CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
Running Head TOWN GUIDE ANDROID APPLICATION5TOWN GUIDE ANDROI.docxtoltonkendal
Running Head: TOWN GUIDE ANDROID APPLICATION
5
TOWN GUIDE ANDROID APPLICATION
Town Guide Android Application
Student Name
Course Title
Instructor’s Name
Institution Affiliation
Date
Project Design Document
Project Title
Town Guide Android Application
Problem Definition
People visiting new places often have trouble adopting to the new place. Whether on a business trip or holiday vocational trip, a new place is usually hard to adopt in terms of finding locations, restaurants, guest rooms, movie theatres and shopping centers. To find the required destination or services, one has to spend long time and resources asking people or walking from one corner of the town or city to another (Koutroumanis, 2011). The Town-Guide Android application is to help people who are new to a city or town find their way around the town. The application will provide features like navigation, geolocation and reviews for services and other requirements that will help the visitor. The application will also reduce the time of finding services like restaurants, shopping centers and movie theaters among other service centers. Additionally, the app will help select the best services through the reviews of people who has used the restaurant, hotel or tourism center before.
Issues
In modern days, towns and cities have been crowded and security is usually compromised. Moving from one place to another in search of a particular destination can be risky and wasteful of time and other resources. However, applications like Google Maps exist to help find directions; Town-Guide Application will integrate the geolocation feature with features of locating services in town and reviews from the customers and local residents. This will help visitors and tourists find the best services in terms of quality of the places, price range, distance from main centers and security of places. The application aims to have a comprehensive feature for the visitors to help them adopt quickly to the new city or town.
Objectives
Introduce a new android application for visitors at the end of next month to help lower their travelling costs by 50% and reduce the time for finding places and services to one minute. The project also aims to help visitors find category of services in a region by one click with details such as directions, ratings, costs and security.
Requirements
· System Requirements: System availability is 24 hours a day, 7 days a week and 365 days a year (99.9% uptime).
· Reporting Requirements: Weekly traffic report should be auto-generated and sent to the business owner of the application.
· Data requirements: interfacing the system with geolocation data, and other regional databases in terms infrastructure, security and services.
· Business requirements: after approval of the system’s database requirements, there should be five weeks of implementation of the project.
· Security requirements: need to secure the system through two level user authentication.Personnel Requirements: ...
Organizational Process AnalysisBackgroundYou are a senior member o.docxalfred4lewis58146
Organizational Process AnalysisBackground
You are a senior member of the IT Management Team for SAI Toys, one of the leading manufacturers of products for Gifted Electrical Engineering Kids (GEEKs). The toys that the company sells are manufactured in-house and shipped to brick-and-mortar retailers, such as Best Buy and Target, as well as e-Commerce-only sites, such as ThinkGeek.com and Buy.com. The company has no direct interaction with the final purchasers (individuals) of their products other than through warranty service.
The company has four distinct IT systems:
· Public Website—provides information about each of the products, locations where someone can purchase them, and information about how to get warranty support. Details of warranty support and defect rates are not tracked, but the staff has anecdotal stories.
· Manufacturing Support System (MSS)—maintains the supply chain information necessary for manufacturing the company's products, such as raw materials, vendors, and prices.
· Human Resources System (HRS)—maintains and tracks personnel and benefits information.
· Sales and Marketing System (SMS)—tracks the sales and marketing efforts of the company’s sales force. Orders from this system are printed and sent daily to the MSS to be filled.
The current IT staff consists of 25 individuals. Five are assigned to maintain and operate each of the current IT systems, (except the HRS—only four work on that system). There are four support staff members that manage the internal help desk and provide network and workstation support for the internal company staff. The department is headed by the vice president of IT and her Deputy Department Manager (you!).
Physically, the company has two buildings. The manufacturing building and warehouse are located on the east side of the city near the docks and the expressway. The executive and business offices, as well as the IT staff, are located in a separate building on the west side of the city. Situation
The board of directors and the CEO have decided that they want to stay on the forefront of geekness, and therefore, the company should integrate all of their IT systems. In addition, they want to develop a more robust web presence and sell their products directly to individual customers in addition to selling through traditional retailers as they currently are doing.Assignment
You are to write a report of about 9 single spaced pages that outlines the situation, weighs various alternatives, and presents a final recommendation as to how the company should go about implementing this executive directive. (If you recommend it should not be done, you should have strong reasons!)
Your report should include the following sections. Please begin each with a heading so that the paper will be organized according to the board’s request and will be easier to follow. 1) Cover Page and Table of Contents (TOC) (5 points)
Provide a cover page with student names, date, course #, session, and professor name. The TO.
Presented at Impact: 2018 Canadian Service Design Conference, November 29 & 30, 2018 (Montreal, Quebec)
Working in small groups, participants will get a chance to try out a variety of Service Design methods in a safe, supportive, and reflective environment. At the end we’ll all come together to share our thoughts on the various methods and how we may utilize them in our practice.
METHOD 1: Ecosystem Mapping
Ecosystem mapping identifies the different roles actors take and how they connect within different contexts and environments. We can push this further by asking “what leverage points exist within this ecosystem where a small push can influence greater change and in what direction?”
METHOD 2: Tomorrow’s Headline
The tomorrow’s headlines are fictional news articles created by imagining a desirable (or undesirable) future from the perspective of users within the service context. It helps us look beyond the short-term constraints and focus on the potential cross-domain impacts generated by the service.
Case Study Analysis 2The Cholesterol.xls records cholesterol lev.docxwendolynhalbert
Case Study Analysis 2
The Cholesterol.xls records cholesterol level data for individuals. Descriptions for the data follow:
· Cholesterol: Cholesterol level (mg/dL)
· Income: annual income in $
· Age: age of individual
· Jogging: number of hours an individual spends on jogging a day
· Saturated fat: the amount of saturated fat an individual takes a day (g)
(A) Develop an estimated regression equation that can be used to predict Cholesterol level using age, jogging income, and saturated fat. Discuss your findings including interpretation of slope of each variable and significance, using at least 200 words. Use .
