FCS 681 Research Methods
Assignment #2
Experimental, quasi-experimental, and ex post facto designs
1. A researcher wants to investigate whether college students’ knowledge of the negative consequences of the overuse of credit will affect their attitudes about credit use. He plans to recruit one family studies class of 30 students from a local college campus (already enrolled in one class) and measure their attitudes toward credit with an attitude scale. Then, on four successive days, the researcher will teach them four lessons on the consequences of the overuse of credit: wage garnishment, repossession, foreclosure, and bankruptcy. On the fifth day, the researcher will administer an alternate form of the credit attitude scale (one intended to measure the same attitude). Then, he will try to infer whether college students’ knowledge of the negative consequences of the overuse of credit affects their attitudes about credit use.
a.. What is the independent variable and what is the treatment that the researcher will use to manipulate that variable?
The independent variable is the college student's knowledge of the negative consequences of overusing credit.
The treatment is educating students on the negative consequences of overusing credit including lessons on wage garnishment, foreclosure, repossession and bankruptcy .
b. What is the dependent variable in this study?
The dependent variable is the change in the college students attitudes towards overusing credit.
c. What type of research design is this researcher planning to use? Diagram it.
The researcher may use pre-Experimental Design, One Group Pretest Posttest study.
Measure Baseline Administer Program Measure Outcome
O X O
d. State the most likely alternative hypothesis of this researcher.
When college students increase their knowledge of the negative consequences of the overuse of credit, their positive attitude toward credit use will decrease.
e. What are the most important threats to the internal validity of the study? (Give an example of each threat in the language of the research problem.)
Selection- The effect may be due to nonequivalent subjects with different education levels, ages, and experience with credit history
Maturation: student’s attitude could change during the course of the experiment due to emotional or intellectual development between pre- and post test.
Mortality- Students could drop out between the pre- and post test.
Instrumentation- the effect on attitude may be due to the researcher using a different form of the credit attitude scale.
History- The students’ attitude on credit use changed as a result of an outside event such as seminar or personal experiences with creditors.
f. What two threats to internal validity are involved in this researcher’s plan to use an alternate form of the credit attitude scale? What is the trade-off?
Instrumentation threa ...
Experimental Research Design - Meaning, Characteristics and ClassificationSundar B N
This ppt contains Experimental Research Design Which covers Meaning, Characteristics and Classification of Experimental Research Design.
Subscribe to Vision Academy
https://www.youtube.com/channel/UCjzpit_cXjdnzER_165mIiw
Wk. 3 DiscussionFor this week’s discussion we have been tasked w.docxlefrancoishazlett
Wk. 3 Discussion
For this week’s discussion we have been tasked with comparing the characteristics of appropriate research designs and recommend a qualitative research design that would facilitate answering the instructor’s additional questions: : (a) How do their students actually feel about the intervention? and (b) How do students view the influence of the intervention on their learning inside and outside of the classroom (if applicable)?
When it comes to qualitative research methods there are several, however the three most common are participant observation, in-depth interviews and focus groups. Participant observation in a social setting tends to aim to gain a means of better understanding within a given group of individuals, their experiences and observations and collects data. In-depth interviews are utilized for collecting data on individual’s personal history, perspectives, and experiences. This is used particularly with sensitive information. Focus groups allow for data collection through group interview processes and tend to related to specific topics. (Frost, 2011)
In addition to our week two scenario the instructors would like to answer additional questions of how the students actually feel about the intervention as well as how the students view the influence of the intervention on their learning in the classroom as well as outside of the classroom. This relates to the phenomenology research design. Phenomenology focuses on individual thoughts and feelings and its purpose is to dive in and determine what feelings or experiences the students have in relation to the intervention. This method has several different characteristics:
· It seeks to understand how people experience a particular situation or phenomenon.
· It is conducted primarily through in-depth conversations and interviews; however, some studies may collect data from diaries, drawings, or observation.
· Small samples sizes, often 10 or less participants, are common in phenomenological studies.
· Interview questions are open-ended to allow the participants to fully describe the experience from their own view point.
· Phenomenology is centered on the participants’ experiences with no regard to social or cultural norms, traditions, or preconceived ideas about the experience.
· It focuses on these four aspects of a lived experience: lived spaced, lived body, lived time, and lived human relations.
· Data collected is qualitative and analysis includes an attempt to identify themes or make generalizations regarding how a particular phenomenon is actually perceived or experienced. (CIRT, 2019)
Phenomenological research studies tend to be interested in the life experiences of human and would relate directly to answering the instructors additional research questions. (CIRT, 2019) According to CIRT 2019, “A phenomenological study attempts to set aside biases and preconceived assumptions about human experiences, feelings, and responses to a particular situation. It allows th.
Experimental ProceduresThe specific experimental design procedur.docxgitagrimston
Experimental Procedures
The specific experimental design procedures also need to be identified. This discussion involves indicating the overall experiment type, citing reasons for the design, and advancing a visual model to help the reader understand the procedures.
• Identify the type of experimental design to be used in the proposed study. The types available in experiments are pre-experimental designs, quasi-experiments, true experiments, and single-subject designs. With pre-experimental designs, the researcher studies a single group and provides an intervention during the experiment. This design does not have a control group to compare with the experimental group. In quasi-experiments, the investigator uses control and experimental groups but does not randomly assign participants to groups (e.g., they may be intact groups available to the researcher). In a true experiment, the investigator randomly assigns the participants to treatment groups. A single-subject design or N of 1 design involves observing the behavior of a single individual (or a small number of individuals) over time.
• Identify what is being compared in the experiment. In many experiments, those of a type called between-subject designs, the investigator compares two or more groups (Keppel & Wickens, 2003; Rosenthal & Rosnow, 1991). For example, a factorial design experiment, a variation on the betweengroup design, involves using two or more treatment variables to examine the independent and simultaneous effects of these treatment variables on an outcome (Vogt, 2011). This widely used behavioral research design explores the effects of each treatment separately and also the effects of variables used in combination, thereby providing a rich and revealing multidimensional view. In other experiments, the researcher studies only one group in what is called a within-group design. For example, in a repeated measures design, participants are assigned to different treatments at different times during the experiment. Another example of a within-group design would be a study of the behavior of a single individual over time in which the experimenter provides and withholds a treatment at different times in the experiment to determine its impact.
