CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
Intro to Sociology Article AbstractsAssignment First, c.docxmariuse18nolet
Intro to Sociology
Article Abstracts
Assignment: First, choose a research topic that can be studied from a social science perspective and a topic which has some personal interest to you. Second, locate and write an abstract for two professional journal articles, which are related to your research topic of interest. Using the format and model provided below, for each article discuss the a) problem statement, b) sample, c) research methods, d) findings, and e) application.
Procedure: Use the information provided by the resource librarian who came to class, as well as the written materials provided. Materials from the text book, bibliographies, etc. may also be of use. Find professional journals used in the social sciences, especially sociology journals, and locate three articles related to your research topic. Do not use popular periodicals like Newsweek, Time, The Wichita Eagle, Jet, or Cosmopolitan.
Format: Use a separate page for each abstract. At the top of the page, give a full citation of the article using this form:
Author's last name, author's first name. Year. "Title of the article in
quotation marks." Title of the Journal underlined Volume Number (date); pages.
In addition, use the following headings as an outline for the required information from each article you abstract. The writing task under each heading is noted.
A. Problem Statement: State clearly and concisely the research problem of the study...that is, what is the purpose of the research?
B. Sample: State clearly who is studied, where, and when. Briefly discuss the size and nature of the sample.
C. Methods: Tell briefly and clearly how the information for the study was collected. Interview, observation, survey, experiment, etc.
D. Findings: Without using statistics, summarize the important findings in the study.
E. Application: What is the significance or value of the findings? How does the author suggest they be used? To whom might these findings be useful?
F. Abstractor’s name
and date.
Each Abstract is worth 50 points each.
SAMPLE ABSTRACT
Downey, Douglas B. and Brian Powell. 1993. "Do Children in Single-Parent Households Fare Better Living With Same-Sex Parents?" Journal of Marriage and the Family 55:55-71.
Problem Statement: The purpose of the study is to answer the question whether living with a single parent of the same sex provides any advantage over living with a parent of the other sex.
Sample: A nationally representative sample of 3,892 eighth graders living with a single parent; 3,483 of whom live with their mothers, and 409 of whom live with their fathers. This subset is part of a much larger data set, National Education Longitudinal Study of 1988 (NELS:88), where 24,599 subjects were selected through a stratified random sampling design with clustering of sampling units within schools.
Methods: Survey methods were used to collect data from students, teachers, parents, and school reco.
Name Case Study Title Briefly What happened Provimaple8qvlisbey
Name:
Case Study Title:
Briefly What happened? Provide the article title, URL and a one sentence summary of the case.
Key Stakeholders and how were they negatively impacted: [This does not need to be a complete list, just several major stakeholders (not stockholders, though the stockholders may be stakeholders). Briefly explain the relationship with the company – why they are stakeholders
What was the final outcome? [prison, fines, termination, and for how many individuals]
Describe why you feel the actions were morally wrong? [Be sure to use keywords describing your moral base (consequentialist, care, duty, act utilitarian, prima facie duties, etc.) and why your compass would justify classifying the action as morally wrong. Alternatively, discuss why you may feel the action was morally acceptable.]
Put yourself in a position of leadership and describe what you would put in place that would have prevented this in the first place or keep it from happening again. Or, alternatively what rules would you implement to justify the action:
Criteria Ratings Points
Scholarly
Tone and
literature
35 to >32.0 pts
Advanced
Level one and two
headings are coherently
aligned with the theory
and research and are
supported throughout the
body of the paper using
scholarly literature and
written in a scholarly
tone.
32 to >22.0 pts
Proficient
Level one and two
headings are coherently
aligned with the theory
and research and are
mostly supported
throughout the body of
the paper using scholarly
literature and somewhat
written in a scholarly
tone.
22 to >0.0 pts
Developing
Some headings are missing
or are not coherently aligned
with the theory and research
and are not well supported
throughout the body of the
paper using scholarly
literature. Lacks scholarly
tone.
0 pts
Not
Present
35 pts
Content 70 to >63.0 pts
Advanced
The theory and theorist
are included. One theory
is well-developed. An
explanation for how the
theory is appropriate for
the research is clearly
described. The author’s
voice is heard throughout
the paper.
63 to >58.0 pts
Proficient
The theory and theorist
are included. One theory
is mostly well-developed.
An explanation for how
the theory is appropriate
for the research is mostly
described. The author’s
voice is somewhat heard
throughout the paper.
58 to >0.0 pts
Developing
The theory and/or theorist are
missing. The theory lacks
development. An explanation
for how the theory is
appropriate for the research
is vaguely described or
missing. The author’s voice is
vaguely heard throughout the
paper.
0 pts
Not
Present
70 pts
Current
APA,
Mechanics,
Format &
Length
45 to >38.0 pts
Advanced
Paper is free of
mechanical and current
APA errors. 100% of the
length requirement is
met. All five sources are
peer-reviewed and clearly
related to the topic. One
source may be non-peer
reviewed to account for
the original theorist.
38 to >36.0 pts
Proficient
Few mechanical and ...
Running head: CYBERBULLYING 1
CYBERBULLYING 6
Cyberbullying and the First Amendment
Jane Doe
July 28, 2016
Cyberbullying and the First Amendment
All papers should have an introductory paragraph that provides background on the subject you are going to write about in the paper. I recommend finding a current event, perhaps an article where a student committed suicide after having been the target of cyberbullying. A good approach follows this line: Tell them what you are going to tell them (introduction), Tell them (body of paper), and Tell them what you told them (Conclusion). The introduction must contain a thesis statement previewing the paper. An examination of Minford School District’s school board policy as well as the faculty and student handbooks in addition to the relevant sections of the Ohio Revised Code followed by a review of the First Amendment arguments the student who is charged with cyberbullying might make, and the First Amendment responses based on case law the school district could argue, will provide insight into the issue of cyberbullying. (This is just an example off the top of my head). (Another approach for the purpose statement could be: Having been notified that a student in your class has been subjected to bullying through another classmate's Facebook page, a discussion of steps required by (enter your state's name)"s statutes, (enter your school district's name)'s school board policies as well as the student handbook, will provide a basis for examining any First Amendment arguments that the bullying has raised, and a discussion of the school district’s First Amendment argumentative responses consistent with the cases in the assigned readings.)
State Statutes and District Policies on Cyberbullying
Paragraph one should explain how the school district policy that you are examining addresses cyberbullying. You should examine the district’s policy, the faculty handbook, and the student handbook. Make sure that you are correctly providing in-text citations to these sources.
In a separate paragraph, you should examine your state’s laws on cyberbullying. (We looked these up in one of the DQs this week). The question you should answer after reviewing each of the above are what steps that a faculty member should take based on the laws and policies examined. Another issue to examine might be if the policy differentiates between cyberbullying that occurs out of school and cyberbullying that occurs during school. Remember to refer back to the facts of the specific scenario as you examine each of these laws or policies. Citations to sources should be used throughout the paper. Transition sentence into the next section of the paper goes here. Examples: Having examined the Minford Local School District’s policy, the faculty handbook, the student handbook, and the Ohio Revised Code, this paper w ...
