Information is no longer a bottleneck, emphasis is shifting to the ‘what does it all mean’
In a translational context we hope that by answering that question we will be able to is to characterise the genetics that drive disease, and indeed develop drugs and diagnostics that are personalised to patients.
Genome editing provides the link between the information here, and this outcome here, by allowing scientists to recapitulate specific genetic alterations in any gene in any living tissue to probe function, develop disease models and identify therapeutic strategies. So, not only do we now have unparalleled access to genetic information, but we now have the tools to most accuartely understand what this genetic information – with genome editing allowing us to explore the genetic drivers of disease in physiological models.
AAV is a single-stranded, linear DNA virus with a a 4.7 kb genome which for the purpose of genome editing is replaced almost in entirety with the targeting vector sequence (except for the iTRs)
It is in effect a highly effective DNA delivery mechanism
After entry of the vector into the cell, target-specific homologous DNA is believed to activate and recruit HR-dependent repair factors can induce HR at rates approximately 1,000 times greater than plasmid based double stranded DNA vectors, but the mechanism by which it achieves this is still largely unknown
By including a selection cassette can select for cells that have integrated the targeting vector, and then screen for clones which have undergone targeted insetion rather than random integration, which will generally be around 1%.
Genome engineering using CRISPR/Cas9 has several advantages over traditional gene targeting methods: it is faster, more precise, applicable to many species, and less expensive. CRISPR/Cas9 uses the Cas9 nuclease guided by a single guide RNA to introduce double-strand breaks at targeted genomic loci. This can generate gene knockouts through error-prone non-homologous end joining or allow for targeted insertions and modifications through homology-directed repair. While CRISPR/Cas9 has great potential, careful design of guide RNAs and donor templates is needed to minimize off-target effects.
GENESIS™: Comprehensive genome editing - Translating genetic information into personalised medicines.
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined. Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
Speaker: Benedict C. S. Cross, PhD, Team leader (Discovery Screening), Horizon Discovery
CRISPR–Cas9 mediated genome editing provides a highly efficient way to probe gene function. Using this technology, thousands of genes can be knocked out and their function assessed in a single experiment. We have conducted over 150 of these complex and powerful screens and will use our experience to guide you through the process of screen design, performance and analysis.
We'll be discussing:
• How to use CRISPR screening for target ID and validation, understanding drug MOA and patient stratification
• The screen design, quality control and how to evaluate success of your screening program
• Horizon’s latest developments to the platform
• Horizon’s novel approaches to target validation screening
Dr. Chris Lowe presented on Horizon Discovery's precision genome editing platform called GENESISTM. The presentation discussed optimizing GENESISTM by combining CRISPR and rAAV technologies to improve gene targeting efficiency. Custom cell line development services are offered to modify genes of interest in various cell lines for applications such as generating disease models and studying drug sensitivity. Key considerations for successful gene editing experiments include factors like gene/cell line selection, gRNA design/activity, donor design, screening/validation approaches. Case studies demonstrated applications of engineered cell lines.
The document discusses CRISPR-Cas9 genome editing. It begins by explaining why genome editing is useful for applications like disease modeling, gene therapy, and agriculture. It then provides details on the CRISPR-Cas9 system, describing how it uses the Cas9 enzyme guided by a short RNA to introduce targeted double-stranded breaks in DNA. The document outlines several uses of CRISPR-Cas9 in research, including generating animal models of disease and correcting genetic defects in human cells and stem cells. It also discusses approaches for screening mammalian cells using libraries of guide RNAs to induce mutations.
The CRISPR/Cas9 system has emerged as one of the leading tools for modifying genomes of organisms ranging from E. coli to humans. Additionally, the simple gene targeting mechanism of CRISPR technology has been modified and adapted to other applications that include gene regulation, detection of intercellular trafficking, and pathogen detection. With a wealth of methods for introducing Cas9 and gRNAs into cells, it can be challenging to decide where to start. In this presentation, Dr Adam Clore describes the CRISPR mechanism and some of the most prominent uses for CRISPR, along with methods where IDT technologies can assist scientists in designing, testing, and executing a variety of CRISPR-mediated experiments. For more informaton, visit: http://www.idtdna.com/crispr
CRISPR is a family of DNA sequences found within the genomes of prokaryotic organisms such as bacteria and archaea. These sequences are derived from DNA fragments from viruses that have previously infected the prokaryote and are used to detect and destroy DNA from similar viruses during subsequent infections.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
Genome engineering using CRISPR/Cas9 has several advantages over traditional gene targeting methods: it is faster, more precise, applicable to many species, and less expensive. CRISPR/Cas9 uses the Cas9 nuclease guided by a single guide RNA to introduce double-strand breaks at targeted genomic loci. This can generate gene knockouts through error-prone non-homologous end joining or allow for targeted insertions and modifications through homology-directed repair. While CRISPR/Cas9 has great potential, careful design of guide RNAs and donor templates is needed to minimize off-target effects.
GENESIS™: Comprehensive genome editing - Translating genetic information into personalised medicines.
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined. Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
Speaker: Benedict C. S. Cross, PhD, Team leader (Discovery Screening), Horizon Discovery
CRISPR–Cas9 mediated genome editing provides a highly efficient way to probe gene function. Using this technology, thousands of genes can be knocked out and their function assessed in a single experiment. We have conducted over 150 of these complex and powerful screens and will use our experience to guide you through the process of screen design, performance and analysis.
We'll be discussing:
• How to use CRISPR screening for target ID and validation, understanding drug MOA and patient stratification
• The screen design, quality control and how to evaluate success of your screening program
• Horizon’s latest developments to the platform
• Horizon’s novel approaches to target validation screening
Dr. Chris Lowe presented on Horizon Discovery's precision genome editing platform called GENESISTM. The presentation discussed optimizing GENESISTM by combining CRISPR and rAAV technologies to improve gene targeting efficiency. Custom cell line development services are offered to modify genes of interest in various cell lines for applications such as generating disease models and studying drug sensitivity. Key considerations for successful gene editing experiments include factors like gene/cell line selection, gRNA design/activity, donor design, screening/validation approaches. Case studies demonstrated applications of engineered cell lines.
The document discusses CRISPR-Cas9 genome editing. It begins by explaining why genome editing is useful for applications like disease modeling, gene therapy, and agriculture. It then provides details on the CRISPR-Cas9 system, describing how it uses the Cas9 enzyme guided by a short RNA to introduce targeted double-stranded breaks in DNA. The document outlines several uses of CRISPR-Cas9 in research, including generating animal models of disease and correcting genetic defects in human cells and stem cells. It also discusses approaches for screening mammalian cells using libraries of guide RNAs to induce mutations.
The CRISPR/Cas9 system has emerged as one of the leading tools for modifying genomes of organisms ranging from E. coli to humans. Additionally, the simple gene targeting mechanism of CRISPR technology has been modified and adapted to other applications that include gene regulation, detection of intercellular trafficking, and pathogen detection. With a wealth of methods for introducing Cas9 and gRNAs into cells, it can be challenging to decide where to start. In this presentation, Dr Adam Clore describes the CRISPR mechanism and some of the most prominent uses for CRISPR, along with methods where IDT technologies can assist scientists in designing, testing, and executing a variety of CRISPR-mediated experiments. For more informaton, visit: http://www.idtdna.com/crispr
CRISPR is a family of DNA sequences found within the genomes of prokaryotic organisms such as bacteria and archaea. These sequences are derived from DNA fragments from viruses that have previously infected the prokaryote and are used to detect and destroy DNA from similar viruses during subsequent infections.
CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9
This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
Recent breakthroughs in genome editing technology have led to a rapid adoption that parallels that seen with RNAi. And like RNAi, these methods are taking the scientific world by storm, with high profile publications in fields as diverse as HIV treatment, stem cell therapy, food crop modification and drug development to name but a few.
Critically, the endogenous modification of genes enables the study of their function in a physiological context. It also overcomes some of the artefacts that can result from established techniques such as transgenesis and RNAi, which have mislead researchers with false positives or negatives. Until recently however genome editing required considerable technical expertise, and consequently was a relatively niche pursuit.
In this talk we will look at how the latest developments in genome editing tools have changed this, with improvements in both ease-of-use and targeting efficiency, as well as a concomitant reduction in costs opening up these approaches to the wider scientific community.
Rapid adoption of the CRISPR/Cas9 system has for example led to a long list of organisms and tissues in which genetic changes have been made with high efficiency. Other technologies such as recombinant adeno-associated virus (rAAV) offer further precision, stimulating the cell’s high-fidelity DNA repair pathways to insert exogenous sequence with unrivalled specificity. Targeting efficiency can be improved still further by using the technologies in combination – genome cutting induced by CRISPR can significantly enhance homologous recombination mediated by rAAV.
Despite these rapid advances, some pitfalls remain, and so we’ll discuss some of the key considerations for avoiding these, ranging from simply picking the right tool for the job to designing an experiment that maximises chances of success.
Finally we’ll look at how genome editing is being applied to both basic and translational research, and in both a gene-specific and genome wide manner. For the study of disease associated genes and mutations scientists can now complement wide panels of tumour cells with genetically defined isogenic cell pairs identical in all but precise modifications in their gene of interest. The ease-of-design and efficiency of the CRISPR system is also being exploited for genome wide synthetic lethality screens, facilitating rapid drug target identification with significantly reduced risk of false negatives and off-target false positives. And again, further synergies are achieved when these approaches are combined to look for potential synthetic lethal targets in specific genomic contexts.
An Introduction to Crispr Genome Editing
Crispr cas: A new tool of genome editing
CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) are part of an adaptive defense mechanism in bacteria and archaea. Use of the CRISPR/Cas9 system for genome editing has been a major technological breakthrough, making genome modification in cells or organisms fast, more efficient, and much more robust than previous genome editing methods. Single guide RNAs (sgRNAs) or guide RNAs (gRNAs) direct and activate the Cas9 endonuclease at a specific genomic sequence. Cas9 then cleaves the target DNA, making it available for repair by the non-homologous end joining (NHEJ) system or for creating an insertion site for exogenous donor DNA by homologous recombination.
Lessons learned from high throughput CRISPR targeting in human cell linesChris Thorne
In just a short period of time CRISPR-Cas9 technology has revolutionized the field of genome editing, and taken the scientific community by storm. Already our understanding of how best to apply this technology has advanced significantly and almost every week new publications appear showcasing its application in basic and translational research.
While CRISPR-Cas9 is applicable across many different cell types, we have found it particularly suited for genome editing in near-haploid human cell lines. This has allowed us to establish a robust pipeline for the inactivation of non-essential genes at unprecedented scale and efficiency.
We have now knocked out over 1500 human genes and have generated a resource that is, to the best of our knowledge, the largest collection of human knockout cell lines available, covering comprehensive subsets of genes clustered by biological pathway (e.g. the autophagy pathway, the JAK/STAT pathway) or by phylogenetic relationship (e.g. kinases, bromodomain-containing proteins).
In this talk we will discuss how, through more than 1500 genome editing experiments, we have started to unravel some of the general principles governing the use of CRISPR-Cas9 in mammalian cells. For example, we have analyzed the impact of variation in the guide RNA sequence on Cas9 cleavage efficiency and characterized the mutational signature arising from CRISPR-Cas9 cleavage.