• Provide a diagram or a figure to illustrate the specific research design to be used. A standard notation system needs to be used in this figure. A research tip I recommend is to use a classic notation system provided by Campbell and Stanley (1963, p. 6):
X represents an exposure of a group to an experimental variable or event, the effects of which are to be measured.
O represents an observation or measurement recorded on an instrument.
Xs and Os in a given row are applied to the same specific persons. Xs and Os in the same column, or placed vertically relative to each other, are simultaneous.
The left-to-right dimension indicates the temporal order of procedures in the experiment (sometimes indicated with an ...
Experimental Research Design - Meaning, Characteristics and ClassificationSundar B N
This ppt contains Experimental Research Design Which covers Meaning, Characteristics and Classification of Experimental Research Design.
Subscribe to Vision Academy
https://www.youtube.com/channel/UCjzpit_cXjdnzER_165mIiw
Wk. 3 DiscussionFor this week’s discussion we have been tasked w.docxlefrancoishazlett
Wk. 3 Discussion
For this week’s discussion we have been tasked with comparing the characteristics of appropriate research designs and recommend a qualitative research design that would facilitate answering the instructor’s additional questions: : (a) How do their students actually feel about the intervention? and (b) How do students view the influence of the intervention on their learning inside and outside of the classroom (if applicable)?
When it comes to qualitative research methods there are several, however the three most common are participant observation, in-depth interviews and focus groups. Participant observation in a social setting tends to aim to gain a means of better understanding within a given group of individuals, their experiences and observations and collects data. In-depth interviews are utilized for collecting data on individual’s personal history, perspectives, and experiences. This is used particularly with sensitive information. Focus groups allow for data collection through group interview processes and tend to related to specific topics. (Frost, 2011)
In addition to our week two scenario the instructors would like to answer additional questions of how the students actually feel about the intervention as well as how the students view the influence of the intervention on their learning in the classroom as well as outside of the classroom. This relates to the phenomenology research design. Phenomenology focuses on individual thoughts and feelings and its purpose is to dive in and determine what feelings or experiences the students have in relation to the intervention. This method has several different characteristics:
· It seeks to understand how people experience a particular situation or phenomenon.
· It is conducted primarily through in-depth conversations and interviews; however, some studies may collect data from diaries, drawings, or observation.
· Small samples sizes, often 10 or less participants, are common in phenomenological studies.
· Interview questions are open-ended to allow the participants to fully describe the experience from their own view point.
· Phenomenology is centered on the participants’ experiences with no regard to social or cultural norms, traditions, or preconceived ideas about the experience.
· It focuses on these four aspects of a lived experience: lived spaced, lived body, lived time, and lived human relations.
· Data collected is qualitative and analysis includes an attempt to identify themes or make generalizations regarding how a particular phenomenon is actually perceived or experienced. (CIRT, 2019)
Phenomenological research studies tend to be interested in the life experiences of human and would relate directly to answering the instructors additional research questions. (CIRT, 2019) According to CIRT 2019, “A phenomenological study attempts to set aside biases and preconceived assumptions about human experiences, feelings, and responses to a particular situation. It allows th.
Experimental ProceduresThe specific experimental design procedur.docxgitagrimston
Experimental Procedures
The specific experimental design procedures also need to be identified. This discussion involves indicating the overall experiment type, citing reasons for the design, and advancing a visual model to help the reader understand the procedures.
• Identify the type of experimental design to be used in the proposed study. The types available in experiments are pre-experimental designs, quasi-experiments, true experiments, and single-subject designs. With pre-experimental designs, the researcher studies a single group and provides an intervention during the experiment. This design does not have a control group to compare with the experimental group. In quasi-experiments, the investigator uses control and experimental groups but does not randomly assign participants to groups (e.g., they may be intact groups available to the researcher). In a true experiment, the investigator randomly assigns the participants to treatment groups. A single-subject design or N of 1 design involves observing the behavior of a single individual (or a small number of individuals) over time.
• Identify what is being compared in the experiment. In many experiments, those of a type called between-subject designs, the investigator compares two or more groups (Keppel & Wickens, 2003; Rosenthal & Rosnow, 1991). For example, a factorial design experiment, a variation on the betweengroup design, involves using two or more treatment variables to examine the independent and simultaneous effects of these treatment variables on an outcome (Vogt, 2011). This widely used behavioral research design explores the effects of each treatment separately and also the effects of variables used in combination, thereby providing a rich and revealing multidimensional view. In other experiments, the researcher studies only one group in what is called a within-group design. For example, in a repeated measures design, participants are assigned to different treatments at different times during the experiment. Another example of a within-group design would be a study of the behavior of a single individual over time in which the experimenter provides and withholds a treatment at different times in the experiment to determine its impact.
• Provide a diagram or a figure to illustrate the specific research design to be used. A standard notation system needs to be used in this figure. A research tip I recommend is to use a classic notation system provided by Campbell and Stanley (1963, p. 6):
X represents an exposure of a group to an experimental variable or event, the effects of which are to be measured.
O represents an observation or measurement recorded on an instrument.
Xs and Os in a given row are applied to the same specific persons. Xs and Os in the same column, or placed vertically relative to each other, are simultaneous.
The left-to-right dimension indicates the temporal order of procedures in the experiment (sometimes indicated with an ...
Question 1.A group of researchers is replicating an earlier .docxIRESH3
Question 1.
A group of researchers is replicating an earlier experiment that indicated that participants who received task-specific feedback were more likely to persist at a task than participants who received more general, encouraging feedback. In an effort to ensure that participants are not treated differently based on the condition that they are in, the researchers automate all of the procedures and follow a written protocol when interacting with the participants. The researchers are trying to minimize:
placebo effects.
demand characteristics.
experimenter expectancy effects.
participant suspicion effects.
Question 2.