Week 3 APA Module AssignmentWeek 3 APA Module Assignmentb. Lis.docxmelbruce90096
Week 3 APA Module Assignment
Week 3 APA Module Assignment
b. Listen to the tutorial or download and review the transcript on APA and answer the questions below
After reviewing the presentation, compose a 2-paragraph response in which you address each of the following points:
1. Why is APA Style used to document ideas in writing? What is the purpose of the in-text citation? Demonstrate your understanding of the in-text citation by providing an in-text citation for the article you summarized for the week 2 assignment. (15 points)
2. In the article that you summarized in week 2, you may have found some information that you want to quote directly. To demonstrate the process for citing a direct quote, provide an example of properly quoted material. (20 points)
Week 3 Grading Rubric for Proposal Pitch
Central Idea/ Focus: thesis statement or main exists; all ideas consistently address this main idea. Off-topic or irrelevant ideas should not exist. 10 points
Support/ Development of Ideas: Ideas are sufficiently developed for each point. ideas are sufficiently developed for each point. Three points for each of the five sections of the document. 15 points
Organization/ Structure: the internal structure of a piece of writing, the thread of central meaning. All ideas are organized well without any missing or incomplete components. The answers are from one to three sentences each. 10 points
APA including Paper Format: correct title page, headers, second page title, margins, alignment, spacing, font and size. 10 points
Grammar/Mechanics/Style:Grammar refers to correctness of language usage, mechanics refers to conventional correctness in capitalization, punctuation, and spelling. Style includes word choice, sentence variety, clarity, and conciseness. Also, sentences vary in length and structure; ideas are clear, logical, and concise. 5 points
Running head: YOUR TITLE GOES HERE 1
YOUR TITLE GOES HERE 3
Your Course Project Title Goes Here
First Last Name
Name of University
Your Course Project Title Goes Here
The purpose of a proposal is to highlight standout ideas, and to do so in a manner that can convince an audience to support a project. Proposals delivered in a workplace are often part of a competitive process in which the strongest proposal is offered the business. In these contexts, effective word choice and professional delivery define the effective communication of an idea. Your research proposal will be presented as a sentence outline. As the name suggests, the sentence outline presents complete thoughts in complete sentences as opposed to phrases. In each section of the proposal, choose ideas with the goal of persuading your reader to believe that you are interested in the topic and ready to learn how to develop the topic into a project. Use a complete sentence to provide the response to each of the questions below. You can use first person. Use APA documentation for the final section of the proposal to document any sources re.
To prepare for writing the research proposal, identify a topic of milissaccm
To prepare for writing the research proposal, identify a topic of personal and professional interest that is relevant to the early childhood field. Conduct an initial review of the literature and narrow your topic by discussing it with Faculty, colleagues, or fellow students.
Topic of choice - What is teacher perspectives on the effectiveness of RTI in preschool settings
Part 1- research proposal
The 10- to 15-page research proposal must include all of the following components, in order:
Title Page (1 page)
Abstract (1 page)
150- to 200-word summary of the proposal
Introduction (2–3 pages)
The introduction provides the reader with an overview of the literature related to the topic and justifies the need for the research study. The introduction is typically written after completing the literature review.
Your introduction should include:
Your research question and an explanation of the problem your question is designed to explore
A rationale for importance of this topic, including an explanation of the gap in the research literature that your topic will explore
Literature Review (3–6 pages)
discuss RTI strategies implications, effects, research etc.
The main purpose of a literature review is to synthesize current research related to your topic. In addition, the literature review is where you consider the implications of research that has already been published on your research question. Must also include the different RTI techniques
The literature review should include an:
Analysis of the context in which the problem is situated and current thinking about solutions, including the theoretical perspectives presented in the literature and a discussion of the research findings
Explanation of the implications of the research to your research question
Note: Your literature review must include a minimum of five highly relevant , up-to-date and credible resources.
Methodology and Data Collection (2–3pages).
Name the research design you will use (i.e., quantitative design, qualitative design, or mixed method design), and the reasons for your choice. If your study is quantitative or mixed methods, define the independent and dependent variables.Add examples base on US were you will use U.S based school data
Describe the study participant(s) and your sampling process. Discuss any sampling issues/challenges you might encounter.
Describe the data collection method(s) you will use—and what influenced your choice.
Describe any major ethical issue(s) you perceive for your study— and ways you will address ethics.
Describe the benefits, limitations, and challenges you perceive in your study.
References (1-2 pages)
Appendices pages
Part 2- sharing and reflection
The video presentation / PowerPoint must be 7 minutes and include an:
Introduction that explains your research question, how you arrived at the research question, and the methodology
Explanation of how this research can contribute to positive social change in the early childhood field
...
Please pay attention to all the details. The instructor told me th.docxstilliegeorgiana
Please pay attention to all the details. The instructor told me the conclusion must include all the topics learned in this class sin ce week 2. I added all the necessary info you need to complete the conclusion for my final paper.
Concusion Section
7 - Conclusion: In this section, the student will identify a summary of their EBP project as well as consider the potential contribution to their specialty track (FAMILY NURSE PRACTITIONER) practice setting. The required content includes: MUST BE A COMPREHENSIVE CONCLUSION FROM WEEK 2 THROUGH WEEK 7
· Provide a comprehensive summary of key points from this EBP proposal project (PART A)
WEEK 2 – To develop an EBP PICOT/PICo question as well as a research question, numerous sources can trigger the spirit of inquiry, or to put it simply, the "I wonder . . . ?" The sources include, but are not limited to, the following.
· Identification of a concern in a practice area (i.e., "I wonder how I can prevent . . . ")
· Inconsistencies found in professional literature (i.e., Article A says I should do X, but Article B says that the preferred action is Y. I wonder which one is correct for my practice area.")
· Problems occurring with the practice area (i.e., "This has been a problem in the unit as long as I can remember; I wonder how I can improve the . . . ")
· Reviewing nursing theory (i.e., "I read that knowledge helps with self-care; I wonder whether it would help to foster patient compliance with . . . )
Although the source of the EBPPICOT/PICo or research study question can vary based upon your practice area and its related events, the role of nursing theory is where this week begins.
WEEK 3 – Discussions - Elements of Quantitative Research: Design and Sampling
This discussion will explore the quantitative approach sampling and design by analyzing a single study quantitative research article related to your specialty track. WEEK 4 - Developing New Evidence: Qualitative Research Studies Overview of the Qualitative Research Approach
Qualitative research studies phenomena in their natural settings. By using the natural settings, this design interprets phenomena in terms of the meanings that people bring to them. Qualitative research aims to get a better understanding through firsthand experience because subjects share thoughts, feelings, and experiences. Qualitative research involves the collection of a variety of empirical materials. These materials include, but are not limited to, case study, personal experience, life story, interviews, observations, historical perspectives, interactional, and visual texts. All of this information becomes data that describe routine as well as problematic moments with the meanings these moments have in individuals' lives.
Often, the qualitative approach is used as the initial research study in an area of interest because it will help to explore and define the phenomena. By gaining an understanding of underlying reasons, opinions, and motivations, it provid ...
NR360 Information Systems in Healthcare RUA We Can, BuMoseStaton39
NR360 Information Systems in Healthcare
RUA: We Can, But Dare We? Guidelines
NR360_RUA_We_Can_But_Dare_We_Guidelines Revised: July 2020 1
Purpose
The purpose of this assignment is to investigate informatics in healthcare and to apply professional, ethical, and legal
principles to its appropriate use in healthcare technology.