(B) Starting with the estimated regression equation developed in part (A), delete any independent variables that are not statistically significant and develop a new estimated regression equation that can be used to predict Cholesterol level. Use . Discuss your findings including interpretation of slope of each variable and significance, using at least 200 words. Use .
(C) Compare model (A) and (B) in terms of R^2 and which model fits the data better? Discuss this using at least 100 words
(D) In model B, what are the most important factors affecting Cholesterol level? What are the least important factors? Discuss this using at least 100 words
Assignment1DueTHURSDAY.zip
Assignment1/Assignment1-17.pdf
ICT209 Assignment 1, Murdoch University 2016
ICT209 Assignment 1, Murdoch University 2016 1
ICT209 Assignment 1 2016
Objectives:
• Demonstrate that you can do Object Oriented design
• Demonstrate that you can write Object Oriented programs using C++.
• Demonstrate that you can design and write programs using user defined data structures.
• Demonstrate that you can work with data files.
• Demonstrate that you can write test plans and show evidence of systematic testing.
• Demonstrate that you can design using UML.
You do not work in groups for this assignment, as this is an individual assignment.
Worth:
14% of the unit
Due:
Midnight (end of Session 7). This would be the 7th teaching week.
How to submit (also see unit guide - section on Assignment/Project submission/return):
Singapore or Dubai Campus:
Into the assignment submission area for the unit in LMS. Follow all directions from your lecturer.
Murdoch Campus Internal students:
Into the assignment submission area for the unit in LMS.
Externals:
Into the assignment submission area for the unit in LMS.
For submitting in LMS, zip up the entire folder. Make sure that you have included all needed files. Do not
include temporary files or files not relevant to the assignment.
Name the zip file with the unit code, Assignment number, your name, student number.
ICT209Asg1JoBlogs12345678.zip
or alternatively,
ICT209_Asg1_JoBlogs_12345678.zip
Textual submissions should be type-written. External documentation can only be in the following formats:
Text (.txt)
PDF (.pdf)
RTF (.rtf)
HTML (.html)
Image formats : PNG ...
Running head CASE STUDY QUESTIONS 1CASE STUDY QUESTIONS7.docxhealdkathaleen
Running head: CASE STUDY QUESTIONS 1
CASE STUDY QUESTIONS7
Case study questions
Name
Institution
Introduction
The CARE International is known to be a humanitarian organization which offers relief help to regions that are experiencing natural disasters like hurricanes and earthquakes. This paper will focus on answering the case study questions on diverse issues.
1. What were the main challenges encountered by CARE International before they created their warehouse prepositioning model
The challenges faced by CARE international are such as transportation issues, absence of agility, limited aptitude to gather supplies both locally and internationally (Gay, 2015). There is a challenge of the previous means of transportation utilized by vendors which is slow and also very unreliable as well as the cost of relief resources is very high.
2. How does the objective function relate to the organization's need to improve relief services to affected areas?
The objective function need to minimize the time used to respond to natural occurrences as well as transport reliefs to the affected area. The objective function is connected to the need of agency providing shipping relief services to the affected region at minimal response time.
3. Conduct online research and suggest at least three other applications or types of software that could handle the magnitude of variable and constraints CARE International used in their MIP model.
There are three software that can be incorporated to handle constraints Care International utilizes for Mixed-integer programming ideal which are “Mathematical Programming Language (AMPL), Gurobi, and Statistical Analysis System (SAS) (De & Mok, 2016).” These are tools that assist the organization in solving the linear and the quadratic optimization.
4. Elaborate on some benefits CARE International stands to gain from implementing their pre-positioning model on a large scale in future
Warehouse pre-positioning model has some advantages that it offers to CARE International such as they facilitate the delivery relief to the affected region, mostly in the time of the disaster occurrence. This model assist in providing relief in the affected region in relatively short period of time which means that the agency will be in a position to save more lives.
Warehouse pre-positioning model
Figure 1: Warehouse pre-positioning model
Application case
1. Describe the problem that a large company such as HP might face in offering many product lines and options.
One problem they might face is the issue of high cost for introducing new products, designing and manufacturing as well as the issue of supply chain complexity. The institution might face issues such as the unexpected increase in operational expenses, reduction in the forecasting accuracy and increase in the inventory costs.
2. Why is there a possible conflict between marketing and operations?
Yes. Marketing and operation department are the pillars of any organization. How ...
Running Head TOWN GUIDE ANDROID APPLICATION5TOWN GUIDE ANDROI.docxtoltonkendal
Running Head: TOWN GUIDE ANDROID APPLICATION
5
TOWN GUIDE ANDROID APPLICATION
Town Guide Android Application
Student Name
Course Title
Instructor’s Name
Institution Affiliation
Date
Project Design Document
Project Title
Town Guide Android Application
Problem Definition
People visiting new places often have trouble adopting to the new place. Whether on a business trip or holiday vocational trip, a new place is usually hard to adopt in terms of finding locations, restaurants, guest rooms, movie theatres and shopping centers. To find the required destination or services, one has to spend long time and resources asking people or walking from one corner of the town or city to another (Koutroumanis, 2011). The Town-Guide Android application is to help people who are new to a city or town find their way around the town. The application will provide features like navigation, geolocation and reviews for services and other requirements that will help the visitor. The application will also reduce the time of finding services like restaurants, shopping centers and movie theaters among other service centers. Additionally, the app will help select the best services through the reviews of people who has used the restaurant, hotel or tourism center before.
Issues
In modern days, towns and cities have been crowded and security is usually compromised. Moving from one place to another in search of a particular destination can be risky and wasteful of time and other resources. However, applications like Google Maps exist to help find directions; Town-Guide Application will integrate the geolocation feature with features of locating services in town and reviews from the customers and local residents. This will help visitors and tourists find the best services in terms of quality of the places, price range, distance from main centers and security of places. The application aims to have a comprehensive feature for the visitors to help them adopt quickly to the new city or town.