We will also highlight (with examples) how these learnings are now being applied to introduce other genomic modifications in a high throughput manner, including chromosomal deletions, translocations, point mutations and endogenous gene tags.
CRISPR-Cas9 Review: A potential tool for genome editingDavient Bala
The document discusses CRISPR-Cas9 as a potential tool for genome editing. It describes how CRISPR was originally discovered in bacteria and archaea as a mechanism for adaptive immunity against viruses. The CRISPR-Cas9 system uses guide RNA to direct an endonuclease called Cas9 to introduce targeted double-strand breaks in DNA, which can then be repaired through non-homologous end joining or homology directed repair for genome editing. Applications discussed include using CRISPR-Cas9 for disease modeling in animals and cell lines more efficiently compared to previous methods, as well as for drug development by generating gene knockouts and mutations for target validation.
CRISPR-Revolutionary Genome editing tools for Plants.....BHU,Varanasi, INDIA
CRISPR/Cas9 is a revolutionary genome editing tool discovered in bacterial immune systems. It provides acquired immunity against viruses and phages. CRISPR components include crRNA, tracrRNA, and Cas9 protein. There is an ongoing patent war over CRISPR between major scientists and institutions. CRISPR has been used to successfully edit plant genomes and develop disease resistant and drought tolerant crops like rice, cotton, wheat, and maize. It also shows promise for developing virus resistant varieties and removing unwanted plant species. CRISPR's applications extend to human health by potentially destroying cancer cells and disabling viruses like HIV.
CRISPR: what it is, and why it is having a profound impact on human healthPistoia Alliance
This document summarizes a webinar on CRISPR that included presentations from experts in gene editing and bioinformatics. The webinar provided an overview of CRISPR and how it works using the Cas9 enzyme and guide RNA to make precise cuts in DNA. It discussed how CRISPR is being used for gene knockout studies, clinical trials to treat diseases like cystic fibrosis and cancer, and the challenges of predicting off-target effects. The webinar highlighted both the promise and challenges of CRISPR for accelerating scientific discovery and developing new gene therapies.
Application of crispr in cancer therapykamran javidi
Many bacterial clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) systems employ the dual RNA–guided DNA endonuclease Cas9 to defend against invading phages and conjugative plasmids by introducing site-specific double-stranded breaks in target DNA. Target recognition strictly requires the presence of a short protospacer adjacent motif (PAM) flanking the target site, and subsequent R-loop formation and strand scission are driven by complementary base pairing between the guide RNA and target DNA, Cas9–DNA interactions, and associated conformational changes. The use of CRISPR–Cas9 as an RNA-programmable
DNA targeting and editing platform is simplified by a synthetic single-guide RNA (sgRNA) mimicking the natural dual trans-activating CRISPR RNA (tracrRNA)–CRISPR RNA (crRNA) structure
(1) CRISPR-Cas9 is a new genetic editing technique that allows easier correction of faulty genes. It has potential for treating genetic diseases but also raises ethical concerns.
(2) The document discusses using CRISPR-Cas9 to edit somatic/adult cells (acceptable) vs germline/embryonic cells (controversial). Editing germline cells could affect future generations and paves the way for "designer babies".
(3) The proposed position is to continue CRISPR-Cas9 research on animals and adult cells but support a moratorium on human germline/embryonic editing and a permanent ban due to safety issues and concerns about human
The document provides an overview of the CRISPR/Cas9 gene editing technology. It discusses the history and components of the CRISPR system, how it works, applications in various fields like microbiology, biomedicine, agriculture, and therapeutics. Recent advances expand its use for transcriptional regulation, epigenetic editing, and live imaging. While powerful, it faces challenges like off-target effects that require further research to optimize its safe and ethical application.
CRISPR-Cas9 is a powerful gene editing tool that has promising applications in public health. It allows targeted editing of genes and could help treat diseases like HIV/AIDS, cancer, and antibiotic resistance. However, there are also ethical concerns about its use, such as off-target effects and questions around human enhancement. Going forward, CRISPR holds potential for developing new therapies and improving agriculture, but its applications will require addressing safety, consent, and access issues.
CRISPR / Cas9 has become the most popular system for in vitro genome editing, but the in vivo gene editing method is still limited by the Cas9 import problem.
This document summarizes Jai Kishan's presentation on gene manipulation techniques. It discusses conventional plant breeding, mutation breeding, transgenic plants, and several precise gene editing techniques like ZFN, TALENs, and CRISPR-Cas9. CRISPR-Cas systems provide adaptive immunity in bacteria and archaea by recognizing foreign DNA. The document then reviews the history and components of the CRISPR-Cas system and its applications in cancer therapy, viral diseases, bacterial infections, and genetic disorders. It also discusses challenges like delivery methods, mosaicism, immune responses, and off-target mutations. Key references on the discovery of CRISPR and its use in agriculture and as a genetic manipulation tool are presented.
An Introduction to Crispr Genome EditingChris Thorne
In this short presentation, I make a case for doing genome editing vs some of the approaches that have gone before, describe some of the tools available, and the focus on CRISPR-Cas9, what it is, where it's come from and how it works.
CRISPR in crop Improvement, CRISPR/Cas Genome editing toolParthasarathiG2
This document discusses the use of CRISPR-Cas9 genome editing in crop improvement. It begins with an introduction to CRISPR-Cas9 and its mechanism of action. It then discusses the discovery of CRISPR and key scientists involved. Several case studies on using CRISPR to edit rice genes for disease resistance and hybrid seed production are summarized. Achievements using CRISPR in rice, horticulture crops, and other field crops are briefly outlined. The document concludes that CRISPR provides a simple and efficient tool for genome editing in plants.
CRISPR-Cas9 is a unique technology that enables geneticists and medical researchers to edit parts of the genome by removing, adding or altering sections of the DNA sequence.
It is currently the simplest, most versatile and precise method of genetic manipulation and is therefore causing a buzz in the science world.
Institute of Learning in Retirement - Miami University (Ohio)Andor Kiss
CRISPR/Cas9 is a new genetic engineering technique that uses a bacterial immune system to edit DNA. It involves using an RNA guide sequence and Cas9 protein to cut DNA at a targeted location. This allows genes to be knocked out or altered. CRISPR has many advantages over older techniques and has greatly improved efficiency of genetic engineering. However, it also raises ethical concerns about its applications, including the first reported use in human embryos.
This document provides an overview of CRISPR/Cas9 genome editing. It discusses the history and limitations of prior genome engineering techniques like recombinant DNA and zinc finger nucleases. It then explains how CRISPR/Cas9 works as a RNA-guided DNA endonuclease and how this allows it to efficiently and specifically edit genomes. The document outlines several applications of CRISPR/Cas9 like generating knockout animals and cell lines. It also notes some concerns about using the technique for human genome editing.
This document provides an overview of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and its role as an adaptive immune system in prokaryotes. It describes the components and function of the CRISPR-Cas system, including how it provides immunity against viruses and plasmids. Applications of CRISPR technology discussed include phage resistance in bacteria, gene regulation, and bacterial strain typing. Potential future uses involve harnessing CRISPR biology for applications like transcriptional control.
Recent breakthroughs in genome editing technology have led to a rapid adoption that parallels that seen with RNAi. And like RNAi, these methods are taking the scientific world by storm, with high profile publications in fields as diverse as HIV treatment, stem cell therapy, food crop modification and drug development to name but a few.
Critically, the endogenous modification of genes enables the study of their function in a physiological context. It also overcomes some of the artefacts that can result from established techniques such as transgenesis and RNAi, which have mislead researchers with false positives or negatives. Until recently however genome editing required considerable technical expertise, and consequently was a relatively niche pursuit.
In this talk we will look at how the latest developments in genome editing tools have changed this, with improvements in both ease-of-use and targeting efficiency, as well as a concomitant reduction in costs opening up these approaches to the wider scientific community.
Rapid adoption of the CRISPR/Cas9 system has for example led to a long list of organisms and tissues in which genetic changes have been made with high efficiency. Other technologies such as recombinant adeno-associated virus (rAAV) offer further precision, stimulating the cell’s high-fidelity DNA repair pathways to insert exogenous sequence with unrivalled specificity. Targeting efficiency can be improved still further by using the technologies in combination – genome cutting induced by CRISPR can significantly enhance homologous recombination mediated by rAAV.
Despite these rapid advances, some pitfalls remain, and so we’ll discuss some of the key considerations for avoiding these, ranging from simply picking the right tool for the job to designing an experiment that maximises chances of success.
Finally we’ll look at how genome editing is being applied to both basic and translational research, and in both a gene-specific and genome wide manner. For the study of disease associated genes and mutations scientists can now complement wide panels of tumour cells with genetically defined isogenic cell pairs identical in all but precise modifications in their gene of interest. The ease-of-design and efficiency of the CRISPR system is also being exploited for genome wide synthetic lethality screens, facilitating rapid drug target identification with significantly reduced risk of false negatives and off-target false positives. And again, further synergies are achieved when these approaches are combined to look for potential synthetic lethal targets in specific genomic contexts.
An Introduction to Crispr Genome Editing
Crispr cas: A new tool of genome editing
CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) are part of an adaptive defense mechanism in bacteria and archaea. Use of the CRISPR/Cas9 system for genome editing has been a major technological breakthrough, making genome modification in cells or organisms fast, more efficient, and much more robust than previous genome editing methods. Single guide RNAs (sgRNAs) or guide RNAs (gRNAs) direct and activate the Cas9 endonuclease at a specific genomic sequence. Cas9 then cleaves the target DNA, making it available for repair by the non-homologous end joining (NHEJ) system or for creating an insertion site for exogenous donor DNA by homologous recombination.
Lessons learned from high throughput CRISPR targeting in human cell linesChris Thorne
In just a short period of time CRISPR-Cas9 technology has revolutionized the field of genome editing, and taken the scientific community by storm. Already our understanding of how best to apply this technology has advanced significantly and almost every week new publications appear showcasing its application in basic and translational research.
While CRISPR-Cas9 is applicable across many different cell types, we have found it particularly suited for genome editing in near-haploid human cell lines. This has allowed us to establish a robust pipeline for the inactivation of non-essential genes at unprecedented scale and efficiency.
We have now knocked out over 1500 human genes and have generated a resource that is, to the best of our knowledge, the largest collection of human knockout cell lines available, covering comprehensive subsets of genes clustered by biological pathway (e.g. the autophagy pathway, the JAK/STAT pathway) or by phylogenetic relationship (e.g. kinases, bromodomain-containing proteins).
In this talk we will discuss how, through more than 1500 genome editing experiments, we have started to unravel some of the general principles governing the use of CRISPR-Cas9 in mammalian cells. For example, we have analyzed the impact of variation in the guide RNA sequence on Cas9 cleavage efficiency and characterized the mutational signature arising from CRISPR-Cas9 cleavage.
We will also highlight (with examples) how these learnings are now being applied to introduce other genomic modifications in a high throughput manner, including chromosomal deletions, translocations, point mutations and endogenous gene tags.