Course outcomes: This assignment enables the student to meet the following course outcomes:
CO 4: Investigate safeguards and decision‐making support tools embedded in patient care technologies and information
systems to support a safe practice environment for both patients and healthcare workers. (PO 4)
CO 6: Discuss the principles of data integrity, professional ethics, and legal requirements related to data security,
regulatory requirements, confidentiality, and client’s right to privacy. (PO 6)
CO 8: Discuss the value of best evidence as a driving force to institute change in the delivery of nursing care. (PO 8)
Due date: Your faculty member will inform you when this assignment is due . The Late Assignment Policy applies to
this assignment.
Total points possible: 240 points
Requirements:
• Research, compose, and type a scholarly paper based on the scenario provided by your faculty, and choose a
conclusion scenario to discuss within the body of your paper. Reflect on lessons learned in this class about
technology, privacy concerns, and legal and ethical issues and address each of these concepts in the paper. Consider
the consequences of such a scenario. Do not limit your review of the literature to the nursing discipline only because
other health professionals are using the technology, and you may need to apply critical thinking skills to its
applications in this scenario.
• Use Microsoft Word and APA formatting. Consult your copy of the Publication Manual of the American Psychological
Association, as well as the resources in Doc Sharing if you have questions (e.g., margin size, font type and size
(point), use of third person, etc.). Take advantage of the writing service SmartThinking, which is accessed by clicking
on the link called the Tutor Source, found under the Course Home area.
• The length of the paper should be four to five pages, excluding the title page and the reference page. Limit the
references to a few key sources (minimum of three required).
• The paper will contain an introduction that catches the attention of the reader, states the purpose of the paper, and
provides a narrative outline of what will follow (i.e., the assignment criteria).
• In the body of the paper, discuss the scenario in relation to HIPAA, legal, and other regulatory requirements that
apply to the scenario and the ending you chose. Demonstrate support from sources of evidence (references)
included as in‐text citations.
• Choose and identify one of the possible endings provided for the scenario, and construct your paper based on its
implications to the scenario. Make recommendati ...
Intro to Sociology Article AbstractsAssignment First, c.docxmariuse18nolet
Intro to Sociology
Article Abstracts
Assignment: First, choose a research topic that can be studied from a social science perspective and a topic which has some personal interest to you. Second, locate and write an abstract for two professional journal articles, which are related to your research topic of interest. Using the format and model provided below, for each article discuss the a) problem statement, b) sample, c) research methods, d) findings, and e) application.
Procedure: Use the information provided by the resource librarian who came to class, as well as the written materials provided. Materials from the text book, bibliographies, etc. may also be of use. Find professional journals used in the social sciences, especially sociology journals, and locate three articles related to your research topic. Do not use popular periodicals like Newsweek, Time, The Wichita Eagle, Jet, or Cosmopolitan.
Format: Use a separate page for each abstract. At the top of the page, give a full citation of the article using this form:
Author's last name, author's first name. Year. "Title of the article in
quotation marks." Title of the Journal underlined Volume Number (date); pages.
In addition, use the following headings as an outline for the required information from each article you abstract. The writing task under each heading is noted.
A. Problem Statement: State clearly and concisely the research problem of the study...that is, what is the purpose of the research?
B. Sample: State clearly who is studied, where, and when. Briefly discuss the size and nature of the sample.
C. Methods: Tell briefly and clearly how the information for the study was collected. Interview, observation, survey, experiment, etc.
D. Findings: Without using statistics, summarize the important findings in the study.
E. Application: What is the significance or value of the findings? How does the author suggest they be used? To whom might these findings be useful?
F. Abstractor’s name
and date.
Each Abstract is worth 50 points each.
SAMPLE ABSTRACT
Downey, Douglas B. and Brian Powell. 1993. "Do Children in Single-Parent Households Fare Better Living With Same-Sex Parents?" Journal of Marriage and the Family 55:55-71.
Problem Statement: The purpose of the study is to answer the question whether living with a single parent of the same sex provides any advantage over living with a parent of the other sex.
Sample: A nationally representative sample of 3,892 eighth graders living with a single parent; 3,483 of whom live with their mothers, and 409 of whom live with their fathers. This subset is part of a much larger data set, National Education Longitudinal Study of 1988 (NELS:88), where 24,599 subjects were selected through a stratified random sampling design with clustering of sampling units within schools.
Methods: Survey methods were used to collect data from students, teachers, parents, and school reco.
Name Case Study Title Briefly What happened Provimaple8qvlisbey
Name:
Case Study Title:
Briefly What happened? Provide the article title, URL and a one sentence summary of the case.
Key Stakeholders and how were they negatively impacted: [This does not need to be a complete list, just several major stakeholders (not stockholders, though the stockholders may be stakeholders). Briefly explain the relationship with the company – why they are stakeholders
What was the final outcome? [prison, fines, termination, and for how many individuals]
Describe why you feel the actions were morally wrong? [Be sure to use keywords describing your moral base (consequentialist, care, duty, act utilitarian, prima facie duties, etc.) and why your compass would justify classifying the action as morally wrong. Alternatively, discuss why you may feel the action was morally acceptable.]
Put yourself in a position of leadership and describe what you would put in place that would have prevented this in the first place or keep it from happening again. Or, alternatively what rules would you implement to justify the action:
Criteria Ratings Points
Scholarly
Tone and
literature
35 to >32.0 pts
Advanced
Level one and two
headings are coherently
aligned with the theory
and research and are
supported throughout the
body of the paper using
scholarly literature and
written in a scholarly
tone.
32 to >22.0 pts
Proficient
Level one and two
headings are coherently
aligned with the theory
and research and are
mostly supported
throughout the body of
the paper using scholarly
literature and somewhat
written in a scholarly
tone.
22 to >0.0 pts
Developing
Some headings are missing
or are not coherently aligned
with the theory and research
and are not well supported
throughout the body of the
paper using scholarly
literature. Lacks scholarly
tone.
0 pts
Not
Present
35 pts
Content 70 to >63.0 pts
Advanced
The theory and theorist
are included. One theory
is well-developed. An
explanation for how the
theory is appropriate for
the research is clearly
described. The author’s
voice is heard throughout
the paper.
63 to >58.0 pts
Proficient
The theory and theorist
are included. One theory
is mostly well-developed.
An explanation for how
the theory is appropriate
for the research is mostly
described. The author’s
voice is somewhat heard
throughout the paper.
58 to >0.0 pts
Developing
The theory and/or theorist are
missing. The theory lacks
development. An explanation
for how the theory is
appropriate for the research
is vaguely described or
missing. The author’s voice is
vaguely heard throughout the
paper.
0 pts
Not
Present
70 pts
Current
APA,
Mechanics,
Format &
Length
45 to >38.0 pts
Advanced
Paper is free of
mechanical and current
APA errors. 100% of the
length requirement is
met. All five sources are
peer-reviewed and clearly
related to the topic. One
source may be non-peer
reviewed to account for
the original theorist.
38 to >36.0 pts
Proficient
Few mechanical and ...