Objectives
Introduce a new android application for visitors at the end of next month to help lower their travelling costs by 50% and reduce the time for finding places and services to one minute. The project also aims to help visitors find category of services in a region by one click with details such as directions, ratings, costs and security.
Requirements
· System Requirements: System availability is 24 hours a day, 7 days a week and 365 days a year (99.9% uptime).
· Reporting Requirements: Weekly traffic report should be auto-generated and sent to the business owner of the application.
· Data requirements: interfacing the system with geolocation data, and other regional databases in terms infrastructure, security and services.
· Business requirements: after approval of the system’s database requirements, there should be five weeks of implementation of the project.
· Security requirements: need to secure the system through two level user authentication.Personnel Requirements: ...
Organizational Process AnalysisBackgroundYou are a senior member o.docxalfred4lewis58146
Organizational Process AnalysisBackground
You are a senior member of the IT Management Team for SAI Toys, one of the leading manufacturers of products for Gifted Electrical Engineering Kids (GEEKs). The toys that the company sells are manufactured in-house and shipped to brick-and-mortar retailers, such as Best Buy and Target, as well as e-Commerce-only sites, such as ThinkGeek.com and Buy.com. The company has no direct interaction with the final purchasers (individuals) of their products other than through warranty service.
The company has four distinct IT systems:
· Public Website—provides information about each of the products, locations where someone can purchase them, and information about how to get warranty support. Details of warranty support and defect rates are not tracked, but the staff has anecdotal stories.
· Manufacturing Support System (MSS)—maintains the supply chain information necessary for manufacturing the company's products, such as raw materials, vendors, and prices.
· Human Resources System (HRS)—maintains and tracks personnel and benefits information.
· Sales and Marketing System (SMS)—tracks the sales and marketing efforts of the company’s sales force. Orders from this system are printed and sent daily to the MSS to be filled.
The current IT staff consists of 25 individuals. Five are assigned to maintain and operate each of the current IT systems, (except the HRS—only four work on that system). There are four support staff members that manage the internal help desk and provide network and workstation support for the internal company staff. The department is headed by the vice president of IT and her Deputy Department Manager (you!).
Physically, the company has two buildings. The manufacturing building and warehouse are located on the east side of the city near the docks and the expressway. The executive and business offices, as well as the IT staff, are located in a separate building on the west side of the city. Situation
The board of directors and the CEO have decided that they want to stay on the forefront of geekness, and therefore, the company should integrate all of their IT systems. In addition, they want to develop a more robust web presence and sell their products directly to individual customers in addition to selling through traditional retailers as they currently are doing.Assignment
You are to write a report of about 9 single spaced pages that outlines the situation, weighs various alternatives, and presents a final recommendation as to how the company should go about implementing this executive directive. (If you recommend it should not be done, you should have strong reasons!)
Your report should include the following sections. Please begin each with a heading so that the paper will be organized according to the board’s request and will be easier to follow. 1) Cover Page and Table of Contents (TOC) (5 points)
Provide a cover page with student names, date, course #, session, and professor name. The TO.
Presented at Impact: 2018 Canadian Service Design Conference, November 29 & 30, 2018 (Montreal, Quebec)
Working in small groups, participants will get a chance to try out a variety of Service Design methods in a safe, supportive, and reflective environment. At the end we’ll all come together to share our thoughts on the various methods and how we may utilize them in our practice.
METHOD 1: Ecosystem Mapping
Ecosystem mapping identifies the different roles actors take and how they connect within different contexts and environments. We can push this further by asking “what leverage points exist within this ecosystem where a small push can influence greater change and in what direction?”
METHOD 2: Tomorrow’s Headline
The tomorrow’s headlines are fictional news articles created by imagining a desirable (or undesirable) future from the perspective of users within the service context. It helps us look beyond the short-term constraints and focus on the potential cross-domain impacts generated by the service.
Case Study Analysis 2The Cholesterol.xls records cholesterol lev.docxwendolynhalbert
Case Study Analysis 2
The Cholesterol.xls records cholesterol level data for individuals. Descriptions for the data follow:
· Cholesterol: Cholesterol level (mg/dL)
· Income: annual income in $
· Age: age of individual
· Jogging: number of hours an individual spends on jogging a day
· Saturated fat: the amount of saturated fat an individual takes a day (g)
(A) Develop an estimated regression equation that can be used to predict Cholesterol level using age, jogging income, and saturated fat. Discuss your findings including interpretation of slope of each variable and significance, using at least 200 words. Use .
(B) Starting with the estimated regression equation developed in part (A), delete any independent variables that are not statistically significant and develop a new estimated regression equation that can be used to predict Cholesterol level. Use . Discuss your findings including interpretation of slope of each variable and significance, using at least 200 words. Use .
(C) Compare model (A) and (B) in terms of R^2 and which model fits the data better? Discuss this using at least 100 words
(D) In model B, what are the most important factors affecting Cholesterol level? What are the least important factors? Discuss this using at least 100 words
Assignment1DueTHURSDAY.zip
Assignment1/Assignment1-17.pdf
ICT209 Assignment 1, Murdoch University 2016
ICT209 Assignment 1, Murdoch University 2016 1
ICT209 Assignment 1 2016
Objectives:
• Demonstrate that you can do Object Oriented design
• Demonstrate that you can write Object Oriented programs using C++.
• Demonstrate that you can design and write programs using user defined data structures.
• Demonstrate that you can work with data files.
• Demonstrate that you can write test plans and show evidence of systematic testing.
• Demonstrate that you can design using UML.
You do not work in groups for this assignment, as this is an individual assignment.
Worth:
14% of the unit
Due:
Midnight (end of Session 7). This would be the 7th teaching week.
How to submit (also see unit guide - section on Assignment/Project submission/return):
Singapore or Dubai Campus:
Into the assignment submission area for the unit in LMS. Follow all directions from your lecturer.
Murdoch Campus Internal students:
Into the assignment submission area for the unit in LMS.
Externals:
Into the assignment submission area for the unit in LMS.
For submitting in LMS, zip up the entire folder. Make sure that you have included all needed files. Do not
include temporary files or files not relevant to the assignment.