CRISPR-Cas9 Review: A potential tool for genome editingDavient Bala
The document discusses CRISPR-Cas9 as a potential tool for genome editing. It describes how CRISPR was originally discovered in bacteria and archaea as a mechanism for adaptive immunity against viruses. The CRISPR-Cas9 system uses guide RNA to direct an endonuclease called Cas9 to introduce targeted double-strand breaks in DNA, which can then be repaired through non-homologous end joining or homology directed repair for genome editing. Applications discussed include using CRISPR-Cas9 for disease modeling in animals and cell lines more efficiently compared to previous methods, as well as for drug development by generating gene knockouts and mutations for target validation.
CRISPR-Revolutionary Genome editing tools for Plants.....BHU,Varanasi, INDIA
CRISPR/Cas9 is a revolutionary genome editing tool discovered in bacterial immune systems. It provides acquired immunity against viruses and phages. CRISPR components include crRNA, tracrRNA, and Cas9 protein. There is an ongoing patent war over CRISPR between major scientists and institutions. CRISPR has been used to successfully edit plant genomes and develop disease resistant and drought tolerant crops like rice, cotton, wheat, and maize. It also shows promise for developing virus resistant varieties and removing unwanted plant species. CRISPR's applications extend to human health by potentially destroying cancer cells and disabling viruses like HIV.
CRISPR: what it is, and why it is having a profound impact on human healthPistoia Alliance
This document summarizes a webinar on CRISPR that included presentations from experts in gene editing and bioinformatics. The webinar provided an overview of CRISPR and how it works using the Cas9 enzyme and guide RNA to make precise cuts in DNA. It discussed how CRISPR is being used for gene knockout studies, clinical trials to treat diseases like cystic fibrosis and cancer, and the challenges of predicting off-target effects. The webinar highlighted both the promise and challenges of CRISPR for accelerating scientific discovery and developing new gene therapies.
Application of crispr in cancer therapykamran javidi
Many bacterial clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) systems employ the dual RNA–guided DNA endonuclease Cas9 to defend against invading phages and conjugative plasmids by introducing site-specific double-stranded breaks in target DNA. Target recognition strictly requires the presence of a short protospacer adjacent motif (PAM) flanking the target site, and subsequent R-loop formation and strand scission are driven by complementary base pairing between the guide RNA and target DNA, Cas9–DNA interactions, and associated conformational changes. The use of CRISPR–Cas9 as an RNA-programmable
DNA targeting and editing platform is simplified by a synthetic single-guide RNA (sgRNA) mimicking the natural dual trans-activating CRISPR RNA (tracrRNA)–CRISPR RNA (crRNA) structure
(1) CRISPR-Cas9 is a new genetic editing technique that allows easier correction of faulty genes. It has potential for treating genetic diseases but also raises ethical concerns.
(2) The document discusses using CRISPR-Cas9 to edit somatic/adult cells (acceptable) vs germline/embryonic cells (controversial). Editing germline cells could affect future generations and paves the way for "designer babies".
(3) The proposed position is to continue CRISPR-Cas9 research on animals and adult cells but support a moratorium on human germline/embryonic editing and a permanent ban due to safety issues and concerns about human
The document provides an overview of the CRISPR/Cas9 gene editing technology. It discusses the history and components of the CRISPR system, how it works, applications in various fields like microbiology, biomedicine, agriculture, and therapeutics. Recent advances expand its use for transcriptional regulation, epigenetic editing, and live imaging. While powerful, it faces challenges like off-target effects that require further research to optimize its safe and ethical application.
CRISPR-Cas9 is a powerful gene editing tool that has promising applications in public health. It allows targeted editing of genes and could help treat diseases like HIV/AIDS, cancer, and antibiotic resistance. However, there are also ethical concerns about its use, such as off-target effects and questions around human enhancement. Going forward, CRISPR holds potential for developing new therapies and improving agriculture, but its applications will require addressing safety, consent, and access issues.
CRISPR / Cas9 has become the most popular system for in vitro genome editing, but the in vivo gene editing method is still limited by the Cas9 import problem.
This document summarizes Jai Kishan's presentation on gene manipulation techniques. It discusses conventional plant breeding, mutation breeding, transgenic plants, and several precise gene editing techniques like ZFN, TALENs, and CRISPR-Cas9. CRISPR-Cas systems provide adaptive immunity in bacteria and archaea by recognizing foreign DNA. The document then reviews the history and components of the CRISPR-Cas system and its applications in cancer therapy, viral diseases, bacterial infections, and genetic disorders. It also discusses challenges like delivery methods, mosaicism, immune responses, and off-target mutations. Key references on the discovery of CRISPR and its use in agriculture and as a genetic manipulation tool are presented.
An Introduction to Crispr Genome EditingChris Thorne
In this short presentation, I make a case for doing genome editing vs some of the approaches that have gone before, describe some of the tools available, and the focus on CRISPR-Cas9, what it is, where it's come from and how it works.
CRISPR in crop Improvement, CRISPR/Cas Genome editing toolParthasarathiG2
This document discusses the use of CRISPR-Cas9 genome editing in crop improvement. It begins with an introduction to CRISPR-Cas9 and its mechanism of action. It then discusses the discovery of CRISPR and key scientists involved. Several case studies on using CRISPR to edit rice genes for disease resistance and hybrid seed production are summarized. Achievements using CRISPR in rice, horticulture crops, and other field crops are briefly outlined. The document concludes that CRISPR provides a simple and efficient tool for genome editing in plants.
CRISPR-Cas9 is a unique technology that enables geneticists and medical researchers to edit parts of the genome by removing, adding or altering sections of the DNA sequence.
It is currently the simplest, most versatile and precise method of genetic manipulation and is therefore causing a buzz in the science world.
Institute of Learning in Retirement - Miami University (Ohio)Andor Kiss
CRISPR/Cas9 is a new genetic engineering technique that uses a bacterial immune system to edit DNA. It involves using an RNA guide sequence and Cas9 protein to cut DNA at a targeted location. This allows genes to be knocked out or altered. CRISPR has many advantages over older techniques and has greatly improved efficiency of genetic engineering. However, it also raises ethical concerns about its applications, including the first reported use in human embryos.
This document provides an overview of CRISPR/Cas9 genome editing. It discusses the history and limitations of prior genome engineering techniques like recombinant DNA and zinc finger nucleases. It then explains how CRISPR/Cas9 works as a RNA-guided DNA endonuclease and how this allows it to efficiently and specifically edit genomes. The document outlines several applications of CRISPR/Cas9 like generating knockout animals and cell lines. It also notes some concerns about using the technique for human genome editing.
This document provides an overview of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and its role as an adaptive immune system in prokaryotes. It describes the components and function of the CRISPR-Cas system, including how it provides immunity against viruses and plasmids. Applications of CRISPR technology discussed include phage resistance in bacteria, gene regulation, and bacterial strain typing. Potential future uses involve harnessing CRISPR biology for applications like transcriptional control.
Infusing genomics in hybrid breeding program of pigeonpea (Cajanus cajan)ICRISAT
Pigeonpea is an important pulse crop, well-suited for rainfed and semi-arid cropping system. The released draft genome sequence and
commercial cytoplasmic nuclear male sterility (CMS)-based hybrids has been the significant contributions of ICRISAT.
30 June 2015
Genetic Recording in Yeast Using CRISPR-Cas9Robert Beem
This document describes a study on using CRISPR/Cas9 for genome editing in yeast (Saccharomyces cerevisiae). The goal was to analyze the activity of self-targeting guide RNAs (stgRNAs) in yeast. Methods included constructing plasmids containing Cas9 and an stgRNA in E. coli, then integrating them into the yeast genome using homologous recombination. Activity was assayed using a T7 endonuclease assay to detect mutations from Cas9 cutting the target sequence. Results showed the stgRNA was effective in yeast and that Cas9 was active even at low levels due to leaky expression from the inducible promoter. Future applications could include protein engineering and gene therapy research
There are different strategies bacterial cells use to survive. Differentiation can be occasionally one of them. Although differentiation can occur in the bacterial life cycle, it is a strategy to adapt themselves to harsh environments.
The document discusses various gene editing technologies. It begins by introducing genome/gene editing as a type of genetic engineering that uses engineered nucleases to precisely modify genomes by creating DNA insertions, deletions, or replacements at specific DNA sequences. It then describes three main gene editing systems - zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 system. For each system, it provides details on the nuclease domains, methods for engineering DNA binding specificity, and mechanisms for creating DNA double strand breaks to facilitate gene modifications.
The key considerations of crispr genome editingChris Thorne
While CRISPR is simple to use, widely applicable and often highly efficient, there are a number of things to keep in mind to maximise experimental success. Here's what we recommend...
Genome editing tools form the basis for personalized medicine, especially for therapies requiring change in genome. Currently there are four contenders to this – Meganucleases, ZNF Nucleases, TALENs and CRISPRs. Although, the technologies are many, there are very few commercial providers of this technology. This is attributed to the fact that select few possess the intellectual property rights of turning these technologies to valid form of therapy; for example, ZFN patent with Sangamo BioSciences and TALENs with Cellectis, Transposagen and Life Technologies.
Edward Perello, CBO of Desktop Genetics, joins us at the Science: Disrupt London Session on Disruptor Stories to talk machine learning, CRSIPR, pivoting and his startup story.
The document discusses the CRISPR-Cas9 genome editing tool. CRISPR-Cas9 uses an enzyme called Cas9 and a guide RNA to cut DNA at a specific location, allowing DNA to be removed, added, or altered. It was developed based on the bacterial immune system and provides a simple, precise way to edit genomes. While promising for treating genetic diseases, its use in germline editing raises ethical concerns that require further discussion.
This document discusses the use of CRISPR gene editing technology. It provides examples of how CRISPR has been used to cure diseases in animals and potentially humans, create customized cancer models and modify animal organs. It also describes how CRISPR can be applied in agriculture to develop drought-resistant and pest-resistant crops, as well as in industrial biotechnology settings. The document then explains how gene drives work to alter genes and spread them through populations using CRISPR. It calls for responsible development of this technology through community guidance, transparency and democratic decision making.
CRISPR/Cas9 is a powerful new technique for genome editing that allows DNA to be easily cut and modified. It involves using the Cas9 enzyme, guided by RNA, to create targeted double-stranded breaks in DNA which are then repaired, allowing the DNA sequence to be altered. This system was adapted from a bacterial immune system. CRISPR/Cas9 represents a major breakthrough as it is simpler, cheaper and more accurate than previous genome editing methods. It has already been used to edit genes in numerous organisms and holds promise for applications like correcting genetic diseases. However, off-target effects and ethical concerns surrounding its use in humans remain limitations that need to be addressed.