Running head: CYBERBULLYING 1
CYBERBULLYING 6
Cyberbullying and the First Amendment
Jane Doe
July 28, 2016
Cyberbullying and the First Amendment
All papers should have an introductory paragraph that provides background on the subject you are going to write about in the paper. I recommend finding a current event, perhaps an article where a student committed suicide after having been the target of cyberbullying. A good approach follows this line: Tell them what you are going to tell them (introduction), Tell them (body of paper), and Tell them what you told them (Conclusion). The introduction must contain a thesis statement previewing the paper. An examination of Minford School District’s school board policy as well as the faculty and student handbooks in addition to the relevant sections of the Ohio Revised Code followed by a review of the First Amendment arguments the student who is charged with cyberbullying might make, and the First Amendment responses based on case law the school district could argue, will provide insight into the issue of cyberbullying. (This is just an example off the top of my head). (Another approach for the purpose statement could be: Having been notified that a student in your class has been subjected to bullying through another classmate's Facebook page, a discussion of steps required by (enter your state's name)"s statutes, (enter your school district's name)'s school board policies as well as the student handbook, will provide a basis for examining any First Amendment arguments that the bullying has raised, and a discussion of the school district’s First Amendment argumentative responses consistent with the cases in the assigned readings.)
State Statutes and District Policies on Cyberbullying
Paragraph one should explain how the school district policy that you are examining addresses cyberbullying. You should examine the district’s policy, the faculty handbook, and the student handbook. Make sure that you are correctly providing in-text citations to these sources.
In a separate paragraph, you should examine your state’s laws on cyberbullying. (We looked these up in one of the DQs this week). The question you should answer after reviewing each of the above are what steps that a faculty member should take based on the laws and policies examined. Another issue to examine might be if the policy differentiates between cyberbullying that occurs out of school and cyberbullying that occurs during school. Remember to refer back to the facts of the specific scenario as you examine each of these laws or policies. Citations to sources should be used throughout the paper. Transition sentence into the next section of the paper goes here. Examples: Having examined the Minford Local School District’s policy, the faculty handbook, the student handbook, and the Ohio Revised Code, this paper w ...
Week 3 APA Module AssignmentWeek 3 APA Module Assignmentb. Lis.docxmelbruce90096
Week 3 APA Module Assignment
Week 3 APA Module Assignment
b. Listen to the tutorial or download and review the transcript on APA and answer the questions below
After reviewing the presentation, compose a 2-paragraph response in which you address each of the following points:
1. Why is APA Style used to document ideas in writing? What is the purpose of the in-text citation? Demonstrate your understanding of the in-text citation by providing an in-text citation for the article you summarized for the week 2 assignment. (15 points)
2. In the article that you summarized in week 2, you may have found some information that you want to quote directly. To demonstrate the process for citing a direct quote, provide an example of properly quoted material. (20 points)
Week 3 Grading Rubric for Proposal Pitch
Central Idea/ Focus: thesis statement or main exists; all ideas consistently address this main idea. Off-topic or irrelevant ideas should not exist. 10 points
Support/ Development of Ideas: Ideas are sufficiently developed for each point. ideas are sufficiently developed for each point. Three points for each of the five sections of the document. 15 points
Organization/ Structure: the internal structure of a piece of writing, the thread of central meaning. All ideas are organized well without any missing or incomplete components. The answers are from one to three sentences each. 10 points
APA including Paper Format: correct title page, headers, second page title, margins, alignment, spacing, font and size. 10 points
Grammar/Mechanics/Style:Grammar refers to correctness of language usage, mechanics refers to conventional correctness in capitalization, punctuation, and spelling. Style includes word choice, sentence variety, clarity, and conciseness. Also, sentences vary in length and structure; ideas are clear, logical, and concise. 5 points
Running head: YOUR TITLE GOES HERE 1
YOUR TITLE GOES HERE 3
Your Course Project Title Goes Here
First Last Name
Name of University
Your Course Project Title Goes Here
The purpose of a proposal is to highlight standout ideas, and to do so in a manner that can convince an audience to support a project. Proposals delivered in a workplace are often part of a competitive process in which the strongest proposal is offered the business. In these contexts, effective word choice and professional delivery define the effective communication of an idea. Your research proposal will be presented as a sentence outline. As the name suggests, the sentence outline presents complete thoughts in complete sentences as opposed to phrases. In each section of the proposal, choose ideas with the goal of persuading your reader to believe that you are interested in the topic and ready to learn how to develop the topic into a project. Use a complete sentence to provide the response to each of the questions below. You can use first person. Use APA documentation for the final section of the proposal to document any sources re.
To prepare for writing the research proposal, identify a topic of milissaccm
To prepare for writing the research proposal, identify a topic of personal and professional interest that is relevant to the early childhood field. Conduct an initial review of the literature and narrow your topic by discussing it with Faculty, colleagues, or fellow students.
Topic of choice - What is teacher perspectives on the effectiveness of RTI in preschool settings
Part 1- research proposal
The 10- to 15-page research proposal must include all of the following components, in order:
Title Page (1 page)
Abstract (1 page)
150- to 200-word summary of the proposal
Introduction (2–3 pages)
The introduction provides the reader with an overview of the literature related to the topic and justifies the need for the research study. The introduction is typically written after completing the literature review.
Your introduction should include:
Your research question and an explanation of the problem your question is designed to explore
A rationale for importance of this topic, including an explanation of the gap in the research literature that your topic will explore
Literature Review (3–6 pages)
discuss RTI strategies implications, effects, research etc.
The main purpose of a literature review is to synthesize current research related to your topic. In addition, the literature review is where you consider the implications of research that has already been published on your research question. Must also include the different RTI techniques
The literature review should include an:
Analysis of the context in which the problem is situated and current thinking about solutions, including the theoretical perspectives presented in the literature and a discussion of the research findings
Explanation of the implications of the research to your research question
Note: Your literature review must include a minimum of five highly relevant , up-to-date and credible resources.
Methodology and Data Collection (2–3pages).
Name the research design you will use (i.e., quantitative design, qualitative design, or mixed method design), and the reasons for your choice. If your study is quantitative or mixed methods, define the independent and dependent variables.Add examples base on US were you will use U.S based school data
Describe the study participant(s) and your sampling process. Discuss any sampling issues/challenges you might encounter.
Describe the data collection method(s) you will use—and what influenced your choice.
Describe any major ethical issue(s) you perceive for your study— and ways you will address ethics.
Describe the benefits, limitations, and challenges you perceive in your study.
References (1-2 pages)
Appendices pages
Part 2- sharing and reflection
The video presentation / PowerPoint must be 7 minutes and include an:
Introduction that explains your research question, how you arrived at the research question, and the methodology
Explanation of how this research can contribute to positive social change in the early childhood field
...
Please pay attention to all the details. The instructor told me th.docxstilliegeorgiana
Please pay attention to all the details. The instructor told me the conclusion must include all the topics learned in this class sin ce week 2. I added all the necessary info you need to complete the conclusion for my final paper.
Concusion Section
7 - Conclusion: In this section, the student will identify a summary of their EBP project as well as consider the potential contribution to their specialty track (FAMILY NURSE PRACTITIONER) practice setting. The required content includes: MUST BE A COMPREHENSIVE CONCLUSION FROM WEEK 2 THROUGH WEEK 7
· Provide a comprehensive summary of key points from this EBP proposal project (PART A)
WEEK 2 – To develop an EBP PICOT/PICo question as well as a research question, numerous sources can trigger the spirit of inquiry, or to put it simply, the "I wonder . . . ?" The sources include, but are not limited to, the following.
