Genomics is the study of genomes through sequencing and analysis. Key points: - Genomics involves mapping and sequencing genomes to understand genes and how they function. It uses techniques from genetics and molecular biology. - The human genome contains 23 chromosome pairs and around 24,000 genes. Genomics aims to sequence whole genomes and analyze gene function. - Early developments included identifying DNA's structure in 1953 and sequencing the first genome in the 1970s. The Human Genome Project aimed to map the entire human genome between 1990-2003. - Genomics has applications in medicine like gene therapy for genetic diseases and in understanding health, disease, and drug responses through analysis of genetic variations.

1. Genomics
Iqra sami

2. What is Genomics?
• a branch of biotechnology concerned with applying the techniques of
genetics and molecular biology to the genetic mapping and DNA sequencing
of sets of genes

3. Genomics
• The human genome typically consists of 23 pairs of chromosomes and
24,000 genes. In medicine, genome and DNA sequencing -- determining the
exact structure of a DNA molecule.

4. Genomics in genetics
• Genomics is an area within genetics that concerns the sequencing and
analysis of an organism's genome. The genome is the entire DNA content
that is present within one cell of an organism.

5. Genomics in molecular biology
The branch of molecular biology concerned with the structure, function ,
evolution and mapping of genomes.

6. Genome
• the genome is made of a chemical called DNA. The genome, contains genes
which are packaged in chromosomes and affect specific characteristics of the
organism.
• In short, the genome is divided into chromosomes, chromosomes contain
genes, and genes are made of DNA.

7. Genomics
• Genome: the complete set of genes or genetic material present in a cell or
organism.
• Gene :the hereditary unit specifying the production of discrete proteins or
enzymes of RNA molecules.
• Chromosome: DNA molecule is packaged into thread-like structures called
chromosomes. Each chromosome is made up of DNA tightly coiled many
times around proteins called histones that support its structure.

8. Who coined the term genomics?
• Genomics was coined by Tom Roderick, a geneticist at the Jackson
Laboratory (Bar Harbor, Maine)
• Genome term was coined German botanist Hans Winkler coined the term
genome in 1920 by combining the words Gene and chromosome.

9. History of genomics
• DNA was first isolated as early as 1869, with technological advances
happening in the 1950s, such as creating isotopes and radiolabel biological
molecules. Also during this time, the description of the structure of the
DNA helix was made by scientists James D. Watson and Francis H.C.
Crick in 1953.

10. History of genomics
• The history of modern genomics really starts in the 1970s when the first
genome was sequenced by biochemist Frederick Sanger. He sequenced
the genomes of a virus and mitochondrion in the early 1970s. Sanger and his
team also created techniques for sequencing, data storage, genome mapping
and more.
• Another scientist who played an important role in modern genomics is
Walter Fiers. In 1976, he and his research team from the Laboratory of
Molecular Biology of the University of Ghent in Belgium were the first to
establish the complete nucleotide sequence of a viral RNA-genome

11. History of genomics
• In 1990, the Human Genome Project, a publicly funded international genomics
research effort to determine the sequence of the human genome as well as identify
the genes it contains, was launched by the National Institutes of Health and the U.S.
Department of Energy. The goal of this group was to sequence and identify
all three billion chemical units in the human genome. The purpose of this was
to find the genetic roots of disease and help develop treatments.
• The Human Genome Project also aimed to make all human genome sequence
information freely and publicly available within 24 hours of its assembly. The
project was active for 13 years.

12. Difference between genetics and genomics
genetics
• Genetics is the study of heredity, or how
the characteristics of living organisms are
transmitted from one generation to the
next via DNA, the substance that
comprises genes, the basic unit of heredity
genomics
• Genomics, in contrast, is the study of the
entirety of an organism’s genes – called
the genome.
• Using high-performance computing and
math techniques known as bioinformatics,
genomics researchers analyze enormous
amounts of DNA-sequence data to find
variations that affect health, disease or
drug response.
• Genomics is a much newer field than
genetics

13. Genomics
• Genomics mainly relies:
• Genome sequencing
• Genome mapping
• Genome variation
• Gene therapy
• Genetic diseases.
• Human genome project.

14. Genome sequencing
• Genome sequencing is figuring out the order of DNA nucleotides, or bases,
in a genome—the order of As, Cs, Gs, and Ts that make up an organism's
DNA. The human genome is made up of over 3 billion of these genetic
letters.

15. Early efforts in genome sequencing
• Rosalind Franklin's confirmation of the helical structure of DNA
• James D. Watson and Francis Crick s publication of the structure of
DNA in 1953
• Fred Sanger s publication of the Amino acid sequence of insulin in
1955
• Marshall Nirenberg and Philip Leder revealed the triplet nature of
the genetic code and were able to determine the sequences of 54 out
of 64 codons in their experiment.