In a study examining the effects of heredity on intelligence, researchers compare the correlation of intelligence test scores of identical twins with the correlation of intelligence test scores for fraternal twins. In this experiment, the researcher is assuming that the comparison of identical and fraternal twins is a measure of heredity. This is an example of a ________________ inference.
construct
statistical
generalizability
Causal
Question 3
Researchers interested in studying the effect of happiness on various health outcomes randomly assign each person who comes in to the laboratory to one of two study conditions. However, several people in the study are friends and drove to the study together. The group of friends indicates that they need to be in the same condition of the study so that they can all leave at the together to get home. Accommodating the subjects' request might threaten validity because of the effect of:
regression to the mean.
attrition.
maturation.
selection.
Question 4
In an experiment on the effects of everyday stress on memory, a researcher has participants record every hour how much stress they are feeling and then complete a short-term memory task. The results of the study reveal that everyday stress may affect short-term memory. After evaluating the results of the study, however, the researcher is concerned that people who have high scores on neuroticism questionnaires are more likely to report stress and exhibit memory problems than people who have low scores. The researcher is worried about __________ validity.
construct
internal
statistical conclusion
external
Question 5
__________ validity concerns the generalizability of findings beyond the present study.
Ecological
Construct
Statistical conclusion
External
Question 6
A researcher is investigating the ability of aversive punishment to decrease students' disruptive behaviors in class. She is worried that the number of punishments will vary from student to student and thus will bias the results of the study. The researcher would do well to:
run a pilot test before conducting the study.
manipulate participants' knowledge about the study.
use a yoked control-group.
use a red herring technique.
Question 7
A psychologist is examini ...
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to FCS 681 Research MethodsAssignment #2Experimental, quasi-exper.docx
Question 1.A group of researchers is replicating an earlier .docxIRESH3
Question 1.
A group of researchers is replicating an earlier experiment that indicated that participants who received task-specific feedback were more likely to persist at a task than participants who received more general, encouraging feedback. In an effort to ensure that participants are not treated differently based on the condition that they are in, the researchers automate all of the procedures and follow a written protocol when interacting with the participants. The researchers are trying to minimize:
placebo effects.
demand characteristics.
experimenter expectancy effects.
participant suspicion effects.
Question 2.
In a study examining the effects of heredity on intelligence, researchers compare the correlation of intelligence test scores of identical twins with the correlation of intelligence test scores for fraternal twins. In this experiment, the researcher is assuming that the comparison of identical and fraternal twins is a measure of heredity. This is an example of a ________________ inference.
construct
statistical
generalizability
Causal
Question 3
Researchers interested in studying the effect of happiness on various health outcomes randomly assign each person who comes in to the laboratory to one of two study conditions. However, several people in the study are friends and drove to the study together. The group of friends indicates that they need to be in the same condition of the study so that they can all leave at the together to get home. Accommodating the subjects' request might threaten validity because of the effect of:
regression to the mean.
attrition.
maturation.
selection.
Question 4
In an experiment on the effects of everyday stress on memory, a researcher has participants record every hour how much stress they are feeling and then complete a short-term memory task. The results of the study reveal that everyday stress may affect short-term memory. After evaluating the results of the study, however, the researcher is concerned that people who have high scores on neuroticism questionnaires are more likely to report stress and exhibit memory problems than people who have low scores. The researcher is worried about __________ validity.
construct
internal
statistical conclusion
external
Question 5
__________ validity concerns the generalizability of findings beyond the present study.
Ecological
Construct
Statistical conclusion
External
Question 6
A researcher is investigating the ability of aversive punishment to decrease students' disruptive behaviors in class. She is worried that the number of punishments will vary from student to student and thus will bias the results of the study. The researcher would do well to:
run a pilot test before conducting the study.
manipulate participants' knowledge about the study.
use a yoked control-group.
use a red herring technique.
Question 7
A psychologist is examini ...
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Instructions for Submissions thorugh G- Classroom.pptxJheel Barad
This presentation provides a briefing on how to upload submissions and documents in Google Classroom. It was prepared as part of an orientation for new Sainik School in-service teacher trainees. As a training officer, my goal is to ensure that you are comfortable and proficient with this essential tool for managing assignments and fostering student engagement.
This presentation provides an introduction to quantitative trait loci (QTL) analysis and marker-assisted selection (MAS) in plant breeding. The presentation begins by explaining the type of quantitative traits. The process of QTL analysis, including the use of molecular genetic markers and statistical methods, is discussed. Practical examples demonstrating the power of MAS are provided, such as its use in improving crop traits in plant breeding programs. Overall, this presentation offers a comprehensive overview of these important genomics-based approaches that are transforming modern agriculture.
Solid waste management & Types of Basic civil Engineering notes by DJ Sir.pptxDenish Jangid
Solid waste management & Types of Basic civil Engineering notes by DJ Sir
Types of SWM
Liquid wastes
Gaseous wastes
Solid wastes.
CLASSIFICATION OF SOLID WASTE:
Based on their sources of origin
Based on physical nature
SYSTEMS FOR SOLID WASTE MANAGEMENT:
METHODS FOR DISPOSAL OF THE SOLID WASTE:
OPEN DUMPS:
LANDFILLS:
Sanitary landfills
COMPOSTING
Different stages of composting
VERMICOMPOSTING:
Vermicomposting process:
Encapsulation:
Incineration
MANAGEMENT OF SOLID WASTE:
Refuse
Reuse
Recycle
Reduce
FACTORS AFFECTING SOLID WASTE MANAGEMENT:
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
How to Split Bills in the Odoo 17 POS ModuleCeline George
Bills have a main role in point of sale procedure. It will help to track sales, handling payments and giving receipts to customers. Bill splitting also has an important role in POS. For example, If some friends come together for dinner and if they want to divide the bill then it is possible by POS bill splitting. This slide will show how to split bills in odoo 17 POS.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
The Indian economy is classified into different sectors to simplify the analysis and understanding of economic activities. For Class 10, it's essential to grasp the sectors of the Indian economy, understand their characteristics, and recognize their importance. This guide will provide detailed notes on the Sectors of the Indian Economy Class 10, using specific long-tail keywords to enhance comprehension.