· Identification of a concern in a practice area (i.e., "I wonder how I can prevent . . . ")
· Inconsistencies found in professional literature (i.e., Article A says I should do X, but Article B says that the preferred action is Y. I wonder which one is correct for my practice area.")
· Problems occurring with the practice area (i.e., "This has been a problem in the unit as long as I can remember; I wonder how I can improve the . . . ")
· Reviewing nursing theory (i.e., "I read that knowledge helps with self-care; I wonder whether it would help to foster patient compliance with . . . )
Although the source of the EBPPICOT/PICo or research study question can vary based upon your practice area and its related events, the role of nursing theory is where this week begins.
WEEK 3 – Discussions - Elements of Quantitative Research: Design and Sampling
This discussion will explore the quantitative approach sampling and design by analyzing a single study quantitative research article related to your specialty track. WEEK 4 - Developing New Evidence: Qualitative Research Studies Overview of the Qualitative Research Approach
Qualitative research studies phenomena in their natural settings. By using the natural settings, this design interprets phenomena in terms of the meanings that people bring to them. Qualitative research aims to get a better understanding through firsthand experience because subjects share thoughts, feelings, and experiences. Qualitative research involves the collection of a variety of empirical materials. These materials include, but are not limited to, case study, personal experience, life story, interviews, observations, historical perspectives, interactional, and visual texts. All of this information becomes data that describe routine as well as problematic moments with the meanings these moments have in individuals' lives.
Often, the qualitative approach is used as the initial research study in an area of interest because it will help to explore and define the phenomena. By gaining an understanding of underlying reasons, opinions, and motivations, it provid ...
NR360 Information Systems in Healthcare RUA We Can, BuMoseStaton39
NR360 Information Systems in Healthcare
RUA: We Can, But Dare We? Guidelines
NR360_RUA_We_Can_But_Dare_We_Guidelines Revised: July 2020 1
Purpose
The purpose of this assignment is to investigate informatics in healthcare and to apply professional, ethical, and legal
principles to its appropriate use in healthcare technology.
Course outcomes: This assignment enables the student to meet the following course outcomes:
CO 4: Investigate safeguards and decision‐making support tools embedded in patient care technologies and information
systems to support a safe practice environment for both patients and healthcare workers. (PO 4)
CO 6: Discuss the principles of data integrity, professional ethics, and legal requirements related to data security,
regulatory requirements, confidentiality, and client’s right to privacy. (PO 6)
CO 8: Discuss the value of best evidence as a driving force to institute change in the delivery of nursing care. (PO 8)
Due date: Your faculty member will inform you when this assignment is due . The Late Assignment Policy applies to
this assignment.
Total points possible: 240 points
Requirements:
• Research, compose, and type a scholarly paper based on the scenario provided by your faculty, and choose a
conclusion scenario to discuss within the body of your paper. Reflect on lessons learned in this class about
technology, privacy concerns, and legal and ethical issues and address each of these concepts in the paper. Consider
the consequences of such a scenario. Do not limit your review of the literature to the nursing discipline only because
other health professionals are using the technology, and you may need to apply critical thinking skills to its
applications in this scenario.
• Use Microsoft Word and APA formatting. Consult your copy of the Publication Manual of the American Psychological
Association, as well as the resources in Doc Sharing if you have questions (e.g., margin size, font type and size
(point), use of third person, etc.). Take advantage of the writing service SmartThinking, which is accessed by clicking
on the link called the Tutor Source, found under the Course Home area.
• The length of the paper should be four to five pages, excluding the title page and the reference page. Limit the
references to a few key sources (minimum of three required).
• The paper will contain an introduction that catches the attention of the reader, states the purpose of the paper, and
provides a narrative outline of what will follow (i.e., the assignment criteria).
• In the body of the paper, discuss the scenario in relation to HIPAA, legal, and other regulatory requirements that
apply to the scenario and the ending you chose. Demonstrate support from sources of evidence (references)
included as in‐text citations.
• Choose and identify one of the possible endings provided for the scenario, and construct your paper based on its
implications to the scenario. Make recommendati ...
· Assignment List
· Week 7 - Philosophical Essay
Week 7 - Philosophical Essay
DUE: Mar 22, 2020 11:55 PM
Grade Details
Grade
N/A
Gradebook Comments
None
Assignment Details
Open Date
Feb 3, 2020 12:05 AM
Graded?
Yes
Points Possible
100.0
Resubmissions Allowed?
No
Attachments checked for originality?
Yes
Top of Form
Assignment Instructions
Objective: Students will write a Philosophical Essay for week 7 based on the course concepts.
Course Objectives: 2, 3, & 4
Task:
This 4 - 5 full page (not to exceed 6 pages) Philosophical Essay you will be writing due Week 7 is designed to be a thoughtful, reflective work. The 4 - 5 full pages does not include a cover page or a works cited page. It will be your premier writing assignment focused on the integration and assessment relating to the course concepts. Your paper should be written based on the outline you submitted during week 4 combined with your additional thoughts and instructor feedback. You will use at least three scholarly/reliable resources with matching in-text citations and a Works Cited page. All essays are double spaced, 12 New Times Roman font, paper title, along with all paragraphs indented five spaces.
Details:
You will pick one of the following topics only to do your paper on:
· According to Socrates, must one heed popular opinion about moral matters? Does Socrates accept the fairness of the laws under which he was tried and convicted? Would Socrates have been wrong to escape?
· Consider the following philosophical puzzle: “If a tree falls in the forest and there's no one around to hear it, does it make a sound?” (1) How is this philosophical puzzle an epistemological problem? And (2) how would John Locke answer it?
· Evaluate the movie, The Matrix, in terms of the philosophical issues raised with (1) skepticism and (2) the mind-body problem. Explain how the movie raises questions similar to those found in Plato’s and Descartes’ philosophy. Do not give a plot summary of the movie – focus on the philosophical issues raised in the movie as they relate to Plato and Descartes.
· Socrates asks Euthyphro, “Are morally good acts willed by God because they are morally good, or are they morally good because they are willed by God?” (1) How does this question relate to the Divine Command Theory of morality? (2) What are the philosophical implications associated with each option here?
· Explain (1) the process by which Descartes uses skepticism to refute skepticism, and (2) what first principle does this lead him to? (3) Explain why this project was important for Descartes to accomplish.
Your paper will be written at a college level with an introduction, body paragraphs, a conclusion, along with in-text citations/Works Cited page in MLA formatting. Students will follow MLA format as the sole citation and formatting style used in written assignments submitted as part of coursework to the Humanities Department. Remember - any resource that is listed on the Works Cited page must .
· Assignment List
· Week 7 - Philosophical Essay
Week 7 - Philosophical Essay
DUE: Mar 22, 2020 11:55 PM
Grade Details
Grade
N/A
Gradebook Comments
None
Assignment Details
Open Date
Feb 3, 2020 12:05 AM
Graded?
Yes
Points Possible
100.0
Resubmissions Allowed?
No
Attachments checked for originality?
Yes
Top of Form
Assignment Instructions
Objective: Students will write a Philosophical Essay for week 7 based on the course concepts.
Course Objectives: 2, 3, & 4
Task:
This 4 - 5 full page (not to exceed 6 pages) Philosophical Essay you will be writing due Week 7 is designed to be a thoughtful, reflective work. The 4 - 5 full pages does not include a cover page or a works cited page. It will be your premier writing assignment focused on the integration and assessment relating to the course concepts. Your paper should be written based on the outline you submitted during week 4 combined with your additional thoughts and instructor feedback. You will use at least three scholarly/reliable resources with matching in-text citations and a Works Cited page. All essays are double spaced, 12 New Times Roman font, paper title, along with all paragraphs indented five spaces.