Genome editing methods such as ZFNs, TALENs, and CRISPR/Cas9 use engineered nucleases to create targeted double-stranded breaks in DNA which are then repaired through endogenous cellular processes. These nucleases can be used to modify genomes through techniques like gene knockout, targeted mutation insertion/deletion/correction, and studying gene function. CRISPR/Cas9 uses a guide RNA and Cas9 nuclease to target specific DNA sequences for editing. The four main steps for CRISPR are: 1) selecting target sequences near a PAM site, 2) designing and cloning gRNA, 3) delivering Cas9 and gRNA into cells, and 4) DNA repair after cleavage results in gene modification
This document discusses quantitative trait loci (QTL) mapping. It defines QTLs as genomic regions containing genes related to quantitative traits, which are traits controlled by multiple genes. The process of constructing linkage maps using molecular markers to identify genomic regions associated with traits is called QTL mapping. Genetic markers are used to detect differences between individuals. Linkage maps show the relative positions and distances between markers on chromosomes. They help locate genes and QTLs for traits of interest. The document describes how to construct linkage maps through producing a mapping population, identifying marker polymorphisms, and conducting linkage analysis.
Advanced Genome Engineering Services and Transgenic Model Generation
at MSU’s Transgenic and Genome Editing Facility
Huirong Xie, Elena Demireva, Nate Kauffman, Richard Neubig
The CRISPR/Cas9 system has emerged as one of the leading tools for modifying genomes of organisms ranging from E. coli to humans. In a recent webinar, "New RNA Tools for Optimized CRISPR/Cas 9 Genome Editing", we presented how we developed the Alt-R™ CRISPR-Cas9 System for genome editing. Here, we take a look at designing your target sequences and ordering them as Alt-R CRISPR crRNA. We review the other components of the system and walk through the experimental process step by step, from design to evaluation of editing potency. We also discuss challenges and potential pitfalls and provide tips and guidance towards successful genome editing experiments. Learn more: http://www.idtdna.com/crispr
CRISPR technology allows for genome editing using a prokaryotic immune system called CRISPR/Cas. The system works by adapting spacers from viral DNA, producing CRISPR RNA, and targeting matching sequences. It is being applied in industry to make bacterial cultures virus-resistant, in labs for genetic engineering, and in medicine for treating genetic diseases and developing more specific antibiotics.
Introduction and key considerations around gene-editing using CRISPR and rAAV.
With an overview of our knock-out library using the haploid cell line HAP1
This document provides an overview of genome editing techniques such as CRISPR/Cas9 and rAAV and considerations for their use. It discusses how CRISPR/Cas9 and rAAV work to edit genomes and compares their advantages. Key factors for CRISPR gene editing are discussed such as gRNA design, donor design, and screening/validation approaches. The document also summarizes research optimizing CRISPR gene editing through improvements like testing different donor lengths and modifications. The goal is to translate genetic information into personalized medicines by leveraging tools like CRISPR and rAAV.
Have you considered that protein over-expression or inefficient mRNA knockdown may be masking physiological effects in your assays? Increasingly scientists are moving to endogenous gene-editing to characterise the function of their genes of interest.
Dr Chris Thorne from Cambridge Biotech Horizon Discovery discusses the ground breaking gene-editing technology CRISPR. The simplicity of experimental design has led to rapid adoption of the technology across the scientific community. However, challenges remain.
This Slidedeck focuses specifically on implementing CRISPR experiments, and explore a number of key considerations crucial to maximising chances of targeting success, whether your goal is to generate a knock-out or a knock-in. Chris also takes a look at some of the alternative uses of CRISPR, including sgRNA genome wide synthetic lethality screens.
The slides aim to support those researchers either planning to or already using CRISPR gene-editing in their lab. Horizon Discovery have also recently launched a program aimed specifically at academic cell biologists to promote the adoption of CRISPR by offering FREE CRISPR Reagents for knock-out cell line generation - more information available here. http://www.horizondiscovery.com/what-we-do/discovery-toolbox/genassist-crispr--raav-genome-editing-tools
This document discusses copy number variation analysis and qBiomarker Copy Number PCR Arrays. It begins with defining copy number variation and describing current methods to analyze copy number, including array CGH, SNP chips, NGS, qPCR and FISH. It then discusses issues with using single gene references and introduces the concept of a multicopy reference assay as a better reference. The remainder focuses on qBiomarker Copy Number PCR Arrays, which allow profiling copy number variation across curated gene sets or custom arrays. The arrays utilize a multicopy reference assay and are compatible with most qPCR instruments. Data analysis is performed using an online portal.
This document discusses next generation sequencing (NGS) and its applications in preimplantation genetic diagnosis (PGD). It describes how NGS can simultaneously detect chromosome abnormalities and gene defects in single cells. Studies show NGS has the same accuracy as array comparative genomic hybridization for detecting aneuploidy, and can also detect mutations. NGS has been successfully used to analyze blastocysts and single cells, identifying euploid and aneuploid embryos as well as specific gene mutations. This makes NGS useful for PGD to evaluate chromosome number and identify genetic disorders in embryos prior to implantation.
This document discusses next generation sequencing (NGS) and its applications in preimplantation genetic diagnosis (PGD). It describes how NGS can simultaneously detect chromosome abnormalities and gene defects in single cells. Studies show NGS has the same accuracy as array comparative genomic hybridization for detecting aneuploidy, and can also detect mutations. NGS has been successfully used to analyze blastocysts and single cells to identify euploid and aneuploid embryos as well as specific gene mutations. This makes NGS useful for PGD to select embryos without chromosome issues or gene defects.
Digital DNA-seq Technology: Targeted Enrichment for Cancer ResearchQIAGEN
Targeted DNA sequencing has become a powerful approach by achieving high coverage of the region of interest while keeping the cost of sequencing and complexity of data interpretation manageable. However, existing PCR-based target enrichment approaches introduce errors due to PCR amplification bias and artifacts, which significantly affects quantification accuracy and limit the ability to confidently detect low-frequency DNA variants. This webinar introduces a new digital sequencing approach that is based on the use of unique molecular indices (UMIs) - QIAseq Targeted DNA Panels. With UMIs, each unique DNA molecule is barcoded before any amplification takes place to correct for PCR errors. Detailed workflow and applications in cancer research will be presented. Join us and learn about this exciting novel digital DNAseq technology
This document discusses oncogenomics and cancer genomics technologies. It provides an overview of oncogenomics, the types of DNA biomarkers studied including mutations, and experimental strategies used for cancer genomics research. Key techniques discussed are next-generation sequencing, quantitative PCR (qPCR), and mass spectrometry. The document compares different technologies for mutation detection and profiling and their sensitivities. It also outlines the specifications and pipeline for developing a qPCR-based somatic mutation assay.
The document discusses using PCR arrays to profile gene expression and epigenetics. PCR arrays allow researchers to analyze expression of up to 84 genes related to a pathway or disease using real-time PCR. They include controls to check for genomic DNA contamination and assay performance. As an example, the document describes how a researcher could use a PCR array to compare gene expression between metastatic and non-metastatic breast tumor samples.
This document summarizes the Genome in a Bottle (GIAB) Consortium's efforts to characterize structural variants in human genomes to serve as benchmarks. The GIAB Consortium has generated structural variant calls for 7 human genomes using diverse data types and analysis methods. The document describes the GIAB Consortium's process for integrating these data to identify high-confidence structural variant calls to include in version 0.6 of the structural variant benchmark set. It provides examples of different types of structural variants characterized and evaluates the trustworthiness of the benchmark calls based on independent validation. The document also discusses ongoing efforts to further improve structural variant characterization using emerging long-read technologies.
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...Elia Brodsky
This workshop will address critical issues related to Transcriptomics data:
Processing raw Next Generation Sequencing (NGS) data:
1. Next Generation Sequencing data preprocessing:
Trimming technical sequences
Removing PCR duplicates
2. RNA-seq based quantification of expression levels:
Conventional pipelines (looking at known transcripts)
Identification of novel isoforms
Analysis of Expression Data Using Machine Learning:
3. Unsupervised analysis of expression data:
Principal Component Analysis
Clustering
4. Supervised analysis:
Differential expression analysis
Classification, gene signature construction
5. Gene set enrichment analysis
The workshop will include hands-on exercises utilizing public domain datasets:
breast cancer cell lines transcriptomic profiles (https://genomebiology.biomedcentral.com/articles/10.1186/gb-2013-14-10-r110),
patient-derived xenograft (PDX) mouse model of tumor and stroma transcriptomic profiles (http://www.oncotarget.com/index.php?journal=oncotarget&page=article&op=view&path[]=8014&path[]=23533), and
processed data from The Cancer Genome Atlas samples (https://cancergenome.nih.gov/).
Team: The workshops are designed by the researchers at the Tauber Bioinformatics Research Center at University of Haifa, Israel in collaboration with academic centers across the US. Technical support for the workshops is provided by the Pine Biotech team. https://edu.t-bio.info/a-critical-approach-to-transcriptomic-data-analysis/
To assess the effect of formalin on genomic DNA and assay performance for som...Candy Smellie
What is the impact of assay failure in your laboratory and how do you monitor for it?
Application of Companion Diagnostics - driving better treatment for cancer patients
Characterization of Novel ctDNA Reference Materials Developed using the Genom...Thermo Fisher Scientific
This document summarizes the development and characterization of novel circulating tumor DNA (ctDNA) reference materials. Fragmented DNA containing single or multiple cancer hotspot mutations was spiked into normal human plasma at defined allelic frequencies ranging from 0.1-50%. The size, concentration, and stability of the reference materials were analyzed. Results showed the materials had a mean size of ~160bp and allelic frequencies matched the expected values. Stability testing demonstrated the ctDNA controls were stable in plasma for up to 15 months. The reference materials were developed to enable simpler validation and quality control of ctDNA detection tests.
The document discusses copy number variation and strategies for analyzing copy number alterations. It describes what copy number is and how copy number variations occur frequently in the human genome. Several techniques are used for copy number analysis including array comparative genomic hybridization, single nucleotide polymorphism chips, and next-generation sequencing for discovery, and fluorescence in situ hybridization and quantitative PCR for validation. Quantitative PCR is a common method for copy number validation due to its reliability and ease of use. Important considerations for quantitative PCR include the choice of reference gene, as single-copy genes can be affected by copy number changes and genomic variations. A multicopy reference assay is recommended as it is less influenced by local genomic changes and provides more accurate copy number measurements.
This document discusses RNA interference and provides information about QIAGEN's SureSilencing shRNA plasmids for gene knockdown experiments. It begins with an introduction to RNAi mechanisms and challenges. It then describes QIAGEN's SureSilencing shRNA plasmid solution, which features guaranteed high knockdown efficiency, multiple designs to control off-target effects, and experimental validation. The document reviews the plasmid features, design algorithm, applications and provides a workflow for gene knockdown experiments using the plasmids. It emphasizes the importance of including appropriate controls and validation steps to ensure successful RNAi experiments.
This document discusses oncogenomics and cancer genomics technologies. It provides an overview and agenda for oncogenomics, describing various types of DNA biomarkers and somatic mutations that can be detected. It then discusses experimental strategies and techniques used for cancer genomics, including discovery and validation methods. The document reviews QIAGEN's qBiomarker somatic mutation assay pipeline and array products. It compares different mutation detection technologies and their sensitivity. Finally, it discusses disease-focused mutational profiling and data analysis.