For more information, visit-www.vavaclasses.com
How to Create Map Views in the Odoo 17 ERPCeline George
The map views are useful for providing a geographical representation of data. They allow users to visualize and analyze the data in a more intuitive manner.
FCS 681 Research MethodsAssignment #2Experimental, quasi-exper.docx
1. FCS 681 Research Methods
Assignment #2
Experimental, quasi-experimental, and ex post facto designs
1. A researcher wants to investigate whether college students’
knowledge of the negative consequences of the overuse of credit
will affect their attitudes about credit use. He plans to recruit
one family studies class of 30 students from a local college
campus (already enrolled in one class) and measure their
attitudes toward credit with an attitude scale. Then, on four
successive days, the researcher will teach them four lessons on
the consequences of the overuse of credit: wage garnishment,
repossession, foreclosure, and bankruptcy. On the fifth day, the
researcher will administer an alternate form of the credit
attitude scale (one intended to measure the same attitude). Then,
he will try to infer whether college students’ knowledge of the
negative consequences of the overuse of credit affects their
attitudes about credit use.
a.. What is the independent variable and what is the treatment
that the researcher will use to manipulate that variable?
The independent variable is the college student's knowledge of
the negative consequences of overusing credit.
The treatment is educating students on the negative
consequences of overusing credit including lessons on wage
garnishment, foreclosure, repossession and bankruptcy .
b. What is the dependent variable in this study?
The dependent variable is the change in the college students
attitudes towards overusing credit.
c. What type of research design is this researcher planning to
use? Diagram it.
2. The researcher may use pre-Experimental Design, One Group
Pretest Posttest study.
Measure Baseline Administer Program Measure
Outcome
O X O
d. State the most likely alternative hypothesis of this
researcher.
When college students increase their knowledge of the negative
consequences of the overuse of credit, their positive attitude
toward credit use will decrease.
e. What are the most important threats to the internal validity
of the study? (Give an example of each threat in the language of
the research problem.)
Selection- The effect may be due to nonequivalent subjects with
different education levels, ages, and experience with credit
history
Maturation: student’s attitude could change during the course
of the experiment due to emotional or intellectual development
between pre- and post test.
Mortality- Students could drop out between the pre- and post
test.
Instrumentation- the effect on attitude may be due to the
researcher using a different form of the credit attitude scale.
History- The students’ attitude on credit use changed as a
result of an outside event such as seminar or personal
experiences with creditors.
f. What two threats to internal validity are involved in this
researcher’s plan to use an alternate form of the credit attitude
scale? What is the trade-off?
Instrumentation threat is involved in this research, as the
researcher’s plan to use an alternate form of the credit attitude
3. scale. This means the effect on students’ attitude about credit
use may be due to the researcher using a different form of the
credit attitude scale. When the research uses different form of
credit attitude scale, he or she would like to avoid testing
threat, which can occur when the researcher uses the same form
of scale in pre and post- test. If the research uses the same form
of scale throughout the study, the testing threat may cause the
student to be primed or be aware during the pre-test. As a
result, the students’ performance in posttest might be due to the
pre-test (methodological independent variable) instead of the
treatment itself.
Trade- off: It is impossible for both instrumentation and testing
threat exist in the same study. If the researcher wants to use the
same credit attitude scale in pre-posttest to avoid
instrumentation threat, then testing threat might occur in his or
her study. In contrast, if the researcher wants to use different
form of credit attitude scale in pre-posttest to avoid testing
threat, then instrumentation threat might occur in his or her
study.
g. Briefly describe the analysis this researcher would use to
answer his research question (i.e., what would he compare to
what?)
The researcher would compare the results from pre and post
tests. Any difference, such as increase or decrease from posttest
to pretest is possibly related to the treatment which is
represented by X.
Suppose that instead of the design described, the researcher
randomly assigned each of the 30 students to two groups.
Suppose he did everything the same as before, except a teacher
took one group of students on a field trip each of the four
“treatment” days during their family studies class to a local
historical site.
4. h. What type of research design is he now using? Diagram it.
Experimental Pretest-posttest control group design
experimental.
R O X O
R O O
i. Does this design now have a classic “placebo” control group?
Yes. The control group is the group who was measure their
attitudes toward credit with attitude scale before and after the
event of field trip, but they were not brought to the field trip for
“treatment”.
j. Compare and contrast these two research designs’ internal and
external validity.
Threats to internal validity in these two designs include
selection bias. It is possible that the groups are not formed
equivalently . It could be possible that subjects in one have a
characteristic that would affect the dependent variable. One of
the threats to external validity would be pre-test treatment
interaction. The subjects’ reactions to the treatment might be
affected by their exposure to a pretest gaging their attitude
toward credit. Furthermore, the experimental pretest-posttest
control group design is better control of the threats to internal
validity.
1st Research
Pre-experimental
2nd research
Experimental Pretest-posttest control group design
Selection threat
√
√
Maturation threat
5. √
Instrumentation threat
√
√
History threat
√
Testing threat
Mortality threat
√
√
The threat from methodological independent variable ( pre-test)
→ on to the post test results
√
√
Ambiguity about causal direction
√
(It is because we do not know the posttest results are due to the
treatment or other internal/ external threats)
Interaction of selection-treatment
√
√
Interaction of setting-treatment
√
√
Interaction of history-treatment
2. A research team wants to study the effect of handbag
advertising on women’s choice of handbags. They are concerned
6. about the potential effects of the women having any clue before
the ads are shown about the content of the study (particularly
the treatment). They randomly assign 100 women (19-22 years
old) to four groups. They ask two groups of women to choose a
handbag from a group of four handbags before the treatment.
Two other groups will not be asked initially about their handbag
choices. Of the first two groups, one group will be shown a
television program containing 40-second handbag ads on one of
the handbags and the other group will be shown the program
without ads. Of the last two groups, one group will see the
program with the ads and the other group without the ads. Then,
each woman will be asked to choose a handbag from a set of
four possible handbags (including the one in the ads). Then, the
researchers will try to infer whether women shown the handbag
advertisements choose different handbags from the women not
shown the ads (i.e., whether advertising affects women’s choice
of handbags).
a. What is the substantive independent variable in this study?