Name the zip file with the unit code, Assignment number, your name, student number.
ICT209Asg1JoBlogs12345678.zip
or alternatively,
ICT209_Asg1_JoBlogs_12345678.zip
Textual submissions should be type-written. External documentation can only be in the following formats:
Text (.txt)
PDF (.pdf)
RTF (.rtf)
HTML (.html)
Image formats : PNG ...
Running head CASE STUDY QUESTIONS 1CASE STUDY QUESTIONS7.docxhealdkathaleen
Running head: CASE STUDY QUESTIONS 1
CASE STUDY QUESTIONS7
Case study questions
Name
Institution
Introduction
The CARE International is known to be a humanitarian organization which offers relief help to regions that are experiencing natural disasters like hurricanes and earthquakes. This paper will focus on answering the case study questions on diverse issues.
1. What were the main challenges encountered by CARE International before they created their warehouse prepositioning model
The challenges faced by CARE international are such as transportation issues, absence of agility, limited aptitude to gather supplies both locally and internationally (Gay, 2015). There is a challenge of the previous means of transportation utilized by vendors which is slow and also very unreliable as well as the cost of relief resources is very high.
2. How does the objective function relate to the organization's need to improve relief services to affected areas?
The objective function need to minimize the time used to respond to natural occurrences as well as transport reliefs to the affected area. The objective function is connected to the need of agency providing shipping relief services to the affected region at minimal response time.
3. Conduct online research and suggest at least three other applications or types of software that could handle the magnitude of variable and constraints CARE International used in their MIP model.
There are three software that can be incorporated to handle constraints Care International utilizes for Mixed-integer programming ideal which are “Mathematical Programming Language (AMPL), Gurobi, and Statistical Analysis System (SAS) (De & Mok, 2016).” These are tools that assist the organization in solving the linear and the quadratic optimization.
4. Elaborate on some benefits CARE International stands to gain from implementing their pre-positioning model on a large scale in future
Warehouse pre-positioning model has some advantages that it offers to CARE International such as they facilitate the delivery relief to the affected region, mostly in the time of the disaster occurrence. This model assist in providing relief in the affected region in relatively short period of time which means that the agency will be in a position to save more lives.
Warehouse pre-positioning model
Figure 1: Warehouse pre-positioning model
Application case
1. Describe the problem that a large company such as HP might face in offering many product lines and options.
One problem they might face is the issue of high cost for introducing new products, designing and manufacturing as well as the issue of supply chain complexity. The institution might face issues such as the unexpected increase in operational expenses, reduction in the forecasting accuracy and increase in the inventory costs.
2. Why is there a possible conflict between marketing and operations?
Yes. Marketing and operation department are the pillars of any organization. How ...
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Cryptography Keys
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Cryptography Keys
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
Instructions for Submissions thorugh G- Classroom.pptxJheel Barad
This presentation provides a briefing on how to upload submissions and documents in Google Classroom. It was prepared as part of an orientation for new Sainik School in-service teacher trainees. As a training officer, my goal is to ensure that you are comfortable and proficient with this essential tool for managing assignments and fostering student engagement.
Instructions for Submissions thorugh G- Classroom.pptx
CSCE 1040 Homework 2 For this assignment we are going to .docx
1. CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule
drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for
each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation,
coverage area, etc)
You may add other data needed for your implementation as well
as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
2. Has pets (Boolean)
You may add other data needed for your implementation as well
as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well
as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified
above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
3. Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all
completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to
verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the
passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the
Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this
assignment
you do not need to worry about verifying availability based on
starting and
ending locations.
You will also need to provide in the Rides collection the ability
to
print an assignment schedule for a particular Driver or for a
particular
Passenger of all the active assignments. Also to print a list of
Rides based
on their status. You should also provide a means to delete all
cancelled
rides or all completed flights from the menu. You should also
4. provide a means
to periodically update all rides from active to completed based
on time and date.
You will need to provide an appropriate menu system that can
be multi-level
if you like.
You will need to load and store the data to a permanent disk
file. This can be done
automatically when the program starts and ends. You should
also want to store after
an add, delete or edit to make sure changes to the data are
preserved.
For this design you will need to turn in the
following:
A diagram set consisting of:
1. A title page with your name, assignment, course
and title
2. a single class diagram showing only the relationships
between the entities
3. a set of six individual class diagrams showing the
attributes and methods
for each of the classes in #2
4. Step by Step pseudo code algorithms for every
method defined in every class in
the diagram from #2. You do not need to provide
pseudo code for simple accessor
and mutator functions (i.e. sets and gets)
5. A 1-2 paragraph report about your design
experience.
5. All of theseitems should be gathered together, in
order, in a single PDF
File that you will turn in on Canvas for the design,
and a separate PDF for the report.
That is a total of 2 documents.
NOTE: This assignment is for the design only
Nothing you turn in should look like C/C++ code
-538-
Inzinerine Ekonomika-Engineering Economics, 2014, 25(5),
538–548
Finding a New Way to Increase Project Management Efficiency
in Terms of Time
Reduction
Seweryn Spalek
Silesian University of Technology
Gliwice, Poland
E-mail. [email protected]
http://dx.doi.org/10.5755/j01.ee.25.5.8419
There are three basic constraints called ‘the golden triangle’ in
each project: time, budget and scope. Researchers and
practitioners are trying to find a way to increase the efficacy of
6. the project’s outcomes in terms of shortening the project’s
duration, lowering budgetary costs and meeting the scope.
Although several publications have been written on that topic,
there is still no common solution in place. However, more in-
depth research related to the specific type of projects or
industries is being conducted and this paper seeks to incorporate
additional knowledge into that contemporary field.
Furthermore, this is of growing importance in modern, turbulent
times, where the expectations of profiting from lessons
learned are ever increasing.
Following the current market demands, in the article a new,
innovative approach is proposed to manage the expectation
that future projects will have a shorter duration. Therefore, the
idea of creating specific roadmaps is proposed, which
should help the decision makers improve the efficacy of project
management in the company, where the process of such
improvement is measured using the maturity levels assessment
concept.