16. Genome sequencing
• The whole genome can't be sequenced all at once because available methods
of DNA sequencing can only handle short stretches of DNA at a time.
• So instead, scientists must break the genome into small pieces, sequence the
pieces, and then reassemble them in the proper order to arrive at the
sequence of the whole genome.
• Sanger method was the basis of DNA sequencing.

17. Genome sequencing
• There are two approaches for genome sequencing
• Clone by clone sequencing
• Shotgun sequencing

18. Clone by clone sequencing
• During clone-by-clone sequencing, a map of each chromosome of the genome is
made before the DNA is split up into fragments ready for sequencing.
• In clone-by-clone sequencing the genome is broken up into large chunks,
150 kilobases long (150,000 base pairs).
• the chunks are then inserted into Bacterial Artificial Chromosomes (BACs) and put
inside bacterial cells to grow.
• A bacterial artificial chromosome (BAC) is an engineered DNA molecule
used to clone DNA sequences in bacterial cells

19. Clone by clone sequencing
• The chunks of DNA are copied each time the bacteria divide to produce lots
of identical copies.
• The DNA in the individual bacterial clones is then broken down into even
smaller, overlapping fragments.
• These fragments are put into a vector that has a known DNA sequence.
• The DNA fragments are then sequenced, starting with the known sequence
of the vector and extending out into the unknown sequence of the DNA.

20. Clone by clone sequencing
• Following sequencing the small fragments of DNA are pieced together by
identifying areas of overlap to reform the large chunks that were originally
inserted into the BACs.
• This ‘assembly’ is carried out by computers which spot areas of overlap and
piece the DNA sequence together.

21. clone-by-clone
• The clone-by-clone approach was used during the 1980s and 1990s to
sequence the genomes of the nematode worm, C. elegans, and the yeast, S.
cerevisiae.

22. advantages of clone-by-clone sequencing
• Every fragment of DNA is taken from a known region of the genome, so it
is relatively easy to determine where there are any gaps in the sequence.
• Assembly is more reliable because a genome map is followed so the scientists
know where the larger fragments are in relation to each other.
• As each fragment is distinct many people can work on the genome at one
time.

23. disadvantages of clone-by-clone
sequencing?
• Making clones and generating genome maps takes a long time.
• Clone-by-clone sequencing is generally more expensive than other
sequencing methods.
• Some parts of the chromosomes, such as the centromeres, are difficult to
clone. This is because they contain long repetitive sections which makes
them difficult to cut and clone into BACs. As a result you cannot sequence
using clone-by-clone sequencing methods.

24. Genome sequencing
• Each of these approaches has advantages and disadvantages. The clone-by-clone
method is reliable but slow, and the mapping step can be especially time-
consuming. By contrast, the whole-genome shotgun method is potentially very
fast, but it can be extremely difficult to put together so many tiny pieces of
sequence all at once.
• Both approaches have already been used to sequence whole genomes. The whole-
genome shotgun method was used to sequence the genome of the
bacterium Haemophilus influenzae, while the genome of baker's
yeast, Saccharomyces cerevisiae, was sequenced with a clone-by-clone method.
Sequencing the human genome was done using both approaches.

25. Shortgun method
• .DNA is broken up randomly into numerous small segments, which are
sequenced using the chain termination method to obtain reads. Multiple
overlapping reads for the target DNA are obtained by performing several
rounds of this fragmentation and sequencing. Computer programs then use
the overlapping ends of different reads to assemble them into a continuous
sequence.
• Shotgun sequencing was one of the precursor technologies that was
responsible for enabling full genome sequencing.

26. For example, consider the following two
rounds of shotgun reads:
Strand Sequence
Original AGCATGCTGCAGTCATGCTTAGGCTA
First shotgun sequence
AGCATGCTGCAGTCATGCT-------
-------------------TAGGCTA
Second shotgun sequence
AGCATG--------------------
------CTGCAGTCATGCTTAGGCTA
Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA

27. Genome mapping
• A genome map helps scientists navigate around the genome
• Genome mapping is used to identify and record the location of genes
and the distances between genes on a chromosome. OR
• Gene mapping describes the methods used to identify the locus of
a gene and the distances between genes.
• Genome mapping provided a critical starting point for the Human Genome
Project.

28. Different types of genome mapping
• There are two general types of genome mapping called
• genetic mapping
• physical mapping.

29. Genetic mapping
• Genetic mapping looks at how genetic information is shuffled between
chromosomes or between different regions in the same chromosome
during meiosis (a type of cell division). A process called recombination or
‘crossing over.

31. Physical mapping
• Physical mapping looks at the physical distance between known DNA
sequences (including genes) by working out the number of base pairs (A-T,
C-G) between them.

33. Genome variation
• Genome variations are differences in the sequence of DNA from one
person to the next. In fact, people are unique in large part because their
genomes are unique.