The advertisement of the handbags
b. What additional (methodological) independent variable is
planned?
The pretest- having women choose handbags before the
treatment.
c. What is the dependent variable in this study?
The women’s choice of handbag
(which means how women react to advertising and whether or
not it has an an effect on their choice of handbags)
d. What research design is this research team planning?
Diagram it.
Solomon Four Group Design
R O X O
R O O
7. R X O
R O
e. What are the threats to internal validity of this research
design?
History - The women might choose a certain handbag due to a
particular well-known fashion show instead of 40-seconds
handbag ads.
Selection : The effect might be different due to the difference in
the income levels of the women. Some might prefer more
expensive brands than others based upon their income level.
Maturation: The women might choose a particular bag due to
their maturation and growth. Some women might read different
fashion magazines, watching different fashion shows, or
discussing with their friends regarding fashion throughout their
lifetime. All of these factors (intellectual/ emotional) might
contribute to the women choose a particular bag, and this is not
due to the 40-seconds handbag ads.
Testing: The women are asked to do the same task in pre-
posttest, which is asking the women to choose a handbag from a
set of four possible handbags. s. The women’s choice of
handbag in posttest might be due to the pretest instead of the
40-seconds handbag ad
f. What is the third (methodological) null hypothesis in this
study?
There is no effect of interaction between giving women a
pretest (choosing handbags), when it comes to the choice they
make in handbags during the posttest.
g. (extra credit) Briefly explain how this team would analyze
their data to answer their research question and deal with their
methodological concern, including the two different
possibilities that could occur in the test of the third null
hypothesis.
8. Group1 O X O
Group2 O O
Group3 X O
Group4 O
In order to observe the effect from pretest, the team should
compare the posttest results from group 3 and 4 to the posttests
result in group 1 and 2. Therefore, the researcher would know
whether the posttest result is due to the effect from pretest.
In order to observe the interaction effect, the researcher has to
compare the posttest results in group 1 and 2, group 2 and 3,
group 3 and 4, etc.
3. A researcher wants to investigate whether college students’
knowledge of the negative consequences of the overuse of credit
will affect their attitudes about credit use. He plans to recruit
two professors to help him in his research. One professor of
family and consumer sciences is planning a unit of four lessons
of credit, such as wage garnishment, repossession, foreclosure,
and bankruptcy. The other professor in social studies is teaching
a unit about Australia. Each professor’ class has 30 students. At
the beginning of the study, the researcher will measure each
student’s attitudes toward credit with an attitude scale. Then,
each professor will teach her lessons. After that, the researcher
will administer an alternate form of the credit attitude scale to
each student. Then, he will try to infer whether college
students’ knowledge of the negative consequences of the
overuse of credit affects their attitudes toward credit use.
a. What type of research design is this researcher planning to
use? Diagram it.
Quasi-experimental design-non-equivalent control group
design.
O x O
-------------------
9. O O
b. What do you believe is the one most important threat to the
internal validity of this study? (Use the specific languages of
the problem.)
Instrumentation - because different forms of credit attitude
scale were used between pretest and posttest
Selection: Students come from different majors and educational
background. Students from FCS might already have some
knowledge related to credit use. In contrast, students from
social studies might not have prior or limited exposure to the
subject matter related to credit use. In this study there is no
random assignment of the experimental groups. Selection bias is
a threat which may create the formation of non-equivalent
groups.
c. What could this researcher do to address this threat?
To address selection threat, the researchers should take students
either from FCS or social sciences so the educational
background will be similar.
1) Preliminary matching
2) Assign a subgroup of subjects randomly to groups
3) Analysis of covariance
To address instrumentation threat, the researcher should use the
same form of credit attitude scale in pre-posttest.
d. Compare and contrast this design to a previous research
design (question #1: h). Which do you believe is the better
research design? Why?
The research design in question 1:h, pretest- posttest control
group design is a better research design since it includes
random assignment of participants. If random assignment is not
used there may be unobserved factors causing the differences
between two groups, not the treatment. If the subjects are
assigned randomly then the only difference between the groups,
10. on average, is whether they receive the treatment.
1st Research - Experimental Pretest-posttest control group
design experimental.
2nd research- Quasi Experimental, nonequivalent control group.
Selection threat
✓
✓
Maturation threat
✓
Instrumentation threat
✓
✓
History threat
✓
Testing threat
Mortality threat
✓
✓
The threat from methodological independent variable ( pre-test)
→ on to the post test results
✓
✓
Ambiguity about causal direction
Interaction of selection-treatment
✓
✓
Interaction of setting - treatment
✓
✓
11. Interaction of history - treatment
4. A researcher wants to investigate whether college students’
knowledge of the negative consequences of the overuse of credit
will affect their attitudes about credit use. The researcher will
select a random sample of 100 college students from a list of all
college students at CSUN. He will measure each student’s
knowledge of the negative consequences (delinquency, wage
garnishment, foreclosure, bankruptcy, etc) of the overuse of
credit with a 20-item self-report objective test. At the same
time, he will measure each student’s attitudes toward credit
with an attitude scale. Then, he will try to infer whether college
students’ knowledge of the negative consequences of the
overuse of credit affects their attitudes toward credit use. (He
wants to infer cause-and-effect relationship.)
a. What type of research design is this researcher planning to
use (be precise)? Diagram it.
Ex post facto, Cross sectional design.
X O
Y
· Population of CSUN students
· Subgroup:100 that are randomly selected to represent
· Two tests given at the same time
· 1) 20-Item Self-Report Objective Test (X)
· 2) Attitude Scale (Y)
· Outcomes (O) of the students’ knowledge regarding the
negative consequences of credit overuse and its effect on their
attitudes toward credit use.
12. b. Describe its advantage over other ex post facto designs.
The advantage that this ex post facto, cross sectional design has
over other ex post facto designs is that there are no problem
with changes in conditions, data is much easier to obtain, and it
can be used even when the subject matter can be observed only
once. Also, because this study does not monitor changes in its
participants over a period of time, the cross sectional design is
the most appropriate design. Meanwhile, other ex post facto
designs, such as trend studies, view the changes within a
general population over time. Cohort studies will look at more
specific sub-populations as they change over time, and panel
studies will look at the same set of people each time. Time
series will look at the long view of a study, which would be the
exact opposite of a cross sectional, since cross sectional
chooses one period of time.
c. Is history a threat to the internal validity of this design? Why
or why not?