Details:
You will pick one of the following topics only to do your paper on:
· According to Socrates, must one heed popular opinion about moral matters? Does Socrates accept the fairness of the laws under which he was tried and convicted? Would Socrates have been wrong to escape?
· Consider the following philosophical puzzle: “If a tree falls in the forest and there's no one around to hear it, does it make a sound?” (1) How is this philosophical puzzle an epistemological problem? And (2) how would John Locke answer it?
· Evaluate the movie, The Matrix, in terms of the philosophical issues raised with (1) skepticism and (2) the mind-body problem. Explain how the movie raises questions similar to those found in Plato’s and Descartes’ philosophy. Do not give a plot summary of the movie – focus on the philosophical issues raised in the movie as they relate to Plato and Descartes.
· Socrates asks Euthyphro, “Are morally good acts willed by God because they are morally good, or are they morally good because they are willed by God?” (1) How does this question relate to the Divine Command Theory of morality? (2) What are the philosophical implications associated with each option here?
· Explain (1) the process by which Descartes uses skepticism to refute skepticism, and (2) what first principle does this lead him to? (3) Explain why this project was important for Descartes to accomplish.
Your paper will be written at a college level with an introduction, body paragraphs, a conclusion, along with in-text citations/Works Cited page in MLA formatting. Students will follow MLA format as the sole citation and formatting style used in written assignments submitted as part of coursework to the Humanities Department. Remember - any resource that is listed on the Works Cited page must ...
MSc Managerial Psychology
Assessment Brief
SECTION 1
Assessment Point 1
Module Title: Project and Research Management
Module Code: UU-PSY705 ZM
Essay Title: A written research proposal for the research to be carried out in the
dissertation stage
Word Limit: 3500 words
Assessment Point No: 1 (1 out of 1) 100% of final module mark
Online Submission: Date and Time: See your module schedule.
Learning outcomes assessed:
1. Demonstrate an advanced understanding of the key principles of research
design regarding a particular project as well as an appreciation of the various
research strategies.
2. Critically evaluate sources of information and/or argument in relation to
research objectives.
3. Demonstrate effective skills in the communication of research findings.
4. Apply project management tools, processes and techniques.
5. As appropriate to specific student needs, students will develop an advanced
understanding in at least one of the following areas:
6.A range of research methods for data collection;
7.Data management and analysis, and awareness of issues affecting
data interpretation;
Important Guidelines:
1. Title
The title should be clear and specific, but not too detailed. For example, assume
we had done an experiment in which we had examined whether or not having
breakfast affected people’s ability to concentrate later in the day.
A good title would be ‘The effects of breakfast on mid-morning concentration
levels’.
Avoid using titles that are:
• Too vague
• Very detailed
The American Psychological Association suggests the title to be about 10-
12 words long.
2. Introduction and Literature Review
Introduction
This section is very important. In order to get the reader engaged with your
work you need make sure that you set the scene for the whole essay in a clear
way. Clarify the topic and the aim of the essay. Keep in mind that the reader
might not be familiar with your topic, and hence you should provide
explanations for all relevant terms and a brief overview of the structure of the
essay. Avoid lengthy discussions or explanations regarding definitions or
relevant research findings. Such discussions should be incorporated be part of
your literature review.
Basically, this section introduces the reader to the topic:
Give an introduction to the area of
Provide a rationale for the study using previous studies
Show how the current study fits in with existing literature
Literature Review
Literature review will be focused around your chosen topic -should summarize
and discuss the most recent and most relevant research findings related to the
current research project.
This part should highlight the research gap
The review provides the background of the problem
Critical evaluation is essential
Stat.
Running head ABBREVIATED TITLE OF YOUR PAPER1ABBREVIATED TITLE.docxtoddr4
Running head: ABBREVIATED TITLE OF YOUR PAPER 1
ABBREVIATED TITLE OF YOUR PAPER 13Full Title of Your PaperLearner’s Full Name (no credentials)Capella UniversityAbstract
It is necessary to complete the abstract after the entire project has been developed. The abstract contains an abbreviated overview of the entire project. This overview will reference the following elements of the project:
The Research Question_________________________________
The Research Problem: _____________________________________
The Significance of the Study: _______________________________
Theory or theories that apply to the concepts associated with the RQ: ________________
A Narrative describing the quantitative approach planned, implications for stakeholders, significance to the scientific community, and a description of expected results. The abstract is one concise paragraph.
Keywords: [Add keywords here.]
Table of Contents
CHAPTER 1. INTRODUCTION 1
Background of the Problem 1
Statement of the Problem 1
Purpose of the Study 1
Significance of the Study 1
Research Questions 1
Definition of Terms 1
Research Design 1
CHAPTER 2. LITERATURE REVIEW 1
Theoretical Orientation for the Study 1
Review of the Literature 1
Synthesis of the Research Findings 1
Critique of Previous Research Methods 1
CHAPTER 3. METHODOLOGY 1
Purpose of the Study 1
Research Question and Hypotheses 1
Research Design 1
Target Population and Sample 1
Procedures 1
Ethical Considerations 1
CHAPTER 4. EXPECTED FINDINGS/RESULTS 1
CHAPTER 5. DISCUSSION 1
Implications 1
Methodological Strengths and Weaknesses 1
Suggestions for Future Research 1
CHAPTER 1. INTRODUCTION
[Note, the Final draft of Chapter 1 is typically written after the entire project has been completed and just prior to the Abstract. It is important to understand that the project is iterative. You will work on, change and refine all elements of the project. In your initial submission, begin to provide an evidence-based rationale for each of the sections listed below.]
Background of the Problem
Statement of the Problem
Purpose of the Study
Significance of the Study
Research Questions
Definition of Terms
Research Design
[Note, under the Research Design, make mention of the relevant APA Code of Ethics, but not how you intend to address them. How you will address the codes and ensure they are adhered to will be covered in Chapter 3.]
CHAPTER 2. LITERATURE REVIEW
Note, this is typically the entry point for beginning the project. It is important to understand that the project is iterative. You will work on, change and refine all elements of the project. You will begin by understanding and synthesizing what is known so far in the Literature Review, (Chapter 2). Theoretical Orientation for the Study
The Literature Review provides detailed information about theory that applies to the research topic, theory that applies to the research method, population(s) studied and key concepts under review. Seminal and current sources are analyzed and eva.
At the beginning of each topic a Weekly Homework Assignment is due.docxikirkton
At the beginning of each topic a Weekly Homework Assignment is due. Each Weekly Homework Assignments must have the following:
a. Articles must be from newspapers or magazines, published within the past 30 days (10-points).
b. Articles are to be related to a topic/concept/terminology found in the chapter to be discussed in class (10-points).
c. Students must clearly indicate the title, author, date, and publisher (10-points).
d. Submissions must be minimum of two single space paragraphs:
1. Paragraph one is a descriptive summary of the article (25-points).
2. Paragraph two details the relationship of the article to a topic/concept/terminology found in the chapter to be discussed in class. This paragraph analyzes content and educates the reader as to the relationship with course content (25-points).
e. Students are to paraphrase the chapter, provide examples, and incorporate additional external sources (10-points).
f. All sources are to be cited on a separate page (10-points)
Date:
Title:
Author:
Publisher:
Use this format in future submissions.
