SlideShare a Scribd company logo
1 of 11
GMO in somatotropin
production
The GMO
• A genetically modified organism (GMO) is
any organism whose genetic material has
been altered using genetic engineering
techniques
Somatotropin
• HGH
• It is a peptide hormone that stimulates
growth, cell reproduction, and cell
regeneration in humans and other animals.
• Growth hormone is produced in the growth-
stimulating somatotropic cells of the pituitary
gland, which is located at the base of the brain
Role in Humans
• stimulate the liver and other tissues to secrete
IGF-I. IGF-I (growth factors)
• stimulates proliferation of chondrocytes
(cartilage cells)
• Rapid growth of cells
Structure
(Primary and secondary )
Sequence
• 740 bp linear mRNA
• >NM_022560.3 Homo sapiens growth hormone 1 (GH1), mRNA
AAGAGACCAGCTCAAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTA
GCTGCAATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTC
AAGAGGGCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCG
TCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTC
ATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCT
CTGACAGCAACGTCTATGACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGA
AGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAAC
GATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACAT
TCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTG
TGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATA
AAATTAAGTTGCATCATTTTGTCTGAAAAAAAAAAAAAAA
Production
The strategies
• Enzymes used: EcoRI; Pvu II; BamHI
• Vector used: recombinant expression vector -
PhGH
• Host used: Escherichia coli
Somatotropin supplement
Genetically Modified organisms in Somatotropin production

More Related Content

What's hot

Inocula development for yeast processes
Inocula development for yeast processesInocula development for yeast processes
Inocula development for yeast processes
RipuDas
 
Single cell protein
Single cell proteinSingle cell protein
Single cell protein
Faiza Khalid
 

What's hot (20)

Metabolic engineering ppt
Metabolic engineering pptMetabolic engineering ppt
Metabolic engineering ppt
 
strain improvement techniques
strain improvement techniquesstrain improvement techniques
strain improvement techniques
 
Recombinant insulin
Recombinant insulinRecombinant insulin
Recombinant insulin
 
Molecular pharming
Molecular pharmingMolecular pharming
Molecular pharming
 
Production of lactic acid and acidic acid
Production of lactic acid and acidic acidProduction of lactic acid and acidic acid
Production of lactic acid and acidic acid
 
Inoculum development.pptx
Inoculum development.pptxInoculum development.pptx
Inoculum development.pptx
 
Modes of fermentation
Modes of fermentationModes of fermentation
Modes of fermentation
 
Recombinant production of insulin
Recombinant production of insulinRecombinant production of insulin
Recombinant production of insulin
 
Production of interferons
Production of interferonsProduction of interferons
Production of interferons
 
Knockout mice
Knockout miceKnockout mice
Knockout mice
 
Metabolic engineering
Metabolic engineeringMetabolic engineering
Metabolic engineering
 
Citric acid production
Citric acid productionCitric acid production
Citric acid production
 
Production of amino acid by microorganisms.
Production of amino acid by microorganisms. Production of amino acid by microorganisms.
Production of amino acid by microorganisms.
 
Inocula development for yeast processes
Inocula development for yeast processesInocula development for yeast processes
Inocula development for yeast processes
 
In vitro testing of drug toxicity
In vitro testing of drug toxicityIn vitro testing of drug toxicity
In vitro testing of drug toxicity
 
Strain development techniques of industrially important microorganisms
Strain development techniques of industrially important microorganismsStrain development techniques of industrially important microorganisms
Strain development techniques of industrially important microorganisms
 
Single cell protein
Single cell proteinSingle cell protein
Single cell protein
 
Media for industrial fermentation
Media for industrial fermentationMedia for industrial fermentation
Media for industrial fermentation
 
Exprssion vector
Exprssion vectorExprssion vector
Exprssion vector
 
Single cell protein
Single cell proteinSingle cell protein
Single cell protein
 

Similar to Genetically Modified organisms in Somatotropin production

Pituitary Hormones Dentistry 2010 Female
Pituitary Hormones Dentistry 2010 FemalePituitary Hormones Dentistry 2010 Female
Pituitary Hormones Dentistry 2010 Female
WAlid Salem
 

Similar to Genetically Modified organisms in Somatotropin production (20)

anterior pituitary
anterior pituitaryanterior pituitary
anterior pituitary
 
Pituitary and hypothalamic_hormones_ppt.-converted
Pituitary and hypothalamic_hormones_ppt.-convertedPituitary and hypothalamic_hormones_ppt.-converted
Pituitary and hypothalamic_hormones_ppt.-converted
 
Pituitary Gland
Pituitary GlandPituitary Gland
Pituitary Gland
 
pituitary gland.pptx
pituitary gland.pptxpituitary gland.pptx
pituitary gland.pptx
 
hormones of anterior pitutaty
hormones of anterior pitutatyhormones of anterior pitutaty
hormones of anterior pitutaty
 
Endocrine Physiology pituitary.
Endocrine Physiology  pituitary.Endocrine Physiology  pituitary.
Endocrine Physiology pituitary.
 