No, history is not a threat to the internal validity of this design.
This study design does not involve pre and posttest. The
researcher only measure once on the student’s attitude toward
credit use with an attitude scale.
d. Is maturation a threat to the internal validity of this design?
Why or why not?
No, maturation is not a threat to the internal validity of this
design. This study design does not involve pre and posttest. The
researcher only measures once on the student’s attitude toward
credit use with an attitude scale.
e. It testing a threat to the internal validity of this design? Why
or why not?
No, testing is not a threat to the internal validity of this design.
Testing threat only occur in pre-post design studies. The
researcher measures each student’s knowledge of the negative
consequences of the overuse of credit, and he will measure each
13. student’s attitudes toward credit with an attitude scale at the
same time. There are no pre-post design involved in this study.
f. Is instrumentation a threat to the internal validity of this
design? Why or why not?
No, instrumentation is not a threat to the internal validity of this
design. Similar to testing threat, instrumentation only occur in
pre-post design studies or between two measurement period. It
is related to any pre-post gain that is attributable to the change
of instrument, which is the human observer. For example, the
observer might getting better in measuring the variables in post
test than in the pre test. However, in this case, the observer
measures each student’s knowledge of the negative
consequences of the overuse of credit at the same time with the
measurement of each student’s attitudes toward credit.
g. Is mortality a threat to the internal validity of this design?
Why or why not?
No, mortality is not a threat to the internal validity of this
design. Mortality threat only occurs when there are dropouts of
samples in between two measurement points in a study, which
are pre and posttest. This study design does not involve pre and
posttest. The researcher only measure once on the student’s
attitude toward credit use with an attitude scale.
h. What is the most important threat to the internal validity of
this study? What could this researcher do to address this threat?
What could this researcher do to address this threat? Be specific
in discussing this in relation to THIS particular study.
The most important threat to the internal validity of this study
is ambiguity of cause and effect relationship, since there is no
causal relationship that can be identified. A researcher could
create a longer time-frame, so that it would be easier to
determine whether the outcome resulted from the exposure in
time.
14. i. Describe another important threat to the internal validity of
this design that is NOT a threat to any previous design we have
considered.
The type of people selected cannot be generalized for the entire
population
The ex post facto design is only measured once. There is no way
to know whether or not there is a difference of performance
after the treatment because there is no pretest. There is also no
random sampling and no statistical control because it is only
measured a single time.
j. Compare and contrast this research design to the research
designs in question #1 (note: there are two designs in question
#1: c & h) and question #3 in terms of both internal and external
validity. Please be organized in this answer.
The ex post facto design can be used to to establish cause and
effect when experimental design is not possible. lt is less
expensive and time consuming than experimental research.
The limitation of post facto design are that the researcher is
unable to manipulate the independent variable purposively, and
data may be unreliable due to the fact that subjects are not
assigned randomly. The major threat to internal validity of ex
post facto design is ambiguity about causal direction, the
inability to be sure whether A causes B or B causes A.
1st Research Ex post facto design (cross sectional design)
2nd research Pre-experimental design
3rd Research
Experimental design
Selection threat
✓
✓
Maturation threat
15. ✓
✓
Instrumentation threat
✓
✓
History threat
✓
✓
Testing threat
Mortality threat
✓
✓
The threat from methodological independent variable ---> on to
post test results
✓
Ambiguity about causal direction
✓
Interaction of selection-treatment
✓
✓
Interaction of setting treatment
✓
✓
Interaction of history treatment
16. k. Which of these four designs do you believe is the best
research design? Why?
Although there is no perfect design, Solomon four-group design
might be the best research design. It is appropriate for research
that contains large sample group. It can eliminate almost all
both internal and external threats for large sample population.
However, it might be hard to perform solomon four-group
design if the research contains small sample population.
http://franchiselawyer.com/overview-of-franchising
http://legal-dictionary.thefreedictionary.com/franchise
Read assigned materials above and respond to the questions
below.
1. What are 2 primary advantages of a franchise and why?
2. What are 2 primary disadvantages of a franchise and why?
6
Name:NoufAlkharashi
FCS 681 Research Methods
Assignment #2
Experimental, quasi-experimental, and ex post facto designs
17. 1. A researcher wants to investigate whether college students’
knowledge of the negative consequences of the overuse of credit
will affect their attitudes about credit use. He plans to recruit
one family studies class of 30 students from a local college
campus (already enrolled in one class) and measure their
attitudes toward credit with an attitude scale. Then, on four
successive days, the researcher will teach them four lessons on
the consequences of the overuse of credit: wage garnishment,
repossession, foreclosure, and bankruptcy. On the fifth day, the
researcher will administer an alternate form of the credit
attitude scale (one intended to measure the same attitude). Then,
he will try to infer whether college students’ knowledge of the
negative consequences of the overuse of credit affects their
attitudes about credit use.
a. What is the independent variable and what is the treatment
that the researcher will use to manipulate that variable?
· The credit usage is an independent variable. The researcher
aims at teaching the students to realize the consequences
ventured into due to overuse of credit. Therefore, through
imparting knowledge and measuring their attitude will tend to
manipulate on the credit usage but credit as an independent
variable remains to be credit. Comment by Yali Yang: +3
b. What is the dependent variable in this study?
· Students’ attitude is a dependent variable. The researcher uses
the credit attitude measurement scale to find changes impacted
to students by overuse of the credit. Comment by Yali Yang: +3
·
c. What type of research design is this researcher planning to
use? Diagram it.
· The researcher plans to use Experimental research design as it
uses both the independent and dependent variables. The
variablesbecome the inputs and the outputs of the research study
in the college.
18. Independent Condition A influences Dependent
Variable Condition B Variable
d. State the most likely alternative hypothesis of this researcher.