From Panels to Genomes with VarSeq: The Complete Tertiary Platform for Short ...Golden Helix
From gene panels to whole genome, from short to long-read sequencing, the VarSeq suite is the solution for NGS analysis and reporting in a modern clinical lab. VarSeq handles the spectrum of variant types (SNV, Indel, CNV, Fusions) and provides automated classification and reporting capabilities following the ACMG and AMP guidelines. With our new PacBio partnership, we are more adaptable than ever with creating a spectrum of custom workflows to suit our unique user needs.
This webcast will review:
-Data analysis scaling from Gene Panel to Genome analysis with VarSeq and VSWarehouse.
-Analysis and annotation of SNVs, Indels, CNVs, and fusions.
-A close look at a PacBio long-read trio analysis.
Come join us for this showcase in modern VarSeq analysis capabilities.
The document discusses the Genome in a Bottle Consortium (GIAB) which aims to provide reference materials and data for benchmarking and assessing sequencing technologies and bioinformatics pipelines. The GIAB analyzed multiple sequencing datasets for the NA12878 genome and established a high confidence call set for variants through integration. Quality assessment found the call set to have near 100% sensitivity and specificity compared to other datasets in high confidence regions. The NA12878 data serves as an important reference for validation studies.
1) Targeted re-sequencing is used to detect sequence differences between an individual and a reference genome in order to identify genetic variants associated with diseases. It can be done using microarrays or next-generation sequencing (NGS).
2) Microarrays have simpler workflows but struggle with insertions/deletions and repeats, while NGS can detect more variant types but has more complex data analysis.
3) Both methods require validation before clinical use, but NGS typically has higher data quality, reproducibility, and ability to detect pathogenic mutations while reducing incidental findings compared to microarrays.
Similar to Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular cell biology (20)
Blueprints to blue sky – analyzing the challenges and solutions for IHC compa...Candy Smellie
Manual assessment of biomarker expression is associated with significant inter- and intra reader variability. In some cases there are also limitations when it comes to sensitivity and specificity of manual biomarker assessment.
In one example to the left, the “pure” contribution of inter-reader variability associated with Ki67 assessment was quantified across 20 tumors and 126 participating labs. In that study, it was demonstrated how image analysis can be used to significantly reduce inter-reader variability.
In a another study, the National Danish Validation study of Her2, it was demonstrated how improved sensitivity/specificity of quantitative HER2 protein expression wrt gene amplification lead to significant cost savings in reflex testing.
By automating aspects of stain quality control, it will become scalable to he point where EQA organizations may be able and willing to offer more frequent – perhaps even on-demand – proficiency testing and calibration services.
It is possible that objective and quantitative standards will contribute to improve compliance with protocol recommendations.
In clinical multi-center trials it will be easier to standardize and monitor data from each center.
And it is our hope tha larger diagnostic pathology labs will be able to benefit from such a method by closely monitoring drift in staining quality for biomarkers.
Understanding and controlling for sample and platform biases in NGS assaysCandy Smellie
What is the impact of assay failure in your laboratory and how do you monitor for it?
The advancement of next-generation sequencing has provided invaluable resources to researchers in multiple industries and disciplines, and will be a major driver during the personalized medicine revolution that is upon us. However, while the cost of generating sequencing data continues to decrease this does not take into account the significant costs associated with the infrastructure and expertise that are required to develop a robust, routine NGS pipeline.
Specifically, as predicted by Sboner, et al in 2011, the cost of the sequencing portion of the experiment continues to decrease and the costs associated with upfront experimental design and downstream analysis dominate the cost of each assay. This is true whether you are performing a pre-clinical R&D project, and perhaps even more so for clinical assays. In the paper, the authors note the unpredictable and considerable ‘human time’ spent on the upstream design and downstream analysis. Here at Horizon, we aim to develop tools that help researchers and clinicians optimize these workflows to make NGS more reliable and ultimately, more affordable by streamlining these resource intensive areas.
Resolving Ambiguity in Target ID Screens - CRISPR-Cas9 Based Essentiality Pro...Candy Smellie
Pathfinder Target Essentiality Assay Service
A new CRISPR─Cas9 based medium throughput assay service for validation of target gene essentiality
Can be used to resolve ambiguous screening results
Can also provide information on drug target suitability
This assay developed at Horizon will enable you to identify genes essential for the growth of specific cancer cell lines.
It can be used to definitively resolve ambiguous screening results.
Or to provide information on target suitability – by testing essentiality in “normal” cells, or in cancer subtypes different to the proposed patient population
Molecular QC: Interpreting your Bioinformatics PipelineCandy Smellie
What is the impact of assay failure in your laboratory and how do you monitor for it?
The most heavily degraded samples are not suitable for standard exome coverage: sometimes it’s not even a matter of getting bad sequencing, you might get nothing at all!
FFPE artifacts increase with storage time
Artifacts go against the statistical power of your variant calling analysis
Molecular reference standards help filter out bad mappings and spurious variants
Bioinformatics pipelines allow adding Molecular Reference Standards in your joint variant calling pipeline
Genome In A Bottle Reference Standards are invaluable for validating variant calling analysis
NIST and its collaborators shared datasets created with most NGS technologies
Horizon Diagnostics shared annotated, merged variant calls from NIST for the Ashkenazim Trio
~35K variants are predicted having high or moderate impact within the Trio
GM24385 (Ashkenazim Son) includes 352 small variants with high/moderate impact which are absent in Father and Mother
Routinely monitor the performance of your workflows and assays with independent external controls
Identification and Prioritization of Drug Combinations for Treatment of CancerCandy Smellie
Why are combination drugs important for treatment of cancer?
Overview of cHTS screening strategy
Example of cHTS screening results
Amgen MDM2 inhibitor combination activities
Combination drug leads- prioritization
Ex vivo assays
Tumor microenvironment assays
Xenografts
cHTS to identify synergies and antagonism
Immuno-oncology
Molecular QC: Using Reference Standards in NGS PipelinesCandy Smellie
Since its inception, next-generation sequencing has found utility in a diverse set of industries, from biomarker discovery in pharma to ancestral identification in archeology. Across the board, NGS has the advantage of allowing us to answer questions that require a lot of data. Next-generation sequencing provides orders of magnitude more data than traditional Sanger sequencing as hundreds of “lanes” analyzed in parallel vs. hundreds of millions of “clusters” which allows for many samples to be multiplexed on a single-run.
By starting with different genetic material and following specific experimental workflows, NGS can be applied to many applications.
Here we focus on DNA resequencing applications, which implies the data generated will be compared to an existing reference sequence (such as the human genome). Specifically, we’ll focus on how we can analyze patient-derived material to identify onco-relevant mutations including single-nucleotide variants, insertions-deletions, copy number variants and translocations. We’ll also focus on how known reference standards have been shown to be vital in ensuring data generated from NGS assays is accurate and reproducible.
Improving Immunohistochemistry Standardization in your Laboratory: Renewable ...Candy Smellie
This document discusses the development of immunohistochemistry (IHC) reference standards using genetically defined cell lines to improve standardization and quality control in IHC laboratories. The reference standards consist of cell line cores containing positively and negatively expressing proteins mounted on the same slide. The cell lines are extensively characterized and shown to produce consistent staining results across laboratories and detection methods. Using quantitative digital pathology, the reference standards allow laboratories to routinely monitor assay performance and identify variability in their IHC workflows.
Overall, testing cfDNA has four distinct advantages over conventional biopsies, being:
Cost-effective approach;
Simplified sample collection procedures;
Reduced impact to the patient and;
Easily analyzed.
Addressing the Pre-PCR Analytical Variability of FFPE SamplesCandy Smellie
Despite technical advances, assessing the accuracy of pre-PCR steps, which include DNA extraction from formalin-fixed paraffin-embedded (FFPE) tissues, DNA quantitation and DNA quality control, remain a key challenge in external quality assurance.
In the webinar we will discuss the latest results from recent studies and look at ways that the accuracy of pre-PCR workflows can be improved.
Using reference materials to meet validation & verification requirements for ...Candy Smellie
Using reference materials can help clinical laboratories meet validation and verification requirements for molecular diagnostic tests. Credit Valley Hospital uses Horizon Diagnostics' pooled DNA reference standards at a 2.5% mutant allele frequency as a low positive control in their EGFR diagnostic assays. Including this control helps eliminate false positive results and provides a qualitative reference to confidently identify true low level positives. This reduces the risks of false negative or false positive reports, improving patient outcomes by ensuring accurate molecular testing results.
RNA-based screening in drug discovery – introducing sgRNA technologiesCandy Smellie
RNA-based screening in drug discovery
Use of X-MAN™ isogenic cell lines in RNAi screening approaches
Comparison of siRNA and sgRNA screening approaches
The challenges of genome-wide CRISPR-Cas9 knockout (GeCKO) screening
Using CRISPR-Cas9 sgRNA for target identification and patient stratification
Moving from screening hit to target validation
sgRNA screening: not just KOs
Improvement projects across the business to reduce waste and improve efficiency
Develop and execute first stage of FDA Strategy
Considerations to extend ISO 13485 scope to additional product lines
HDx™ Reference Standards and Reference Materials for Next Generation Sequenci...Candy Smellie
This document summarizes a presentation about reference standards for next generation sequencing (NGS). Horizon Diagnostics has developed genomic DNA and formalin-fixed, paraffin-embedded (FFPE) reference standards containing defined mutations at known allelic frequencies to validate NGS workflows and monitor assay performance. Multiplex reference standards contain up to 40 mutations at low allelic frequencies down to 1.3% that can be quantified using digital PCR. Several laboratories demonstrated they could accurately detect the mutations in Horizon's reference standards using different NGS platforms. The standards help evaluate sensitivity, specificity, and limits of detection on NGS assays.
Dr. Kyla Grimshaw is presenting on using cell-based assays in cancer drug development. She discusses Horizon Discovery's services including isogenic cell lines for target validation, modeling the tumor microenvironment, and high-throughput screening platforms. Key applications of cell-based assays addressed are target validation, patient stratification, determining optimal assay conditions, and evaluating combination therapies. Recent developments include endogenous reporter cell lines and patient-derived xenograft models.
The clinical application development and validation of cell free dna assays -...Candy Smellie
What is the impact of assay failure in your laboratory and how do you monitor for it?
In cancer patients, cell-free DNA carries tumour-related genetic alterations that are relevant to cancer development, disease progression and response to therapy.
Cell-free DNA detection allows:
Early detection
Frequent sampling
Monitoring of disease progression
Measure response to therapy
Detection of resistance mutation
Non-invasive diagnostic tool development
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
DERIVATION OF MODIFIED BERNOULLI EQUATION WITH VISCOUS EFFECTS AND TERMINAL V...Wasswaderrick3
In this book, we use conservation of energy techniques on a fluid element to derive the Modified Bernoulli equation of flow with viscous or friction effects. We derive the general equation of flow/ velocity and then from this we derive the Pouiselle flow equation, the transition flow equation and the turbulent flow equation. In the situations where there are no viscous effects , the equation reduces to the Bernoulli equation. From experimental results, we are able to include other terms in the Bernoulli equation. We also look at cases where pressure gradients exist. We use the Modified Bernoulli equation to derive equations of flow rate for pipes of different cross sectional areas connected together. We also extend our techniques of energy conservation to a sphere falling in a viscous medium under the effect of gravity. We demonstrate Stokes equation of terminal velocity and turbulent flow equation. We look at a way of calculating the time taken for a body to fall in a viscous medium. We also look at the general equation of terminal velocity.