Based on the world-wide quantitative studies in the
construction, information technology and machinery industries,
specific roadmaps for each industry were determined. The
purpose of these roadmaps is to indicate the most effective
investment sequence in the increase of project management
maturity, which should result in a decrease of future projects’
duration. Moreover, discussions on the limitations of such
7. investments are examined.
Keywords: Investment, Time pressure, Company, Projects,
Improvement, PM, Implementation of Strategies, Knowledge,
Innovation.
Introduction
Three of the world’s most recognized Latin words,
“Citius, Altius, Fortius,” meaning “Faster, Higher,
Stronger”, have been the Olympic motto since 1894. At the
time: Pierre de Coubertin proposed the motto, having
borrowed it from his friend Henri Didon, a Dominican
priest who taught sport close to Paris (IOC, 2007, p. 5).
These three words encourage the athlete to give his or
her best during competition. To better understand the
motto, we can compare it with the Olympic creed: “The
most important thing in life is not the triumph, but the
fight; the essential thing is not to have won, but to have
fought well.” Together, the Olympic motto and the creed
represent an ideal that Coubertin believed in and promoted
as an important life lesson that could be gained from
8. participation in sport and the Olympic Games: that giving
one’s best and striving for personal excellence was a
worthwhile goal. It is a lesson that can still be applied
equally today, not just to athletes but to each one of us
(IOC, 2007, p. 5).
Modern project management has its roots (Lenfle and
Loch, 2010, p. 33) in the atomic bomb Manhattan project
(Morris, 1994, p. 18) and the ballistic missile projects,
Atlas and Polaris (Kerzner, 2013). The term “modern
project management” is used by some authors and relates
mostly to the project management approach started in the
1950s and continuing through today (Chen et al., 2011;
Hill, 2004; Lenfle & Loch, 2010; Shenhar, 2001).
Remarkably, from the very beginning of contemporary
project management, projects were, and continue to be,
under similar time pressure (Campos Silva et al., 2012;
Chen et al., 2012; Griffin, 1993, 1997; Herroelen & Leus,
2005; Omorede et al., 2013; Radziszewska-Zielina, 2010;
Zavadskas et al., 2010). Kach and colleagues (2012, p.
9. 377) state: The speed of technological change and
shortened product life cycles have made the time-to-market
requirements for developing new products increasingly
stringent (Kessler and Chakrabarti, Langerak et al., 2010;
Heightened competitive forces have motivated many firms
to move their new products through the design and
manufacturing pipeline at a faster rate, encouraging greater
focus on accelerated development and compressed time
lines (Prasnikar & Skerlj, 2006; Wright et al., 1995).
The above statement for NPD (new product
development) projects can be applied to most projects,
whatever their nature. In our current, turbulent times, the
pressure of time seems to increase to an ever greater
extent. Project managers and their teams experience
similar pressure to athletes: to beat the record and to go
faster and faster. The first word, “Citius”, of the Olympic
hendiatris1 seems to dominate projects managed by
1 Hendiatris is a figure of speech in which three words are used
to
10. emphasize one idea, for example, Wine, women, and song.
Hendiatris is
often used to create mottos for organizations; for example, The
motto at
West Point is “Duty, Honor, Country.” see K. Wilson and J.
Wauson, the
AMA handbook of business writing: the ultimate guide to style,
grammar,
Inzinerine Ekonomika-Engineering Economics, 2014, 25(5),
538–548
- 539 -
companies today. The majority of project stakeholders
(executives, sponsors, clients, managers) expect new
projects to be completed faster than ever.
Moreover, companies are always careful about
spending money. Therefore, they also want to know
where to invest their typically limited funds. This issue
also arises when deciding where to invest to shorten the
time of future projects.
11. This paper gives new insight into the dilemma of
where and when to invest limited company funds to
achieve the best approach to time reduction of future
projects.
(R)evolution in Managing Projects
Project management has evolved throughout history.
This evolution has occurred mostly due to the tools and
techniques applied to single projects and the gradual
improvement of human resource management (Avots,
1969). This situation lasted until the 1990s, when the
number of projects executed by companies increased.
Moreover, companies’ operating environments became
turbulent (Keil & Mahring, 2010). Furthermore, the
influence of project outcomes on the success of an entire
company increased (Baron & Hannan, 2002). As a result,
companies placed a greater emphasis on project
management. To speed up time-to-market, companies
experienced increased pressure to reduce the duration of
projects. The existing methods for reducing the time of
12. ongoing single projects (e.g., application of modern
scheduling techniques supported by computer technology)
(Brucker et al., 1999; Iacovou & Dexter, 2004) are
significant; however, they are no longer sufficient. A new,
more efficient and revolutionary approach to managing
companies’ portfolios of projects was needed (Cooper et
al., 1999). This need generated new approaches for how to
better manage projects to face the new challenges
appearing in multi-project (Hofman, 2014), dynamic
environments (Spalek, 2013). Accordingly, new concepts
in project management were introduced, focusing on
project environment and knowledge management (del
Cano and de la Cruz, 2002; Ethiraj et al., 2005;
Neverauskas and Stankevicius, 2008; Pemsel & Wiewiora,
2013). Among these concepts is the idea of assessing the
maturity level of project management in the company
(Cooke-Davies, 2007; Fraser et al., 2003; Spalek, 2014;
Tan et al., 2011).
Assessing Maturity: the Purpose
13. To gain competitive advantage in executing projects,
companies wanted to know how well they manage projects
while taking into consideration different aspects
influencing the effective execution of projects (Kerzner,
2013; Rudzianskaite-Kvaraciejiene et al., 2010). The
assessment outcomes should note the areas for potential
improvement (Ahmad et al., 2013).
This expectation can be fulfilled by project
management maturity assessment. There are several
existing models of maturity assessment; however, their
main purpose remains the same: to identify weak and
usage, punctuation, construction, and formatting (New York:
American
Management Association, 2010, p. 216).
strong areas in an organization (Belt et al., 2009). By
knowing its strengths and weaknesses, a company can
undertake actions to improve activities related to the
management of projects, resulting in an increased maturity
level and improved project outcomes.