· The alternative hypothesis of the researcher was to prove that
students’ knowledge of the adverse consequences of the overuse
of credit will affect their attitudes about credit use. Comment by
Yali Yang: +3
e. What are the most important threats to the internal validity of
the study? (Give an example of each threat in the language of
the research problem.)
· Theprobeof an instrument used to whether measures accurately
or not. For example, the credit attitudes scale.
· The use of single sampling method in a college to do the
research. For example, the researcher uses a family of 30
students enrolled in the same class in a large population.
f. What two threats to internal validity are involved in this
researcher’s plan to use an alternate form of the credit attitude
scale? What is the trade-off?
· Poor and inaccurate results might be measured thus a threat to
the validity of the study.
· Time taken might vary once an alternate form to administer is
used and thus cause a threat to the study results in the
measurement process.
The trade off in the research study is the usage of the actual
credit scale in comparison to the alternate form of measurement
as it provides quality feedback and on time results analysis.
g. Briefly describe the analysis this researcher would use to
answer his research question (i.e., what would he compare to
what?)
· The researcher will examine the student’s knowledge of the
consequences of the standard usage of credit with that of
overuse before their attitude is affected. In regards to the
teaching lessons the researcher would offer to the students
19. aiming at validating the research question. Also, the use of
credit attitude scales in comparison with the alternate form of
attitude scale measurement to verify his problem in research.
Suppose that instead of the design described, the researcher
randomly assigned each of the 30 students to two groups.
Suppose he did everything the same as before, except a teacher
took one group of students on a field trip each of the four
“treatment” days during their family studies class to a local
historical site.
h. What type of research design is he now using? Diagram it.
· He is using Randomized Blocked Design i.eStratified random
sampling research designthat assigns a given sample into two
groups thus research study will be conducted to reduce variance
in the data or noise.
· Its diagram is seen to have relative homogenous subgroups
then implementation of experimental design study. Therefore,
the randomized block design will be more efficient in estimates
across the entire sample.
i. Does this design now have a classic “placebo” control group?
· Yes, it has a classic placebo since there won’t be a change of
behavior in the two different groups randomly assigned in the
research study. The researcher will be able to get precise results
in the two groups. Comment by Yali Yang: +3
j. Compare and contrast these two research designs’ internal and
external validity.
· In Experimental research design, there is a total lack of
control as compared to the Stratified research design that has
subgroup and controlled, hence can secure valid evidence and
data required in their treatment as they interact.
· The tendency of having errors of misplaced precision on
Experimental research due to a tedious collection of data in the
sample as compared to the stratified research that has exact
20. subgroup to test.
· Both research design needs an instrument that are internally
used to verify the results when analyzing and answering the
question in a research study.
· Both have to use time as a factor in the research study when
answering the question at hand.
2. A research team wants to study the effect of handbag
advertising on women’s choice of handbags. They are concerned
about the potential effects of the women having any clue before
the ads are shown about the content of the study (particularly
the treatment). They randomly assign 100 women (19-22 years
old) to four groups. They ask two groups of women to choose a
handbag from a group of four handbags before the treatment.
Two other groups will not be asked initially about their handbag
choices. Of the first two groups, one group will be shown a
television program containing 40-second handbag ads on one of
the handbags and the other group will be shown the program
without ads. Of the last two groups, one group will see the
program with the ads and the other group without the ads. Then,
each woman will be asked to choose a handbag from a set of
four possible handbags (including the one in the ads). Then, the
researchers will try to infer whether women shown the handbag
advertisements choose different handbags from the women not
shown the ads (i.e., whether advertising affects women’s choice
of handbags).
a. What is the substantive independent variable in this study?
· Handbag ads and the program are the functional Independent
variable. It is because they can affect a woman’s choice once
put in place among the groups. Comment by Yali Yang: +3
b. What additional (methodological) independent variable is
planned?
· Another independent variable that is proposed by the research
team is women’s clue about the content of thestudy. It can
21. affect the behavior of the women in a way suggesting to modify
the actual concentration on what to dwell on so that she can
make a choice on the handbag she needs. Comment by Yali
Yang: +3
c. What is the dependent variable in this study?
· Choice of handbag is a dependent variable. Because a woman
a group can only rely on the program and the ads so as to do the
selection of thebag she needs. Comment by Yali Yang: +3
d. What research design is this research team planning?
Diagram it.
· They are planning to use Randomized Experiment research
design. It is through the groups that they intend to have their
question in a research study. The women cluster in a given age
bracket within the four groups so as to provide precise feedback
in results intended.
e. What are the threats to internal validity of this research
design?
· They include; Events that occurs between the first and second
measurement in women’s selection choices can lead to a change
of the results of the research of the study. Secondly, the effects
of recording the women’s first choice with taking second results
of their choosing. It can lead to a lack of precision in the
variance of the data.
f. What is the third (methodological) null hypothesis in this
study? Comment by Yali Yang: +3
· The third null hypothesis is whether the women having a clue
about the content of research study will affect the choice of the
handbags selected by the women. Therefore, the research study
tries to prove that having a clue will eventually change their
research study in question, and that is the reason they intend to
make them clueless.
22. g. (extra credit) Briefly explain how this team would analyze
their data to answer their research question and deal with their
methodological concern, including the two different
possibilities that could occur in the test of the third null
hypothesis.
· The team will analyze the data in a uniform way as follows:
The groups having watched ads put in one category and the
group that did not watch placed in the second group.
To analyze group shown a program and group not shown the
program to put on their own.
Finally, Analyze the group shown both the program and ads on
their choice of their selection to be analyzed.
· In regards to the null hypothesis, the team should try by
giving a clue to one group that had not been in the research
before and analyzed their data after their research. Therefore,
results will be precise and valid avoiding errors to a high
degree.
3. A researcher wants to investigate whether college students’
knowledge of the negative consequences of the overuse of credit
will affect their attitudes about credit use. He plans to recruit
two professors to help him in his research. One professor of
family and consumer sciences is planning a unit of four lessons
of credit, such as wage garnishment, repossession, foreclosure,
and bankruptcy. The other professor in social studies is teaching
a unit about Australia. Each professor’ class has 30 students. At
the commencement of the research, the researcher will measure
each student’s attitudes toward credit with an attitude scale.