NR361 Information Systems in Healthcare
Telenursing…the Future Is Now Paper
Guidelines and Grading Rubric
Purpose
The purpose of this assignment is to explore the specialty of telenursing as one example of the use of technology in various practice settings. Advantages and disadvantages for the patient and legal and ethical principles for the nurse of this technology will be explored.
Course Outcomes
This assignment enables the student to meet the following course outcomes:
CO #2: Investigate safeguards and decision-making support tools embedded in patient care technologies and information systems to support a safe practice environment for both patients and healthcare workers. (PO #4)
CO #6: Discuss the principles of data integrity, professional ethics, and legal requirements related to data security, regulatory requirements, confidentiality, and client’s right to privacy. (PO #6)
Points
This assignment is worth a total of 200 points.
Due Date
Your completed Telenursing…the Future Is Now paper is due at the end of Week 4. Submit it to the basket in the Dropbox by Sunday at 11:59 p.m. mountain time. Post your questions to the weekly Q & A Forum. Contact your instructor if you need additional assistance. See the Course Policies regarding late assignments. Failure to submit your paper to the Dropbox on time will result in a deduction of points.
Background
Our text (Hebda, 2013) provides us with a broad perspective on telehealth. However, the specialty of telenursing is only briefly discussed. Healthcare is readily embracing any technology to improve patient outcomes, streamline operations, and lower costs. This technology includes the use of various applications based in various environments where registered nurses indirectly provide professional nursing care.
Scenario
The following scenario serves as the basis for your paper:
Manuel, one of your colleagues, is considering leaving his m ...
DHA8013 Management Plan Task WorksheetManagement Plan Tas.docxduketjoy27252
DHA8013: Management Plan Task Worksheet
Management Plan Task Worksheet
List your project activities and related details. An example is given in the first row.
Task or Activity
Person Responsible
Duration
Due Date
Resources Needed
Comments
Approximate Cost
Meet with organizational CEO to obtain permission letter for research project
Researcher
2 hours
July 2012
Description of Research Project
Check address and directions
Travel: $10.00
1
Capella Proprietary and Confidential
Course_File_Template_Landscape.doc
Last updated: 5/29/2015 4:13 PM
Op-Code Operand Description
1 RXY LOAD the register R with the bit pattern found in the
memory cell whose address is XY
2 RXY LOAD the register R with the bit XY
3 RXY STORE the bit pattern found in register R in the memory
cell whose address is XY
4 0RS MOVE the bit pattern found in register R to register S
5 RST ADD the bit patterns in registers S and T as though they
were two’s complement representations and leave the
result in register R
6 RST ADD the bit patterns in registers S and T as though they
represented values in floating-point notation and leave the
result in register R
7 RST OR the bit pattern in registers S and T and place the result
in register R
8 RST AND the bit patterns in register S and T and place the
result in register R
9 RST Exclusive OR the bit patterns in registers S and T and
place the result in register R
A R0X ROTATE the bit pattern in register R one bit to the right X
times. Each time place the bit that started at the low-order
end at the high-order end.
B RXY JUMP to the instruction located in the memory cell at
address XY if the bit pattern in register R is equal to the bit
pattern in register number 0. Otherwise, continue with the
normal sequence of execution.
C 000 HALT execution
SCIENTIFIC MERIT REVIEW FORM
SCIENTIFIC MERIT REVIEW FORMSchool of Public Service Leadership
Scientific Merit Process
Dissertation researchers will use this form to go through the process of scientific merit review (SMR). The goals of this process are to:
(1) Facilitate the planning of the details of your dissertation research project.
(2) Allow for scientific merit review.
(3) Facilitate your progress through the dissertation.
This is not an addition to your dissertation but rather a step to assist you in obtaining mentor, committee, school, and IRB approval more efficiently. You must obtain scientific merit approval before writing your full dissertation proposal. Scientific merit approval is part of Dissertation Milestone 3, Mentor Approval. Scientific Merit Criteria
The following criteria will be used to establish scientific merit. The purpose of the review will determine if the study:
· Advances the scientific knowledge base.
· Makes a contribution to research theory.
· Meets certain “Hallmarks” of good research methodolog.
Question 1The Uniform Commercial Code incorporates some of the s.docxmakdul
Question 1
The Uniform Commercial Code incorporates some of the same elements as the Statute of Frauds. Under the Statute of Frauds, certain contracts must be in writing to be enforceable. Research the types of contracts that must be in writing under the Statute of Frauds.
Do you agree with the contracts that need to be in writing and explain why or why not? Imagine that you were asked to be part of a team to draft revisions to the Statute of Frauds. What changes or proposals would you make? Why?
Respond to this… The Statute of Frauds requires that certain types of contracts be in writing to be able to be enforced. These types of contracts include goods that are priced at $500 or more, interest in land, promises to pay off debt, and contracts that cannot be performed within one year, all of which have been signed by the defendant to be enforceable. I do think that all of these contracts should be in writing because it is a type of safeguard of the resource to ensure that each party is responsible for whatever the contract is regarding. For example, if we did not have to sign for a car loan, the responsible party that needs to pay the loan back could walk away, and without a signature of agreement to the terms of the loan, it would be hard for the company to fight for their money, as there is no signature enforcing the agreement.
If I had to revise something with the Statute of Frauds, I would change the contacts that cannot be performed within one year. I think one year is a long time to let a contract slide. I feel that six months sounds more reasonable. I guess if I was a business and I did not get commitment to a contract for a whole year, I feel this would greatly affect my business. I also think it might be a harder fight to get whatever the other party is responsible for as it was a year ago. As a business, I think I would want to pursue a breach of contract in three or four months even. That is a long time to not pay up.
Question 2
Let’s assume that you are interested in doing a statistical survey and you use confidence intervals for your conclusion. Describe a possible scenario and indicate what the population is, and what measure of the population you would try to estimate (proportion or mean) by using a sample.
· What is your estimate of the population size?
· What sample size will you use?
· How will you gather information for your sample?
· What confidence percentage will you use?
Let’s assume that you have completed the survey and now state your results using a confidence interval statement. You can make up the numbers based on a reasonable result.
Respond to this… had found a study in Australia and New Zealand where they wanted to see if there was efficient care when dealing with people that suffered from acute coronary syndrome, that required an understanding of the sources of variation in their care. Basically, they wanted to see if the people that did not speak English well were receiving the same amount of care a ...
GE 3000 – Introduction Section (Research Problem Statement)Int.docxshericehewat
GE 3000 – Introduction Section (Research Problem Statement)
Introduction: Formulating a Research Problem is the first and most important step of the research process. While the main portion of your work for this semester is focused on the Literature Review, the introduction to the research paper - The Research Problem Statement – is an important step in setting up the research problem to be investigated.
The Research Problem Statement comes before the Literature Review and acts as an introduction in a full-length research paper. The Research Problem Statement should be about 250-350 words in length, or about a page to a page-and-a-half when double-spaced. You must cite a minimum of two references (two scholarly sources) in proper MLA or APA format.
The main questions a Research Problem answers are:
· What will be researched? Identify a specific problem, program, or phenomenon
· Who will be researched? Who is the study population (people)?