14. The majority of existing models assess project
management maturity level on a scale from 1 to 5, where 1
represents the lowest and 5 the highest level (Khoshgoftar
& Osman, 2009). The assessment is performed in different
areas related to project management. Therefore, the
assessment results in a matrix with maturity scores and
testing areas (Spalek, 2011).
Increasing Maturity: the Investment in the Future
It is critical to understand that an increase of maturity
level will mostly benefit future projects. Increasing by one
maturity level up also has some impact, however limited,
on existing projects. Because the planning phase in each
project is crucial (Wyrozebski & Spalek, 2014), the biggest
possible improvements are associated with future projects.
There is even a well–known quotation saying2:
“Show me how your project starts and I can tell you
how it will end.”
If the level of maturity is increased, e.g., from level 1
to 2, the outcomes of that action will be beneficial in new
15. projects. For existing projects, it will usually be too late to
have an impact.
Therefore, the decision to assess and then increase the
project management maturity level in a company is an
investment in future projects.
Investment “in maturity” is time consuming and
money intensive; therefore, to achieve the highest possible
time reduction of future projects, it is crucial to decide
where and when (in which sequence) a company
investment should be placed. Moreover, a company’s
investment funds are often very limited, making the issue
even more important. Therefore, it is essential for
companies today to have a road map guiding decision
makers on the following topic:
“In which areas and in what sequence should limited
funds be most effectively invested in my company?”.
The Research Method
The prediction of the future is a complex issue (Glenn
16. & Gordon, 2003), often involving various methods and
techniques, and thus has a wide record in
publications.(Booth, 2006; Galbraith & Merrill, 1996;
Lacher et al., 1995; Landeta, 2006; Onkal et al., 2013).
To predict reduction of the future time of projects,
questionnaire-based cross-impact analysis was used
following the ideas presented by Fabiana Scapolo and Ian
Miles (2006, p. 680–681). The method included the
following steps:
the object of studies;
2 Author unknown, also exists as: “Show me how your project
starts and I
can tell you how it will finish” or “Show me how your project
starts and I
show you how it will end”.
17. Seweryn Spalek. Finding a New Way to Increase Project
Management Efficiency in Terms of Time Reduction
- 540 -
Three Industries: Construction, Information
Technology and Machinery
The research presented in this article was part of a
larger effort supported by the National Science Centre,
focusing on world-wide studies of maturity in project
management in the chosen industries. The overall research
was designed in two major steps.
The first step was to conduct quantitative empirical
studies on project management maturity levels in three types
of industries: machinery, construction and information
technology. Data from 447 global companies, mostly
medium- and large-sized ones, was collected. Ninety-eight
per cent of them earned over € 2,000,000 per year, and 99,5
% of them employed over 49 people.
The second step, which is discussed in this study, was
designed to investigate the relationship between the
18. increase in maturity level in project management and the
predicted duration of forthcoming projects.
The Assessment
For the purpose of this study, a model was used that
assesses the company’s project management maturity in
four areas (Spalek, 2011):
2000);
3; Killen &
Kjaer, 2012);
2011).
The description of the maturity assessment areas is
shown in table 1.
Table 1
Project Management Maturity Assessment Areas
ID Area Description
1. Human Resources staffing, career paths, motivation, training,
team work
19. 2. Methods (incl. Tools &
Techniques)
methods, tools, techniques and means used for project planning
and execution; risk, requir ements, scope, costs, time
and quality management
3. Environment organizational structures, top management
support, stakeholders’ management, company culture
4. Knowledge Management lessons learned approach, gathering
data and experience for on-going operations and future
references
In the applied project management maturity model the
results of the assessment are reported from level 1 to 5:
-improvement.
The experts were asked to express their opinion on an
increase of maturity level by one increment (from 1 to 2,
from 2 to 3, etc.) and how it influences the time reduction
20. of future projects in their companies. The possible impact
was measured on a scale from 1 to 5, as shown in table 2.
The assessment was made separately in each testing area.
Table 2
The Impact on Time Reduction on Future Projects
Impact Level Description
1 No influence
2 1–10 %
3 11–20 %
4 21–30 %
5 over 30 %
In our study, the experts were practitioners from the
investigated companies. The invitation to participate in this
study was sent to 308 chosen experts as a follow-up to the
major global study on project management maturity. The
experts were chosen based on the demographic information
obtained in the first step of the overall research. They were
experienced managers that had at least five years of
experience and possessed a deep knowledge of the projects
21. executed in their companies. Moreover, the invitations
were sent to experts from companies that reported a
maturity level of at least 2 in each of the testing areas.
The response rate was 63 %. Such a high rate was
obtained as there were individually approached named
persons who expressed, in the first step of overall research,
their willingness to participate in the second step of the
studies. Non-response bias was tested by comparing the
demographic data of participating and non-participating
experts. No significant difference was found, proving that
survey respondents represent the overall sample accurately.
Results and Discussion
Data from 39 information technology, 48 construction
and 107 machinery industry global companies was
collected. The reliability of data was checked using
Cronbach’s alpha, resulting in a value of over 0,9 in each
testing area.
Data analysis using mean, median and mode values
was performed. The equality of variances was tested using
22. Levene's test and the equality of means using a t-test, and
satisfactory results were obtained as the significance for
Levene’s test was greater than 0,05. Additionally,
Spearman's rho correlation coefficients and factor analysis
using rotated component matrix were calculated for further
rigid data analyses. The data analysis was performed using
Statistical Package for the Social Sciences (IBM SPSS
build V21.0.0).
The results revealed differences in the predicted
impact of change in maturity level on the duration of future
projects. This level of impact depended on the specific
change in the designated area of assessment (e.g., a change
from level 1 to 2 in the knowledge management area) and
varied between industries.