The debris of the ‘last major merger’ is dynamically youngSérgio Sacani
The Milky Way’s (MW) inner stellar halo contains an [Fe/H]-rich component with highly eccentric orbits, often referred to as the
‘last major merger.’ Hypotheses for the origin of this component include Gaia-Sausage/Enceladus (GSE), where the progenitor
collided with the MW proto-disc 8–11 Gyr ago, and the Virgo Radial Merger (VRM), where the progenitor collided with the
MW disc within the last 3 Gyr. These two scenarios make different predictions about observable structure in local phase space,
because the morphology of debris depends on how long it has had to phase mix. The recently identified phase-space folds in Gaia
DR3 have positive caustic velocities, making them fundamentally different than the phase-mixed chevrons found in simulations
at late times. Roughly 20 per cent of the stars in the prograde local stellar halo are associated with the observed caustics. Based
on a simple phase-mixing model, the observed number of caustics are consistent with a merger that occurred 1–2 Gyr ago.
We also compare the observed phase-space distribution to FIRE-2 Latte simulations of GSE-like mergers, using a quantitative
measurement of phase mixing (2D causticality). The observed local phase-space distribution best matches the simulated data
1–2 Gyr after collision, and certainly not later than 3 Gyr. This is further evidence that the progenitor of the ‘last major merger’
did not collide with the MW proto-disc at early times, as is thought for the GSE, but instead collided with the MW disc within
the last few Gyr, consistent with the body of work surrounding the VRM.
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/
hematic appreciation test is a psychological assessment tool used to measure an individual's appreciation and understanding of specific themes or topics. This test helps to evaluate an individual's ability to connect different ideas and concepts within a given theme, as well as their overall comprehension and interpretation skills. The results of the test can provide valuable insights into an individual's cognitive abilities, creativity, and critical thinking skills
Phenomics assisted breeding in crop improvementIshaGoswami9
As the population is increasing and will reach about 9 billion upto 2050. Also due to climate change, it is difficult to meet the food requirement of such a large population. Facing the challenges presented by resource shortages, climate
change, and increasing global population, crop yield and quality need to be improved in a sustainable way over the coming decades. Genetic improvement by breeding is the best way to increase crop productivity. With the rapid progression of functional
genomics, an increasing number of crop genomes have been sequenced and dozens of genes influencing key agronomic traits have been identified. However, current genome sequence information has not been adequately exploited for understanding
the complex characteristics of multiple gene, owing to a lack of crop phenotypic data. Efficient, automatic, and accurate technologies and platforms that can capture phenotypic data that can
be linked to genomics information for crop improvement at all growth stages have become as important as genotyping. Thus,
high-throughput phenotyping has become the major bottleneck restricting crop breeding. Plant phenomics has been defined as the high-throughput, accurate acquisition and analysis of multi-dimensional phenotypes
during crop growing stages at the organism level, including the cell, tissue, organ, individual plant, plot, and field levels. With the rapid development of novel sensors, imaging technology,
and analysis methods, numerous infrastructure platforms have been developed for phenotyping.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
The use of Nauplii and metanauplii artemia in aquaculture (brine shrimp).pptxMAGOTI ERNEST
Although Artemia has been known to man for centuries, its use as a food for the culture of larval organisms apparently began only in the 1930s, when several investigators found that it made an excellent food for newly hatched fish larvae (Litvinenko et al., 2023). As aquaculture developed in the 1960s and ‘70s, the use of Artemia also became more widespread, due both to its convenience and to its nutritional value for larval organisms (Arenas-Pardo et al., 2024). The fact that Artemia dormant cysts can be stored for long periods in cans, and then used as an off-the-shelf food requiring only 24 h of incubation makes them the most convenient, least labor-intensive, live food available for aquaculture (Sorgeloos & Roubach, 2021). The nutritional value of Artemia, especially for marine organisms, is not constant, but varies both geographically and temporally. During the last decade, however, both the causes of Artemia nutritional variability and methods to improve poorquality Artemia have been identified (Loufi et al., 2024).
Brine shrimp (Artemia spp.) are used in marine aquaculture worldwide. Annually, more than 2,000 metric tons of dry cysts are used for cultivation of fish, crustacean, and shellfish larva. Brine shrimp are important to aquaculture because newly hatched brine shrimp nauplii (larvae) provide a food source for many fish fry (Mozanzadeh et al., 2021). Culture and harvesting of brine shrimp eggs represents another aspect of the aquaculture industry. Nauplii and metanauplii of Artemia, commonly known as brine shrimp, play a crucial role in aquaculture due to their nutritional value and suitability as live feed for many aquatic species, particularly in larval stages (Sorgeloos & Roubach, 2021).
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
ESR spectroscopy in liquid food and beverages.pptxPRIYANKA PATEL
With increasing population, people need to rely on packaged food stuffs. Packaging of food materials requires the preservation of food. There are various methods for the treatment of food to preserve them and irradiation treatment of food is one of them. It is the most common and the most harmless method for the food preservation as it does not alter the necessary micronutrients of food materials. Although irradiated food doesn’t cause any harm to the human health but still the quality assessment of food is required to provide consumers with necessary information about the food. ESR spectroscopy is the most sophisticated way to investigate the quality of the food and the free radicals induced during the processing of the food. ESR spin trapping technique is useful for the detection of highly unstable radicals in the food. The antioxidant capability of liquid food and beverages in mainly performed by spin trapping technique.
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...Sérgio Sacani
Context. With a mass exceeding several 104 M⊙ and a rich and dense population of massive stars, supermassive young star clusters
represent the most massive star-forming environment that is dominated by the feedback from massive stars and gravitational interactions
among stars.
Aims. In this paper we present the Extended Westerlund 1 and 2 Open Clusters Survey (EWOCS) project, which aims to investigate
the influence of the starburst environment on the formation of stars and planets, and on the evolution of both low and high mass stars.
The primary targets of this project are Westerlund 1 and 2, the closest supermassive star clusters to the Sun.
Methods. The project is based primarily on recent observations conducted with the Chandra and JWST observatories. Specifically,
the Chandra survey of Westerlund 1 consists of 36 new ACIS-I observations, nearly co-pointed, for a total exposure time of 1 Msec.
Additionally, we included 8 archival Chandra/ACIS-S observations. This paper presents the resulting catalog of X-ray sources within
and around Westerlund 1. Sources were detected by combining various existing methods, and photon extraction and source validation
were carried out using the ACIS-Extract software.
Results. The EWOCS X-ray catalog comprises 5963 validated sources out of the 9420 initially provided to ACIS-Extract, reaching a
photon flux threshold of approximately 2 × 10−8 photons cm−2
s
−1
. The X-ray sources exhibit a highly concentrated spatial distribution,
with 1075 sources located within the central 1 arcmin. We have successfully detected X-ray emissions from 126 out of the 166 known
massive stars of the cluster, and we have collected over 71 000 photons from the magnetar CXO J164710.20-455217.
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular cell biology
1. CRISPR, rAAV and the new landscape of molecular cell biology
Genome Editing Comes of Age
2. Genome Editing Comes of Age
Horizon Discovery - Experts in Genome Editing
• Integrated products and services built on genome editing applicable across the drug
development continuum
• Deep roots in academia (with many existing colaborations through CoE program)
Our Mission
To translate the human genome and accelerate the discovery of personalised
medicines
Our Approach
Leveraging genome editing across to speed the translation of genetic observations
into clinical outcomes
3. Genome Editing Comes of Age
Gene Targeting Techniques – an overview
Genome Editing Tools
• rAAV
• CRISPR/Cas9
Key Considerations for Gene Editing
Genome Editing at scale
• High through Knock-out Cell Line Generation
• Genome Wide sgRNA Synthetic Lethality Screening
6. Gene targeting techniques – an overview
Approach
Gain of
function
Loss of
function
Endogenous
expression
Long-term
stability
Off-target
integrations
Time vs. Cost
Transient over-expression Yes No No No No Low
Stable over-expression Yes No No Yes*
Random
integration
Med/Low
Transient RNAi No Yes No No No Low
Stable RNAi No Yes No Yes*
Random
integration
Med/Low
Dominant negative over-
expression
No Yes No No** No Low
* Assuming viral promoter methylation does not occur
** Commonly transient vectors
7. Gene targeting techniques – an overview
Approach
Gain of
function
Loss of
function
Endogenous
expression
Long-term
stability
Off-target
integrations
Time vs. Cost
Transient over-expression Yes No No No No Low
Stable over-expression Yes No No Yes*
Random
integration
Med/Low
Transient RNAi No Yes No No No Low
Stable RNAi No Yes No Yes*
Random
integration
Med/Low
Dominant negative over-
expression
No Yes No No** No Low
Nuclease-Based Genome
Editing
Yes Yes Yes Yes Varies Low-High
rAAV-Based Genome Editing Yes Yes Yes Yes Controlled Med
8. 8
Endogenous targeting of PIK3CA
Large growth induction phenotype
Transforming alone
Milder growth induction phenotype
Non-transforming alone
Di Nicolantonio et al., PNAS, Dec. 2008Isakoff et al., Cancer Research, Jan 2006
9. 9
Endogenous targeting of KRAS
Konishi et al (2007) - Endogenous knock-in of KRAS G12V does not transform cells, unlike
KRAS G12V overexpression
KRAS G12V overexpression is not a physiological model
12. Genome Editing: The Right Tool For The Right Outcome
rAAV
• High precision / low thru-put
• Any locus, wide cell tropism
• Well validated, KI focus
Zinc Fingers
• Med precision / med thru-put
• Good genome coverage
• Well validated / KO Focus
CRISPR
• New but high potential
• Capable of multi-gene targeting
• Simple RNA-directed cleavage
• Combinable with AAV
Great for knock-outs Great for heterozygous
knock-ins
13. rAAV: How Does It Work?
Nature Genetics 18, 325 - 330 (1998)
AAV = Adeno Associated Virus (ssDNA)
14. Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
CRISPR/Cas9: How Does It Work?
16. Cas9 Wild type Cas9 Nickase (Cas9n)
Induces double strand break Only “nicks” a single strand
Only requires single gRNA
Requires two guide RNAs for reasonable
activity
Concerns about off-target specificity Reduced likelihood of off-target events
High efficiency of cleavage
Especially good for random indels (= KO)
Guide efficiency dictated by efficiency of the
weakest gRNA
CRISPR/Cas9: How Does It Work?
Nishimasu et al Cell
18. Genome Editing: As Simple As…
... HOWEVER …
Cell Line
Screen for clones
Engineered cells!