Then, each professor will teach her lessons. After that, the
researcher will administer an alternate form of the credit
attitude scale to each student. Then, he will try to infer whether
college students’ knowledge of the negative consequences of the
overuse of credit affects their attitudes toward credit use.
a. What type of research design is this researcher planning to
23. use? Diagram it.
· The researcher is planning to use Quasi-Experimental Design.
The research design does not involve random assignment and
thus involve selecting groups upon testing the variable at hand.
b. What do you believe is the one most important threat to the
internal validity of this study? (Use the specific languages of
the problem.)
· The most significant threat to the internal validity is the
selection of the subject. Both professorswere ought to prepare
on the same theme of the research study. They both had to
prepare for the four lessons on the credit so that the validity of
the variable tested to correspond to the question in aresearch
study. Comment by Yali Yang: +3
c. What could this researcher do to address this threat?
· The researcher was to provide them with guidelines on the
same selection usage of the four-lesson plan. It was to enable
the professor with their groups have common tested variable as
they dwelt on the same question in the research study but at
different locations.
d. Compare and contrast this design to a previous research
design (question #1: h). Which do you believe is the better
research design? Why?
· Randomized Blocked design uses random assigning of groups
while Quasi-Experiment does not use any randomized pre-
selection process. Comment by Yali Yang: +3
· Both research designs use same instrumentation for measuring
the attitude of students in their usage of credit. Thus, having a
standard technique in testing and analyzing when answering the
question in the research study.
· I think Randomized Blocked design is the better research as
compared to the Quasi-Experiment. Because Randomized study
performs a random assigning of the group and once selected,
24. they are analyzed on the same subject selection. There is no
‘favoritism; on which group to be taught some lessons and
others to be left out in the essence of theresearch study.
4. A researcher wants to investigate whether college students’
knowledge of the negative consequences of the overuse of credit
will affect their attitudes about credit use. The researcher will
select a random sample of 100 college students from a list of all
college students at CSUN. He will measure each student’s
knowledge of the negative consequences (delinquency, wage
garnishment, foreclosure, bankruptcy, etc) of the overuse of
credit with a 20-item self-report objective test. At the same
time, he will measure each student’s attitudes toward credit
with an attitude scale. Then, he will try to infer whether college
students’ knowledge of the negative consequences of the
overuse of credit affects their attitudes toward credit use. (He
wants to infercause-and-effect relationship.)
a. What type of research design is this researcher planning to
use (be precise)? Diagram it.
· The researcher plans on using Simple Random research design.
· It is the most straightforward design research whereby the
method obtains a sample from a population in which every
member of the population has an equal chance of selection.
Therefore, no grouping is done and no choice of students in
CSUN using any given criteria but onlyselecting.
b. Describe its advantage over other ex post facto designs.
· It is easy to find the difference in the results intended since
there is measurement before and after the research study. Also,
using the research design can make the researcher have
precision results in inferring the cause and effect relationship.
c. Is history a threat to the internal validity of this design? Why
25. or why not?
· History is not a threat to the internal validity. It is because the
selected sample experienced the same current event in the
design research study. Comment by Yali Yang: +3
d. Is maturation a threat to the internal validity of this design?
Why or why not?
· Maturation is not a threat to internal validity. Because the
sample group experienced the same developmental processes
while performing the research study. Comment by Yali
Yang: +3
e. Is testing a threat to the internal validity of this design? Why
or why not?
· Yes, testing is a threat. Because once theresearcher records’
the testingat first, itmanipulate the behavior of the students and
could alter to newer record in the post-test.
f. Is instrumentation a threat to the internal validity of this
design? Why or why not?
· Instrumentation is not a threat to the research study. It is
because same measurement method used did not alter the
variables tested thus precision in thesupply of records under
question in aresearch study. Comment by Yali Yang: +3
g. Is mortality a threat to the internal validity of this design?
Why or why not?
· Mortality is not a threat to the internal validity of the research
study. It is because no drop out of an individual from the
sample selected took place thus research study
conductedsuccessfully. Comment by Yali Yang: +3
h. What is the most important threat to the internal validity of
this study? What could this researcher do to address this threat?
Be specific in discussing this in relation to THIS particular
study.
26. · Testing is the most significant threat.
· The researcher could have tested after performing the research
and analysis so as to come up with the exact results on inferring
the cause and effect of overuse of the credit. Once the
researcher presents pre-testing, the behavior of the students will
change and thus post testing results can be affected.
i. Describe another important threat to the internal validity of
this design that is NOT a threat to any previous design we have
considered.
· Design Contamination is a threat to the internal validity of the
research.
· It is because the group was now aware of the research study
conducted and they are vulnerable to exposure. Thus, wanted it
to fail.
j. Compare and contrast this research design to the research
designs in question #1 (note: there are two designs in question
#1: c & h) and question #3 in terms of both internal and external
validity. Please be organized in this answer.
1. Comparison and Contrast in Simple random versus
Experimental research design in regards to internal and external
validity.
· Both research designs improve the external validity such as
the generalization of the research design.
· The experimental research design is more prone to threats in
regards to internal validity as compared to the Simple random
research design that has variable internal threats.
2. Comparison and Contrast in Simple random versus
Randomized Blocked research design in regards to internal and
external validity.
· They both have similarity in grouping samples thus threat in
regards to internal and external corresponds averagely the same.
27. · Randomized Blocked research design is prone precision and
fewerrisks in regards to internal and external validity while
simple random research might select asimilar sample of
thegroup having similar features thus lowering accuracy of the
results.
3. Comparison and Contrast in Simple random versus Quasi-
Experimental research design in regards to internal and external
validity.
· Thy both have similar technique in addressing the threat of
internal and external validity.
· Quasi-Experiment research design is more prone to selection
risk in the internal validity while Simple Random research
design is more prone to testing threat in regards to internal
validity.
k. Which of these four designs do you believe is the best
research design? Why?
· I believe Randomized Block design is the best research design
among the four.
· Because of the precision of results it provides and it does not
allow more threats to internal validity. Also, allows a researcher
to specialize and utilize time on one subgroup for a given a
research study.