The Impact on Future Projects: by Maturity Area
and Type of Industry
The data analysis revealed that the dispersion of the
acquired data is low; consequently, the mean value was
23. chosen to explain the results. Using the mean value allows
Inzinerine Ekonomika-Engineering Economics, 2014, 25(5),
538–548
- 541 -
the results to be presented more clearly, without going into
deep statistical details and allows the development of a
full, more comprehensive picture. The mean values of
impact on the future projects are shown in table 3.
The Impact on Future Projects by Industry (CONS, IND, IT)
and Change of Maturity Level in the Areas of Methods (M),
Human Resources (HR), Project Environment (E) and
Knowledge Management (KM).
Table 3
Statistics (Mean Value of Impact on Future Projects)
M
1–2
M
2–3
25. E
4–5
KM
1–2
KM
2–3
KM
3–4
KM
4–5
CONS 3,96 3,96 3,21 2,46 3,96 3,96 3,21 2,46 3,21 3,21 2,46
1,71 3,21 3,21 2,46 1,71
IND 3,88 3,88 3,16 2,44 3,88 3,88 3,16 2,44 3,16 3,16 2,44 1,72
3,16 3,16 2,44 1,72
IT 3,90 3,90 3,15 2,41 3,90 3,90 3,15 2,41 3,87 3,87 3,13 2,38
3,87 3,87 3,13 2,38
The impact on future projects depends on the type of
industry. The highest impact levels (3,96) were observed
for the change from level 1 to 2 and from 2 to 3 in the
methods (M) and human resources (HR) areas in the
26. construction industry (CONS). The lowest impact (1.71)
also appeared in the construction industry; however, it was
observed in the areas of environment (E) and knowledge
management (KM) for the change of maturity from level 4
to 5. Note, in each type of the studied industries, the
potential impact on future projects is the highest if the
company is at the initial (1) or standardized (2) level of
maturity in project management and wants to increase it by
going one level up. This observation is true for each
assessment area: methods, human resources, environment
and knowledge management.
When a company reports already having appliance (3)
or system management (4), maturity levels and wants to
increase it by one level, the impact on future projects’
duration subsequently decreases. However, this reduction
is greater in the construction and machinery industries than
in information technology companies. Therefore, which
project management maturity area the company should first
invest funds in to reduce the future project’s duration
27. depends on the type of industry. Moreover, the investment
sequence depends on the current level of maturity in the
company in each testing area, meaning that for a chosen
industry, one should consider a different roadmap, showing
where and in which sequence the investment in project
management maturity should be placed.
Different Industries, Different Approach?
This study on the influence of the increase of project
management maturity on future projects’ time reduction
was focused on three types of industries:
that has projects that are, to some extent, inherited in its
long history. The projects associated with these sectors are
described and considered by numerous authors (Davies et
al., 2009; Dominguez et al., 2009).
of
which are admittedly spread throughout the globe. The IT
projects are described and discussed for many different
types, such as agile (Thomke and Reinertsen, 1998) or
Internet projects (Mahadevan, 2000).
28. s in the
background of the above two industries as well as many
others, is present in many countries and is a backbone
industry for the other sectors. Therefore, its importance for
the global economy is very high. However, a limited amount
of research in this particular sector can be found in the
literature. The examples are mostly qualitative case studies
describing new product development (NPD) practices
(Ahmad et al., 2013; Huang et al., 2004; Matsui et al.,
2008), which are crucial for machinery industry companies.
The Investment Road Map: The Idea
Based on the factor analysis (as shown in Table 4), a
road map is proposed showing the investment path in
maturity areas, which should result in the biggest pay-offs
in reduction of time in future projects. Analysing the
groups of factors in the table, the proposed roadmaps for
the companies was built. This road map operates in the
areas of methods and techniques (M), human resources
(HR), project environment (E) and project knowledge
29. management (KM), as well as the associated change in
level of maturity (e.g., from 2 to 3), which is noted, for
example, as follows: M 2–3 (the change in maturity from
level 2 to 3 in the area of methods and techniques).
In general, note that at the beginning of the road map,
the investment has the biggest impact on the duration of
future projects and subsequently decreases along the way.
Table 4
Factor Analysis
Rotated Component Matrixa,b
Component
1 2 3
M2-3 ,964 ,245 -,088
HR1-2 ,964 ,245 -,088
HR2-3 ,964 ,245 -,088
M1-2 ,964 ,245 -,088
HR3-4 ,953 ,265 ,146
33. KM1-2 ,934 ,190 ,297
HR3-4 ,817 ,227 ,519
M3-4 ,817 ,227 ,519
E3-4 ,783 ,284 ,543
KM3-4 ,783 ,284 ,543
HR4-5 ,288 ,327 ,891
M4-5 ,288 ,327 ,891
E4-5 ,254 ,387 ,872
KM4-5 ,254 ,387 ,872
Extraction Method: Principal Component Analysis.
Rotation Method: Varimax with Kaiser Normalization.
a. BRANCH=IT; b. Rotation converged in 9 iterations.
The Investment Road Map: Construction Industry
The construction sector is one of the largest industries
traditionally associated with using project management.
The proposed road map revealed that the biggest pay-off is
associated with an increase of maturity level from 1 to 2
and from 2 to 3 in the methods (M 1–2, M 2–3) and human
34. resources areas (HR 1–2, HR 2–3).
The road map can be described in the following four
steps:
Step One
Assuming that the company is at an initial (1) maturity
level in all areas, the first step in investment should be an
increase of maturity in the methods (M) and human
resources areas (HR) until they reach the level 3.
Step Two
Then, in the second step, the investment should be
placed in gradually reaching level 3 in the environment and
knowledge management areas (E 1–2, E 2–3, KM 1–2,
KM 2–3), and the increase in methods and human
resources should continually increase until they reach level
4 (HR 3–4, M 3–4).
Step Three
The third step should include activities improving the
maturity in the environment and knowledge management
areas until they report level 4 (E 3–4, KM 3–4) and the
35. methods and human resources areas until level 5 (M 4–5,
HR 4–5).
Step Four
Finally, in the fourth step, the increase should be from
level 4 to 5 in the environment and knowledge
management areas (E 4–5, KM 4–5).