Genome Editing Vector
19. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
20. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Normal human karyotype
HeLa cell karyotype
Gene copy number
Effect of modification on growth
24. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Number of gRNAs
gRNA activity measurement
NT
Cas9
wt
only
4uncut
1 52 3
gRNA
200
300
400
500
100
600
+ve
700
200
300
400
500
100
600
700
25. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Donor sequence modifications
Modification effects on expression or splicing
Size and type of donor (AAV, oligo, plasmid)
Selection based strategies
Cas9 Cut Site
Genomic
Sequence
Donor Sequence
containing mutation
26. Technology Development at Horizon: Systematic improvements
Donor lengths: sODNs ranging from 50-200nt, with single phosthothioate modifications at both outer
nucleotides
100nt ssODN is optimal
4 0 6 0 8 0 1 0 0 1 2 0 1 4 0 1 6 0 1 8 0 2 0 0
0 .0
0 .5
1 .0
1 .5
H R e ffic ie n c y u s in g s s O D N s o f d iffe r e n t le n g th s
O lig o le n g th (N T )
Efficiency(%)
4 0 6 0 8 0 1 0 0 1 2 0 1 4 0 1 6 0 1 8 0 2 0 0
0
5
1 0
1 5
T ra n s fe c tio n e ffic ie n c y u s in g 1 0 p m o l s s O D N
O ligo length (N T )
Transfection%(RFP)
Size Oligo Sequence
50 C*ACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCC*C
70 T*CCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTG*C
90 T*GATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACC*A
110 A*CAGTTATGTTGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAG*C
130 T*TTTTGCTCTACAGTTATGTTGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC*G
150 G*TATCTGGTATTTTTGCTCTACAGTTATGTTGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCA*A
170 T*AAGCCTGCAGTATCTGGTATTTTTGCTCTACAGTTATGTTGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAA*C
200 A*AATGTCTTTATAAATAAGCCTGCAGTATCTGGTATTTTTGCTCTACAGTTATGTTGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCA*C
GFP Mutation, PAM mutation
27. Technology Development at Horizon: Systematic improvements
Donor modifications: number and position of phosphothioate medications
Only 3’ PTO modifications required for ssODNs tested
Oligo Sequence
None TGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA
5' PTO T*GATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA
3' PTO TGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACC*A
5+3 PTO T*GATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACC*A
Mut Flank TGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACT*A*C*C*AGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA
Mut Flank + 5+3 PTO T*GATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACT*A*C*C*AGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACC*A
3x5' PTO T*G*A*TGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA
3x3' PTO TGATGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAA*C*C*A
3x5'+3' PTO T*G*A*TGGTTCTTCCATCTTCCCACAGCTGGCCGACCACTACCAGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA
Mut Flank + 3x5'+3' PTO T*G*A*TGGTTCTTCCATCTTCCCACAGCTGGCCGACCACT*A*C*C*AGCAGAACACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAA*C*C*A
GFP Mutation, PAM mutation
N
o
n
e
5
'P
T
O
3
'P
T
O5
+
3
P
T
O
M
u
t
F
la
n
k
M
u
t
F
la
n
k
+
5
+
3
P
T
O3
x
5
'P
T
O3
x
3
'P
T
O
3
x
5
'+
3
'P
T
O
M
u
t
F
la
n
k
+
3
x
5
'+
3
'P
T
O
0 .0
0 .5
1 .0
Targetingfrequency(GFP%)
H R e ffic ie n c y u s in g s s O D N s w ith v a r y in g n u m b e r s a n d p o s ito n s o f
p h o s p h t io la t e p r o t e c t e d n u c le o t id e s
2 5
)
T r a n s fe c tio n e ffic ie n c y u s in g s s O D N s w ith v a r y in g n u m b e r s a n d p o s it o n s o f
p h o s p h t io la t e p r o t e c t e d n u c le o t id e s
N
o
n
e
5
'P
T
O
3
'P
T
O5
+
3
P
T
O
M
u
t
F
la
n
k
M
u
t
F
la
n
k
+
5
+
3
P
T
O3
x
5
'P
T
O3
x
3
'P
T
O
3
x
5
'+
3
'P
T
O
M
u
t
F
la
n
k
+
3
x
5
'+
3
'P
T
O
0 .0
0 .5
Targetingfrequency(GFP
N
o
n
e
5
'P
T
O
3
'P
T
O5
+
3
P
T
O
M
u
t
F
la
n
k
M
u
t
F
la
n
k
+
5
+
3
P
T
O3
x
5
'P
T
O3
x
3
'P
T
O
3
x
5
+
3
P
T
O
M
u
t
F
la
n
k
+
3
x
5
+
3
P
T
O
0
5
1 0
1 5
2 0
2 5
Transfection%(RFP)
T r a n s fe c tio n e ffic ie n c y u s in g s s O D N s w ith v a r y in g n u m b e r s a n d p o s it o n s o f
p h o s p h t io la t e p r o t e c t e d n u c le o t id e s
28. Introducing gUIDEBook™
Supports all Cas9 nuclease
variants
Advanced tools for knock-in
design
Comprehensive gRNA scoring
• Off target
• Activity
Full integration with annotated
reference genomes
Flexible and easy to use
29. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Donor sequence modifications
Modification effects on expression or splicing
Size and type of donor (AAV, oligo, plasmid)
Selection based strategies
(+/+)
(+/-)
(-/-)
(KI/-)
(KI/+)
(KI/KI)
30. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Number of cells to screen
Screening strategy
Modifications on different alleles
Homozygous or heterozygous
modifications versus mixed cultures
% cells targeted
31. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Confirmatory genotyping strategies
Off-target site analysis
Modification expression
Contamination
Heterozygous knock-in
Wild type
32. Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
How many copies?
Is it suitable?
What’s my goal? (Precision vs Efficiency)
Does my guide cut?
Have I minimised re-cutting?
How many clones to find a positive?
Is my engineering as expected?
33. Genome Editing Comes of Age
Gene Targeting Techniques – an overview
Genome Editing Tools
• rAAV
• CRISPR/Cas9
Key Considerations for Gene Editing
Genome Editing at scale
• High through Knock-out Cell Line Generation
• Genome Wide sgRNA Synthetic Lethality Screening
34. High throughput knock-out cell line generation
(Near) Haploid human cell lines
• Near-haploid (diploid for chr8, and chr15)
• Isolated from CML patient
• Myeloid lineage
• Suspension cells
KBM-7
HAP1
• Near-haploid (diploid for chr15)
• Derived from KBM-7
• Fibroblast like
• Adherent cells
35. Unambiguous genotyping
Defined copy number Knowledge base
RNA sequencing
- Predict suitability
as cellular model
Essentiality dataset
- Predict success rate
for knockouts
Haploid
High efficiency
Diploid
- Knockouts
- Defined mutations
High throughput knock-out cell line generation
Advantages of Haploid Cells
36. Wildtype TCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAG
||||||||||| ||||||||||||||
Knockout TCCTTTGCGGA--------AGCCGGTGCAGCAG
Wildtype SerPheAlaGluSerCysLysProValGlnGln
Knockout SerPheAlaGlu AlaGlyAlaAla
Exon 1
DNA sequencing
Exon 2
Cas9 cleavage
High throughput knock-out cell line generation
CRISPR/Cas9 allows rapid and high efficiency targeting
38. Genome Wide sgRNA Screening
Lentivirally delivered sgRNA can drive efficient cleavage of target genomic
sequences for use in whole genome screens
Use massively-parallel next-gen sequencing to assess results
Possible addition/replacement to RNAi screens
40. We are combining CRISPR and isogenic cell lines to perform
CRISPR-based Synthetic Lethality Screens
sgRNA technology will be transformational for both Target ID and early-stage Validation
40
Synthetic lethal target ID via sgRNA screening
41. Ready-made knock-out X-MAN® cell lines
X-MAN® - gene X Mutant And Normal cell line
Advantages:
• Genetically verified
• More than 3,000 available clones already available, in a variety of cell line backgrounds
• Quick and easy way to get first data on gene of interest
• Available with validated gRNAs to use with your own human cell line of choice.
More Information: www.horizon-genomics.com/
Bromodomain
40 genes
Autophagy
15 genes
mTOR pathway
50 genes
Kinases
350 genes
HATs/HDACs
15 genes
DNA damage
50 genes
RAB GTPases
15 genes
Deubiquitinases
80 genes
42. Genome Editing Tools and Services
Support
Services
Cell Lines
Donors
Guide RNAs
Cas9
Vectors
• Wild type and nickase
• Separate or all-in one vectors
• gRNA design and validation service
• Pre-validated guides available
• Custom donor design and synthesis
• Multiple formats inc. rAAV available
• >1000 ready-modified cell lines
• Custom cell line generation service
• Viral encapsulation of rAAV donor
• Project design support
43. Your Horizon Contact:
Horizon Discovery Group plc, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Tel: +44 (0) 1223 655 580 (Reception / Front desk) Fax: +44 (0) 1223 655 581 Email: info@horizondiscovery.com Web: www.horizondiscovery.com
Jan Hryca
Business Development - Europe
J.hryca@horizondiscovery.com
+44 1223 204 742
Chris Thorne PhD
Gene Editing Specialist
c.thorne@horizondiscovery.com
+44 1223 204 799
44. Useful Resources
From Horizon
Free gRNAs in Cas9 wild type vector – www.horizondiscovery.com/guidebook
Technical manuals for working with CRISPR - http://www.horizondiscovery.com/talk-to-
us/technical-manuals
In the Literature
Exploring the importance of offset and overhand for nickase -
http://www.cell.com/cell/abstract/S0092-8674(13)01015-5
sgRNA whole genome screening:
• Shalem et al - http://www.sciencemag.org/content/343/6166/84.short
• Wang et al - http://www.sciencemag.org/content/343/6166/80.abstract
On the web
Feng Zhang on Game Changing Therapeutic Technology (Link to Feng’s Video)
Guide design - http://crispr.mit.edu/
CRISPR Google Group - https://groups.google.com/forum/#!forum/crispr
Editor's Notes
Information is no longer a bottleneck, emphasis is shifting to the ‘what does it all mean’
In a translational context we hope that by answering that question we will be able to is to characterise the genetics that drive disease, and indeed develop drugs and diagnostics that are personalised to patients.
Genome editing provides the link between the information here, and this outcome here, by allowing scientists to recapitulate specific genetic alterations in any gene in any living tissue to probe function, develop disease models and identify therapeutic strategies
Human cell lines containing the Kras G12V knock-in do not exhibit many of the phenotypes observed in overexpressing lines, and make the case for this being a more physiological model for elucidating the contribution of oncogenic Kras in human cancer cells.
So to return to my picture, not only do we now have unparalleled access to genetic information, but we now have the tools to most accuartely understand what this genetic information – with genome editing allowing us to explore the genetic drivers of disease in physiological models.
AAV is a single-stranded, linear DNA virus with a a 4.7 kb genome which for the purpose of genome editing is replaced almost in entirety with the targeting vector sequence (except for the iTRs)
It is in effect a highly effective DNA delivery mechanism
After entry of the vector into the cell, target-specific homologous DNA is believed to activate and recruit HR-dependent repair factors
can induce HR at rates approximately 1,000 times greater than plasmid based double stranded DNA vectors, but the mechanism by which it achieves this is still largely unknown
By including a selection cassette can select for cells that have integrated the targeting vector, and then screen for clones which have undergone targeted insetion rather than random integration, which will generally be around 1%.
CRISPR/Cas9 gene editing is based on a microbial restriction system, which ordinarily functions effectively as an immune system in these organisms, but that has been harnessed for genome targeting.
