucléotide phospholinké incorporé restera sur le site actif de l'enzyme pendant quelques millisecondes, ce qui est suffisant pour qu'un signal fluorescent soit enregistré. NB : Dans d'autres systèmes, l'étiquette fluorescente est attachée à la base dans les nucléotides. Dans la technologie SMRT, l'étiquette fluorescente est attachée à la chaîne de phosphate → Les pentaphosphates étiquetés libérés se diffuseront rapidement.
- #38 Représentation schématique du système de séquençage par nanopore. Protéine supérieure → ssDNA. 2ème protéine Forme un nanopore dans une membrane. Contient une molécule adaptatrice qui réduit la vitesse du passage de l'ADN à travers le pore. Chaque base obstrue le flux à un degré différent. PromethION…
- #40 Vitesse Le séquençage NGS (Next-Generation Sequencing) est plus rapide que le séquençage Sanger de deux manières : La réaction chimique peut être combinée avec la détection du signal, tandis que dans le séquençage Sanger, ce sont deux processus distincts. Une seule lecture peut être effectuée à la fois dans le séquençage Sanger, tandis que le NGS est massivement parallèle. Coût Le coût du séquençage du génome humain était de 300 millions de dollars. Le séquençage d'un génome humain avec Illumina permet d'approcher le coût de 1 000 dollars attendu. Taille de l'échantillon Nécessite une quantité de départ de DNA/ARN significativement plus faible. Précision Plus de répétitions qu'avec le séquençage Sanger → une couverture plus grande, une plus grande précision et une meilleure fiabilité des séquences (les lectures individuelles sont moins précises pour le NGS).
- #44 1, Purification de l’ADN 2. Fragmentation de l'ADN L'ADN extrait est fragmenté en petits morceaux (généralement entre 150 et 500 pb) à l'aide d'un procédé mécanique (sonication) ou enzymatique. Cette étape crée des fragments d'ADN adaptés à la préparation de la bibliothèque. 3, Réparation des extrémités des fragments d'ADN Les extrémités des fragments d'ADN sont souvent irrégulières après la fragmentation, et il est nécessaire de les réparer pour qu'elles puissent être ligaturées aux adaptateurs. Ce processus inclut l'ajout de groupements chimiques spécifiques pour rendre les extrémités cohésives et compatibles avec la ligature des adaptateurs. 4. Ajout d'adaptateurs Des adaptateurs spécifiques sont ligaturés aux extrémités des fragments d'ADN. Ces adaptateurs servent de points d'ancrage pour les étapes suivantes, comme l'amplification PCR et la capture des fragments pendant le séquençage. Ils contiennent souvent des séquences uniques pour le marquage (barcoding) et des séquences nécessaires pour la fixation sur la surface du séquenceur Illumina. 5. Amplification PCR (optionnelle) Certains protocoles incluent une étape d'amplification PCR pour augmenter la quantité de la bibliothèque avant le séquençage. Cette amplification est réalisée en utilisant des amorces spécifiques qui ciblent les adaptateurs ligaturés sur les fragments. Dans le cas des kits PCR-free, cette étape est omise pour éviter les biais d'amplification. 6. Séquençage Une fois que la bibliothèque est prête, elle est chargée sur la plateforme de séquençage Illumina. La technologie Illumina permet de lire les fragments d'ADN en parallèle sur une surface de flowcell, produisant des millions de lectures pour une analyse génomique de haute couverture.
- #45 kits de préparation de bibliothèques pour le séquençage de l'ADN compatibles avec les plateformes Illumina, qui sont utilisés pour préparer des échantillons d'ADN avant de les séquencer avec des technologies de séquençage de nouvelle génération (NGS), notamment celles proposées par Illumina. Ces kits sont conçus pour différents types d'échantillons et besoins en fonction de la quantité d'ADN, du type d'ADN ciblé (par exemple, ADN mitochondrial ou ADN génomique), et des spécificités de la préparation des bibliothèques. NEXTflex™ Rapid DNA-Seq Kit : Un kit de préparation de bibliothèques pour le séquençage de l'ADN, qui nécessite entre 1 ng et 1 µg d'ADN en entrée. Ce kit est utilisé pour la préparation rapide de bibliothèques ADN pour le séquençage Illumina. NEXTflex mtDNA-Seq Kit : Un kit spécifiquement conçu pour la préparation de bibliothèques d'ADN mitochondrial, utile pour les études ciblant l'ADN mitochondrial. NEXTflex™ DNA Sequencing Kits : Un kit de préparation de bibliothèques pour le séquençage de l'ADN, nécessitant 1 µg d'ADN en entrée. NEXTflex™ PCR-Free DNA Sequencing Kit : Un kit pour la préparation de bibliothèques d'ADN sans amplification (PCR-free), utilisé lorsque l'échantillon d'ADN est de 0,5 µg à 3 µg. Ce kit permet d'éviter les biais introduits par l'amplification PCR. NEXTflex™ PCR-Free Barcodes : Des codes-barres (jusqu'à 48) pour être utilisés avec le kit PCR-Free et d'autres protocoles de séquençage de l'ADN. KAPA HyperPlus Kits : Un kit de préparation de bibliothèques pour des quantités d'ADN en entrée allant de 1 ng à 1 µg. Il permet une préparation efficace avec une large gamme de quantités d'ADN. KAPA Hyper Prep Kits : Un kit conçu pour préparer des bibliothèques d'ADN à partir de 250 ng d'ADN de tissus formol-fixés et paraffine-embed, avec moins de cycles d'amplification, permettant ainsi de réduire les taux de duplication tout en maintenant une bonne couverture du génome. Ces kits sont utilisés pour optimiser la préparation des échantillons avant leur séquençage sur des plateformes Illumina, permettant des analyses plus rapides et plus fiables des génomes.
- #46 Quantification et évaluation de la bibliothèque La concentration de la bibliothèque d'ADN est mesurée à l'aide de méthodes comme la spectrophotométrie (ex. Nanodrop), la PCR quantitative, ou les systèmes comme le Qubit pour s'assurer que la bibliothèque est prête pour le séquençage. Des contrôles de qualité supplémentaires, comme l'analyse de la taille des fragments par électrophorèse sur gel ou sur un analyseur de fragments, peuvent être effectués.
- #52 Fournis ou conçus sur mesure La concentration des adaptateurs influence la ligature, ainsi que le transfert des dimères d'adaptateurs et des adaptateurs eux-mêmes. Efficacité de ligature robuste pour des rapports molaires adaptateur : insert compris entre 10:1 et >200:1. Rapport d'adaptateurs >200:1 pour les applications à faible quantité d'entrée. Qualité des adaptateurs Nettoyage post-ligation.
- #53 Sélection de taille 300 – 400 pb ou 350 – 500 pb, après la ligation. Assure une couverture maximale de la plupart des insertions. Problème de couverture non uniforme du génome. Problème de perte de matériau. Stratégie pour se concentrer sur les longueurs de lecture lors de la préparation de l'échantillon et de la bibliothèque.
- #54 Les méthodes de sélection par double immobilisation en phase solide (SPRI) inversée permettent de remodeler la distribution des fragments d'entrée en plages bien définies. SPRI + Reverse-SPRI.
- #55 Amplifie la quantité d'ADN dans la bibliothèque Enrichit sélectivement les fragments d'ADN avec des molécules d'adaptateur aux deux extrémités. Nettoyage post-amplification.
- #56 Séquençage de l'ADN Entrée : Bibliothèque construite Génome complet Exome complet Région cible