Regulation of growth and body mass
Regulation of growth and body massRegulation of growth and body mass
Regulation of growth and body mass
 
Endocrine system pharm D.pdf
Endocrine system pharm D.pdfEndocrine system pharm D.pdf
Endocrine system pharm D.pdf
 
dwarfism & GH
dwarfism & GH dwarfism & GH
dwarfism & GH
 
Anterior pituitary Hormones
Anterior pituitary HormonesAnterior pituitary Hormones
Anterior pituitary Hormones
 
Pituitary Gland
Pituitary GlandPituitary Gland
Pituitary Gland
 
Growth hormone
Growth hormone Growth hormone
Growth hormone
 
Glycoprotein by kk sahu sir
Glycoprotein by kk sahu sirGlycoprotein by kk sahu sir
Glycoprotein by kk sahu sir
 
Pitutary Hormones.pptx
Pitutary Hormones.pptxPitutary Hormones.pptx
Pitutary Hormones.pptx
 
Growth hormone
Growth hormoneGrowth hormone
Growth hormone
 
Hypothalamus 1
Hypothalamus 1Hypothalamus 1
Hypothalamus 1
 
Ppt on hypothalamic & anterior pituitary hormones
Ppt on hypothalamic & anterior pituitary hormonesPpt on hypothalamic & anterior pituitary hormones
Ppt on hypothalamic & anterior pituitary hormones
 
Pituitary Hormones Dentistry 2010 Female
Pituitary Hormones Dentistry 2010 FemalePituitary Hormones Dentistry 2010 Female
Pituitary Hormones Dentistry 2010 Female
 
Pituitary gland
Pituitary glandPituitary gland
Pituitary gland
 
Growth hormons
Growth hormonsGrowth hormons
Growth hormons
 

More from Arjun Kumar (7)

Microarray of long oligonucleotide
Microarray of long oligonucleotide Microarray of long oligonucleotide
Microarray of long oligonucleotide
 
Biosurfactants production and applications.
Biosurfactants production and applications.Biosurfactants production and applications.
Biosurfactants production and applications.
 
Bacterial diseases - Corynebacterium
Bacterial diseases - Corynebacterium Bacterial diseases - Corynebacterium
Bacterial diseases - Corynebacterium
 
viruses and viral diseases
viruses and viral diseasesviruses and viral diseases
viruses and viral diseases
 
classification of Amino acids
classification of Amino acids classification of Amino acids
classification of Amino acids
 
Industrial procedure of beer making
Industrial procedure of beer makingIndustrial procedure of beer making
Industrial procedure of beer making
 
Multidrug resistance in Microbes
Multidrug resistance in MicrobesMultidrug resistance in Microbes
Multidrug resistance in Microbes
 

Recently uploaded

Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdf
PirithiRaju
 
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
ssuser79fe74
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
PirithiRaju
 
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET
 
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Sérgio Sacani
 

Recently uploaded (20)

Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdf
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)
 
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 60009654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
 
GBSN - Microbiology (Unit 2)
GBSN - Microbiology (Unit 2)GBSN - Microbiology (Unit 2)
GBSN - Microbiology (Unit 2)
 
module for grade 9 for distance learning
module for grade 9 for distance learningmodule for grade 9 for distance learning
module for grade 9 for distance learning
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.
 
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxPSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
 
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
 
GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
Dopamine neurotransmitter determination using graphite sheet- graphene nano-s...
Dopamine neurotransmitter determination using graphite sheet- graphene nano-s...Dopamine neurotransmitter determination using graphite sheet- graphene nano-s...
Dopamine neurotransmitter determination using graphite sheet- graphene nano-s...
 
Pulmonary drug delivery system M.pharm -2nd sem P'ceutics
Pulmonary drug delivery system M.pharm -2nd sem P'ceuticsPulmonary drug delivery system M.pharm -2nd sem P'ceutics
Pulmonary drug delivery system M.pharm -2nd sem P'ceutics
 
STS-UNIT 4 CLIMATE CHANGE POWERPOINT PRESENTATION
STS-UNIT 4 CLIMATE CHANGE POWERPOINT PRESENTATIONSTS-UNIT 4 CLIMATE CHANGE POWERPOINT PRESENTATION
STS-UNIT 4 CLIMATE CHANGE POWERPOINT PRESENTATION
 
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
dkNET Webinar "Texera: A Scalable Cloud Computing Platform for Sharing Data a...
 
Clean In Place(CIP).pptx .
Clean In Place(CIP).pptx                 .Clean In Place(CIP).pptx                 .
Clean In Place(CIP).pptx .
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
 
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
9999266834 Call Girls In Noida Sector 22 (Delhi) Call Girl Service
 
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
 
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
 
Zoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdfZoology 5th semester notes( Sumit_yadav).pdf
Zoology 5th semester notes( Sumit_yadav).pdf
 

Genetically Modified organisms in Somatotropin production

  • 2. The GMO • A genetically modified organism (GMO) is any organism whose genetic material has been altered using genetic engineering techniques
  • 3. Somatotropin • HGH • It is a peptide hormone that stimulates growth, cell reproduction, and cell regeneration in humans and other animals. • Growth hormone is produced in the growth- stimulating somatotropic cells of the pituitary gland, which is located at the base of the brain
  • 4. Role in Humans • stimulate the liver and other tissues to secrete IGF-I. IGF-I (growth factors) • stimulates proliferation of chondrocytes (cartilage cells) • Rapid growth of cells
  • 6. Sequence • 740 bp linear mRNA • >NM_022560.3 Homo sapiens growth hormone 1 (GH1), mRNA AAGAGACCAGCTCAAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTA GCTGCAATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTC AAGAGGGCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCG TCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTC ATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCT CTGACAGCAACGTCTATGACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGA AGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAAC GATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACAT TCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTG TGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATA AAATTAAGTTGCATCATTTTGTCTGAAAAAAAAAAAAAAA
  • 8. The strategies • Enzymes used: EcoRI; Pvu II; BamHI • Vector used: recombinant expression vector - PhGH • Host used: Escherichia coli
  • 9.