The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community.
The system itself is comprised of three key components
the Cas9 protein, which cuts/cleaves the DNA and
Two RNAs - a crispr RNA contains a sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex
For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA
Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site. This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence.
The design rules for CRISPR are straightforward, as you require only a 23 nucleotide sequence that ends in an NGG motif – known as the protospacer associated motif (or PAM site).
Of this 23bases, only the first 20 are included in the guide target sequence which is appended to the tracrRNA “fixed scaffold” and together comprise the gRNA.
So as the only requirement is this NGG, on average eligible PAM sites can be found every 12bp, although this will depends on sequence
Several tools for gRNA design – HD has our own. One of the key considerations is what is the off target potential of my guide – very often even a 23 base pair sequence will be found elsewhere in the enormity of the genome, and even if an exact match isn’t observed there may be instances of homology with a few mismatches.
In fact the specificity of the CRISPR system remains a concern for researchers, especially where minimising off target modifications is critical, such as those working in the field of gene therapy.
Various approaches are being taken improve specificity - Interestingly recent work by Keith Joung’s lab has shown using a 17bp target region can reduce some of the off target potential that guides have
Another approach has been to mutate the nuclease such that it will only nick one strand of the dsDNA, a nickase form of the protein. Nicks will in general be repaired by the base excision repair pathway which is significantly higher fidelity than NHEJ.
Targeting strategies using the nickase are designed with two gRNAs, one to recruit the nickase to each strand of the DNA, only after which a DSB will be introduced.
This increase in specificity is unfortunately at the expense of some efficiency at you’re at the mercy of your weakest guide in the pair
The design of CRISPR system is simple and Genome editing might appear as simple as:
Identifying a gRNA target sequence
Ordering an oligo with the target sequence and cloning it into a gRNA vector
Transfecting cells with the gRNA + Cas9
+ Voila!
well… is not always that simple, there are things you need to consider
And as we are running gene editing projects every day at Horizon we’ve learnt from experience that there are various ways that things can go wrong if you don’t consider the following,
and I want to briefly run through each of these one at a time.
The first group of considerations regard the quirks of your specific target gene
How many copies of your gene exist in your cell line?
Many of us use transformed human cell lines – there aren’t many that actually come with a normal copy number of 2. For many, many, years people using HeLa cells - quadroploid – see pic = mess -Their karyotype is very different from wild type and they might have multiple copies of an allele
It is important to understand YOUR cell line.
Do you need to modify all alleles present?
Would KO of one allele and modification of the other be viable/acceptable? This is something that happens frequently with CRISPR.
When you make the modification do you expect it affect the growth of the cells?
When the gene alteration we are trying to make don’t seem to be able to be isolated and then they tell us expts with shRNAs show viability of cells affected by modification
The second category, and this is probable the one that causes us here at Horizon the most trouble/has required a lot of hard-won expertise - the suitability of the cell line. For example:
Need to get DNA into cells..Does your cell transfect/electroporate well? Should you transduce instead?
Can the cell line be single cell dilute (SCD)? (Single cell or as in Top panel = triplicate stuck together – takes a long time to separate artefacts) And have it come back at reasonable growth levels? Even if the cell line grows very well, it might not tolerate single cell dilution and you need to find the most suitable conditions to let the cell line grow
What is the doubling time? Optimal growth conditions?
Looked at whole panel of media formulations, additives, diff seeding densities..(see panel on bottom gives example of taking 1 particularly hard cell line and trying a range of conditions to find the conditions most suitable for SCD
Now let’s get to the most interesting part the guide RNA design
gRNA design:
A very important consideration is What source you are using for your genomic sequence?
Even a single base discrepancy can be the difference between success and failure with CRISPR and most of these other technologies. It is important that you know what the target looks like IN YOUR cell line. We therefore highly recommend that you sequence all alleles in your cell line so you know what you are targeting. 1bp or 2bp difference will have a big effect on whether you are going to be able to make an effective change. Imperative that you make sure you understand your target region so that your guides are appropriately designed to your real sequence. That’s one of the strengths of the gUIDEbook guide design system that we have developed jointly with Desktop Genetics – see example of output in slide – need to use it to identify potential guides and figure out how close are they to the modification want to make? Distance does matter!
How close is the guide to the desired mutation?
Distance is important, particularly for something like a point mutation. The closer the cut is to the change you want to make the most effective will be the guide.
What are the potential off-target considerations?
We pay a lot of attention to this at Horizon, the design algorithm takes into account all the sites that are obviously a perfect match and up to 1, 2, 3, or 4bp mismatched potential off effects elsewhere in the genome. Sometimes, can’t avoid; common to have some mismatches but need to know if in coding or non-coding. If non-coding is it in a regulatory region?
Data suggests that two nicks that result in a 5’ overhang are most efficient at being modified
It has also been shown that the distance or “offset” between the two guides is important for efficiency.
Once you have guide designs it can pay dividends to validate their activity before hand.
The accepted wisdom is to design 5 guides (or 10 if using pairs). Activity can be assessed semi quantitiatively using the Surveyor assay.
This done, you can then take just one or two forward for gene targeting in your cell line of choice.
Donor must be sufficiently different to prevent re-cutting
Include silent mutations
However, consider effects on expression on splicing
Also to consider is nature of donor – selection? Delivery method?
If you can imagine, even if you dsb is repaired by the HDR pathway, unless your donor is sufficiently different from you guide target sequence, you’re at high risk of having your modified allele further modified with CRISPR cuts and indels.
It is highly recommended therefore to include with your donor silent mutations in the guide target sequence.
If you alter the donor, in a coding region like our hypothetical example, how will codon substitutions affect the outcome? Will expression or splicing be affected? How big a donor do you need, how many changes are you introducing – where do you derive donor from? For targeting, every single bp important…also impt. on the donor side of things - want to introduce as few changes as possible in donor in order to achieve highest efficiencies.
Can use selection but need to be careful as introducing another ORF.
So you can see, there’s a lot to consider and a lot of value in working with a company that can do much more than just providing plasmids
Between our personal expertise and through our design tool we have implemented a donor design module that helps us to design the perfect donor for your project, and which will be stable and in-frame.
Historically Horizon’s tool of choice for gene editing was rAAV – for reasons not yet fully understood rAAV is very good at stimulating HDR, and so the system is perfect for introducing very precise modifications into the genome.
However, in general these modifications will only be introduced onto a single allele, which means that whilst it’s a great system for knock-in’s it lacks the efficiency of nucleases when it comes to knock-outs.
What we’re able to do now however is combined our experience with rAAV with CRISPR – evidence in the literature suggests that DSBs can stimulate HDR by rAAV, and we’ve found that by combining a cut with CRISPR and rAAV delivery of the donor we can improve efficiency of HDR by 50 fold.
In this case we have an in hosue testing system, a cell line containing a mutant (non-fluoresecent) GFP, and we can measure efficiency of targeting by rescue of fluoresence in FACS.
Historically Horizon’s tool of choice for gene editing was rAAV – for reasons not yet fully understood rAAV is very good at stimulating HDR, and so the system is perfect for introducing very precise modifications into the genome.
However, in general these modifications will only be introduced onto a single allele, which means that whilst it’s a great system for knock-in’s it lacks the efficiency of nucleases when it comes to knock-outs.
What we’re able to do now however is combined our experience with rAAV with CRISPR – evidence in the literature suggests that DSBs can stimulate HDR by rAAV, and we’ve found that by combining a cut with CRISPR and rAAV delivery of the donor we can improve efficiency of HDR by 50 fold.
In this case we have an in hosue testing system, a cell line containing a mutant (non-fluoresecent) GFP, and we can measure efficiency of targeting by rescue of fluoresence in FACS.
Desktop Genetics, in partnership with Horizon, has developed the premiere software platform tailored for CRISPR/Cas9 experiments
Complete guide design capabilities for all common nucleases, including Fok1 fused dCas9
Advanced tools for knock-in design (donors and optimal guide designs specifically for KIs)
Comprehensive multiple scoring dimensions to iform experimental prediction
Full integration with annotated reference genomes for accurate guide design
Stores experimental outcomes to continuously improve gRNA design
Flexible and simple user interface with collaboration tools and vendor integration
What is your like probability of your targeting desired event?
Armed with all the above information on the nature of the cell line, your transfection efficiency and your guide activity, you next consideration will be how many cells do you need to screen to have a chance of finding a positive.
In our case, as we’re looking for a single modified allele which at best will be ¼ of those cells that have been targeted we will need to scale up our screen accordingly.
The method you use to screen will depend largely on the modification your introducting – if for example you’re inserting a tag, you can screen using PCR at that locus.
If you’re introducing a framshift that will disrupt a restriction site, this can be used.
Finally, in many knock-outs the modification on each allele will be different, and so the surveyor assay can be used.
Finally, once you have identified a clone or clones that you believe contain your desired mutation the ultimate step is the validate these.
Of most interest is certainly going to be the nature of the modifications introduced at your target site – whether for example insertion deletions are present on all of your alleles, and if so, whether they result in frameshifts.
You may also wish to assess the off-target cutting in your clones, whether mutations have been introduced at your prediced off target sites, and you can do this using sequencing.
Finally, there are various other factors that will be critical to the utility of your cell line. Does the modification express (if it’s a knock-in) or not (if it’s a knock-out). Does your cell line remain genomically stable over multiple passages. And finally, given the length of time cells must remain in culture, and also the degree of handling we always test our engineered lines for contamination with mycoplasma and other microbes.
In summary If we however, try to consider them in the context of a hypothetical experimental goal this might help, and so for the sake of this example lets say we want to introduce a point mutation the coding sequence of a single allele of a gene, and we want to use CRISPR to make this happen
Further to this we….
Recent data from Feng Zhang’s and Eric Lander/David Sabatini’s laboratories indicate lentivirally delivered sgRNA can drive efficient enough cleavage of target genomic sequences that the technology can be used for whole genome screens
Results can then be assessed using next generation sequencing, with each sgRNA effectively acting as a bar code
This style of screen will complement or replace si or shRNA screens of a similar nature
SO the principal is that you synthesis a guide or guides against every gene in the genome, with the aim being that that guide is capable of disrupting the coding sequence of the gene and knocking it out.
These guides are cloned into a lentiviral delivery system to generate what has become known as a lentiCRISPR library
You can use this library to transduce cells, and by using the guides themselves as barcodes ask the question which guides are enriched when treated with a drug for example vs my control cell. This for example would tell you which knock-outs promotes resistance to this drug
In the case of the two papers on the previous slide, the proof of concept was to look for those genes that are essential.
Cancer is a genetic disease
Genome sequencing has generated 100’s of potential targets for cancer therapy
However, most targets are rare and poorly characterised
Most of them can’t be drugged directly e.g., tumour suppressors
If tumour suppressor loss is the prime cancer initiating event, agents exploiting this loss may assist with overcoming tumour heterogeneity
Systematic de-orphaning required to find key druggable downstream targets - exploiting co-dependence or synthetic lethality
Vectors
gRNA design services
Donor services and expertise in knock-ins
Services – viral encapsulation, project design support, expert support