Figure 1 shows the investment road map for the
construction industry.
Figure 1. Investment road map for the construction industry
36. M 1–2,
M 2–3,
HR 1–2,
HR 2–3
E 1–2,
E 2–3,
KM 1–2,
KM 2–3,
HR 3–4,
M 3–4
E 3–4,
KM 3–4,
M 4–5,
HR 4–5
E 4–5,
KM 4–5
37. STEP 1 STEP 2 STEP 3 STEP 4
Inzinerine Ekonomika-Engineering Economics, 2014, 25(5),
538–548
- 543 -
Comparing Steps in Construction Companies: the
Reduction of Impact
Remarkably, if assuming that in the first step, the impact
on reduction of time of future projects is 100, then in the
second step, it equals 81; in the third, 62; and in the fourth,
43.
This information is useful for investments in a specific
company, as companies in the same industry differ from one
another. After performing the first step, the total investment
and detailed impact on a project’s duration can be measured.
Then, knowing the predicted reduction of impact, one can
estimate the possible outcomes in the second step toward the
investment effort and decide if it is worth it to proceed. The
same approach can be performed before step three and four.
38. Following this advice means, of course, that time gaps are
needed between successive steps to reassess the situation.
The Investment Road Map: Information Technology
After construction, the second industry traditionally
associated with the project management sector is
information technology (IT). Moreover, both industries
report a long project management application history.
The investment road map for information technology
consists of six steps.
Step One
In step one, the investment in increasing project
management maturity levels should be performed to go from
level 1 to 2 and from 2 to 3 in the methods and human
resources areas (M 1–2, M 2–3, HR 1–2, HR 2–3).
Step Two
After the first investments, the company should consider
investments to increase the level of maturity from 1 to 2 and
then from 2 to 3 in the remaining two areas: environment
39. and knowledge management (E 1–2, E 2–3, KM 1–2, KM
2–3).
Step Three
In the third step, the project management maturity level
should be increased from 3 to 4 in the methods and human
resources areas (M 3–4, HR 3–4).
Step Four
In this step, as in step three, one goes up from level 3 to
4 in the environment and knowledge management areas (E
3–4, KM 3–4).
Step Five
The fifth step is designated for improvement in the
methods and human resources areas from level 4 to 5 (M 4–
5, HR 4–5).
Step Six
In the last step, the investment should be placed to
increase the maturity level from 4 to 5 in the areas of
environment and knowledge management (E 4–5, KM 4–5).
Figure 2 shows the investment road map for information
40. technology companies.
Figure 2. Investment road map for information technology
companies
Comparing Steps in IT Companies: The Reduction of
Impact
The highest potential impact on future projects in the
IT industry occurs when investing in the areas indicated in
the first step and then gradually decreases.
Assuming that the impact in the first step equals 100,
the impact on future projects’ duration of investment in
step two is 99. Accordingly, in step three, the duration is
81; in step four, 80; in step five, 62; and, finally, in step
41. six, 61.
Despite a relatively greater number of steps in
comparison to the construction industry, the differences
between some pairs of steps (1 and 2, 3 and 4, 5 and 6) are
small. Thus, the decision to …
CSCE 1040 Homework 3
For this assignment we are going to implement the Mean Green
EagleLift Application that we designed in Homework 2.
For the purposes of this assignment you will need to create a
user
interface menu that matches your design as well as implement
each
of the entities as classes in C++. Note we will be using C++ and
you
will need to use the g++ version of the compiler.
You may use any of the C++ STL at this time. You may NOT
use
Inheritance at this time. It is STRONGLY recommended, in fact
it is
required, that you use a pattern-based solution such as the
transaction pattern we have discussed, just as you created in
your
design. Other methods or designs will significantly increase
your
development time, stress level, as well as the
42. degree of difficulty for this assignment. And you will lose a
portion of
the points since it is required. Be sure that your implementation
reflects the information in your updated design; based on any
feedback you received from the grader or instructor.
You will need to use the Time class from C++ libraries to work
with the time
information. We will discuss this in class and there will be
some video and other
resources posted about this for your reference.
You may need to modify your design from Homework 2 based
on
grader comments and class discussion. You will need to turn
this
updated design in as well as use it for the basis of your program
Be sure to attend class lectures, as we will discuss many of the
topics you will need to complete the assignment!
Program Requirements
Your program will be written in C/C++ not any other computer
language.
You will include the steps in your algorithm in your code. You
may, of
course, paraphrase them if you like.
Your program will be graded based largely upon whether it
works
correctly on a CSE Department Linux machine.
43. Your program will also be graded upon your program style. At
the
very least your program should include: A consistent
indentation style
as recommended in the textbook and in class. It should also use
meaningful variable names. A block header comment section
that
includes: Your Name and Email Address, and a brief description
of
the program.
Your program's output should initially display the department
and
course number, program number, your name, and your email
address.
Be sure to create appropriate test data and execute tests for
proper
and improper data on all functions. You will submit your
program
source file to the Canvas website under the "Homework 3" drop
box.
Make sure you submit your program before the due date and
time.
You must also submit your updated Design file, and a short
report
about your efforts. Each class should have its own header (.h)
and
code (.cpp) file as well as a .cpp for main and, if needed, a .h
file for
main if any other functions of constants are needed. This means
you
will be turning in 2 PDF’s (updated design document and
report) , 7
cpp files (6 classes and 1 main) and at least 6 header files (1 for
44. each
class). If you create a .h for main then you will have 7 header
files.
You should also create a makefile to make it easier to compile
your
code for both you and the grader. Finally zip all of these files
into a
single zip file named hw3xxx.zip, where xxx represents your
initials.
Please be sure and test your program to make sure it is working
properly. You can either do this by hand (calculating some test
values
on paper to see if they match what your program says), or
temporarily
display various intermediate values you're calculating in the
process
and desk check the results to make sure they are correct. The
more
test cases you try and you get correct answers, the more certain
you
will be that when the grader uses his or her own test cases that
your
program will produce the correct result.