34. Why is every human genome different?
• Every human genome is different because of mutations—"mistakes" that occur
occasionally in a DNA sequence. When a cell divides in two, it makes a copy of its
genome, then parcels out one copy to each of the two new cells. Theoretically, the
entire genome sequence is copied exactly, but in practice a wrong base is
incorporated into the DNA sequence every once in a while, or a base or two might
be left out or added.
• . Causes of differences between individuals include independent assortment
the exchange of genes (crossing over and recombination) during
reproduction (through meiosis and various mutational events.

35. Where are genome variations found?
• Variations are found all throughout the genome, on every one of the 46
human chromosomes
• The majority of variations are found outside of genes, in the "extra" or
"junk" DNA that does not affect a person's characteristics. Mutations in
these parts of the genome are never harmful, so variations can accumulate
without causing any problems. Genes, by contrast, tend to be stable because
mutations that occur in genes are often harmful to an individual, and thus
less likely to be passed on.

36. What kinds of genome variations are there?
• Genome variations include mutations and polymorphisms
• is a DNA variation in which each possible sequence is present in at least 1
percent of people

37. • If one of the possible sequences is present in less than 1 percent of people
(99.9 percent of people have a G and 0.1 percent have a C), then the
variation is called a mutation.
• the term mutation is often used to refer to a harmful genome variation that
is associated with a specific human disease, while the word polymorphism
implies a variation that is neither harmful nor beneficial

39. • About 90 percent of human genome variation comes in the form of single
nucleotide polymorphisms, or SNPs (pronounced "snips"). As their name
implies, these are variations that involve just one nucleotide, or base. Any one
of the four DNA bases may be substituted for any other—an A instead of a
T, a T instead of a C, a G instead of an A, and so on.

40. Human genome project
• The Human Genome Project (HGP) was the international, collaborative
research program whose goal was the complete mapping and understanding
of all the genes of human beings. All our genes together are known as our
"genome.“
• The HGP has revealed that there are probably about 20,500 human genes.
• James Watson was appointed to lead the NIH component, which was
dubbed the Office of Human Genome Research.

41. • HGP researchers deciphered the human genome in three major ways:
determining the order, or "sequence," of all the bases in our genome's
DNA; making maps that show the locations of genes for major sections
of all our chromosomes; and producing what are called linkage maps,
through which inherited traits (such as those for genetic disease) can be
tracked over generations.

42. Types of genomics
• Structural genomics: Aims to determine the structure of every protein
encoded by the genome.
• Functional genomics: Aims to collect and use data from sequencing for
describing gene and protein functions.

43. Types of genomics
• Comparative genomics: Aims to compare genomic features between
different species.
• Mutation genomics: Studies the genome in terms of mutations that occur
in a person's DNA or genome.

44. Types of genomics
• Epigenomics is the study of the complete set of epigenetic modifications
on the genetic material of a cell, known as the epigenome
• Epigenome is the complete description of all the chemical modifications to
DNA and histone proteins that regulate the expression of genes within the
genome.

45. Types of genomics
• Metagenomics is the study of metagenomes, genetic material recovered
directly from environmental samples. The broad field may also be referred to
as environmental genomics, eco genomics or community genomics.
• OR
• the collective genome of microorganisms from an environmental sample—
to provide information on the microbial diversity and ecology of a specific
environment.

46. Scope of genomics
• The field of genomics can be subdivided into a number of areas. For
instance, comparative genomics involves comparing the genomes of
different organisms. Comparative genomics can be used to define important
structural sequences that are identical in many genomes and to detect
evolutionary changes across genomes. Structural genomics involves the
physical nature of genomes and includes the sequencing and mapping of
genomes. Functional genomics involves studying the expression and
function of the genome. Genomics can also involve the investigation
of interactions between genes and between genes and the environment.

47. Applications of genomics.
• What genomics is used for
• There are many applications for human genetics in medicine, biotechnology,
anthropology and other social sciences.
• Application of genomics:
• Gene therapy to cure genetics diseases

48. Genetic diseases
• A genetic disorder is a disease caused in whole or in part by a change in the
DNA sequence away from the normal sequence. Genetic disorders can be
caused by a mutation in one gene (monogenic disorder), by mutations in
multiple genes (multifactorial inheritance disorder), by a combination of
gene mutations and environmental factors, or by damage to chromosomes
(changes in the number or structure of entire chromosomes, the structures
that carry genes).

49. types of genetic disorders
• There are a number of different types of genetic disorders (inherited),
including the following:
• Single gene inheritance sickle cell anemia
• Multifactorial inheritance diabetes
• Chromosome abnormalities Klinefelter syndrome
• Mitochondrial inheritance dementia

50. Gene therapy
• Gene therapy is an experimental technique that uses genes to treat or prevent
disease. In the future, this technique may allow doctors to treat a disorder by
inserting a gene into a patient’s cells instead of using drugs or surgery. Researchers
are testing several approaches to gene therapy, including:
• Replacing a mutated gene that causes disease with a healthy copy of the
gene.
• Inactivating, or “knocking out,” a mutated gene that is functioning
improperly.
• Introducing a new gene into the body to help fight a disease.

51. Thanks