Questions you should ask yourself when composing the Research Problem:
(Note that these questions are not necessarily going to be explicitly answered question-by-question in the Research Problem Statement. Rather, these are things that you should be thinking about and able to answer for yourself before you begin constructing the document).
· Who is the study population? How can you further refine the study population?
· What exactly do you want to understand about the topic/problem?
· Is the Research Problem too broad?
· How relevant is the research to your study area/discipline/major/interests?
· What motivates you to do the research on the chosen topic/problem?
· Why should others be interested in your chosen topic/problem?
· What are the concepts and issues to be studied?
· What concepts and measurements have to be further defined before the study begins?
· Do you have enough time to complete the research?
· Is an answer to the Research Problem obvious?
Constructing a Research Problem
A Research Problem typically consists of three parts: 1) the ideal, 2) the reality, and 3) the consequences.
1. Part A- the ideal: Describes a desired goal or ideal situation; explains how things should be.
2. Part B - the reality: Describes a condition that prevents the goal, state, or value in Part A from being achieved or realized at this time; explains how the current situation falls short of the goal or ideal.
3. Part C - the consequences: Identifies the way you propose to improve the current situation and move it closer to the goal or ideal.
Steps to Writing a Research Problem:
Step 1 (statement 1): Construct statement 1 by describing a goal or desired state of a given situation, phenomenon etc. This will build the ideal situation (what should be, what is expected, desired). How should things be in your topic? What is the ideal scenario?
Step 2 (statement 2): Describe a condition that prevents the goal, state, or value discussed in step 1 from being achieved or realized at the present time. This will build ...
#35537 Topic Course Project Part 3—Translating Evidence Into Pra.docxAASTHA76
#35537 Topic: Course Project: Part 3—Translating Evidence Into Practice. Continuation of the assignment attached
Number of Pages: 3 (Double Spaced)
Number of sources: 3
Writing Style: APA
Type of document: Coursework
Academic Level:Master
Category: Nursing
VIP Support: N/A
Language Style: English (U.S.)
Order Instructions: Attached
In Part 3 of the Course Project, you consider how the evidence you gathered during Part 2 can be translated into nursing practice.
Now that you have located available research on your PICOT question, you will examine what the research indicates about nursing practices. Connecting research evidence and findings to actual decisions and tasks that nurses complete in their daily practice is essentially what evidence-based practice is all about. This final component of the Course Project asks you to translate the evidence and data from your literature review into authentic practices that can be adopted to improve health care outcomes. In addition, you will also consider possible methods and strategies for disseminating evidence-based practices to your colleagues and to the broader health care field.
To prepare:
Consider Parts 1 and 2 of your Course Project. How does the research address your PICOT question?
With your PICOT question in mind, identify at least one nursing practice that is supported by the evidence in two or more of the articles from your literature review. Consider what the evidence indicates about how this practice contributes to better outcomes.
Explore possible consequences of failing to adopt the evidence-based practice that you identified.
Consider how you would disseminate information about this evidence-based practice throughout your organization or practice setting. How would you communicate the importance of the practice?
To complete:
In a 3- to 4-page paper:
Restate your PICOT question and its significance to nursing practice.
Summarize the findings from the articles you selected for your literature review. Describe at least one nursing practice that is supported by the evidence in the articles. Justify your response with specific references to at least 2 of the articles.
Explain how the evidence-based practice that you identified contributes to better outcomes. In addition, identify potential negative outcomes that could result from failing to use the evidence-based practice.
Outline the strategy for disseminating the evidence-based practice that you identified throughout your practice setting. Explain how you would communicate the importance of the practice to your colleagues. Describe how you would move from disseminating the information to implementing the evidence-based practice within your organization. How would you address concerns and opposition to the change in practice?It should be combined with the other two components of the Course Project and turned in as your Portfolio Assignment for this course.
IMPORTANT
Reminder: The School of Nursing requires th.
ASSIGNMENT 2 - Research Proposal Weighting 30 tow.docxsherni1
ASSIGNMENT 2 - Research Proposal
Weighting: 30% towards final grade
Word limit: 3000 (-/+10%) – text only, excluding tables, appendices, references,
covers page, contents.
This is an individual piece of work
Apply the requirements of the Harvard Referencing System throughout the
report.
Use the structure appearing below:
Research Proposal Specifics
You are about to commence a new research project in a field of your choice.
You are expected to write a report that constitutes a research proposal.
1. Working individually, you will:
- Have chosen a clear and specific research question/ aim/ hypothesis for your research;
- Have contextualised your research question/ aim within the academic literature;
- Understand the philosophical and methodological bases for your research;
- Have a sound method to address the research question/ aim/ hypothesis.
2. Use Harvard style in-text citation and referencing.
3. Do not copy any materials you use word for word unless you identify these sections clearly as
quotations.
4. If you paraphrase any materials, you must identify sources through in-text referencing.
5. This is an individual assignment please do not work closely with anyone else.
6. Write 3000 words (+ or – 10%) excluding the header sheet, cover page, contents page, reference
list, footnotes and appendices.
Marks for criteria: Criteria
10% Focus and Completion Does the proposal
address the set tasks in a meaningful
manner?
20% Research Objective Does the proposal
clearly articulate
20% Synthesis and Soundness Does the
proposal place the research objective in
the context of the relevant academic
literature and any relevant past studies?
Does the discussion demonstrate a
comprehensive understanding of that
literature?
30% Research Methods and Methodology Does
the proposal sensibly outline methods for
accessing sources of data that will address
or answer the research objective? Is the
method consistent with the methodology?
10% Clarity of Approach Is the proposal well
organised, logically constructed and
attentive to the needs of the reader? Does
the timeline include an Gantt chart or key
milestones for research?
10% Mechanical Soundness Is the portfolio
clearly written, spell
Structuring the research proposal
1. Introduction (~200 words)
Explain the issue you are examining and why it is significant.
Describe the general area to be studied
Explain why this area is important to the general area under study (e.g., psychology of
language, second language acquisition, teaching methods)
2. Background/Review of the Literature (~1000 words)
A description of what has already known about this area and short discussion of why the background
studies are not sufficient.
Summarise what is already known about the field. Include a summary of the basic
background information on the topic gleaned from your literature re ...
The Outsiders Essay Questions And AnswersAshley Mason
The Outsiders Study Guide Answers. Essay the Outsiders-Eng. The Outsiders (Papers and Projects) | PDF | Essays | Paragraph. Outsiders, Chapter Short Answer Question Sets, S.E. Hinton's The .... Year 9 English The Outsiders Essay Guide C.McDonnell Essay Questions .... The Outsiders essay. The Outsiders Essay | English - Year 11 SACE | Thinkswap.
5/25/2020 Rubric Detail – 31228.202030
https://ucumberlands.blackboard.com/webapps/rubric/do/course/gradeRubric?mode=grid&isPopup=true&rubricCount=1&prefix=_843783_1&course_i… 1/4
Rubric Detail
A rubric lists grading criteria that instructors use to evaluate student work. Your instructor linked a rubric to this item
and made it available to you. Select Grid View or List View to change the rubric's layout.
Show Descriptions Show Feedback
Name: ITS836 (8 Week) Research Paper Rubric
Description: Please use this rubric for grading research papers
Exit
Grid View List View
No requirements are met
Includes a few of the required components as speci�ed in the assignment.
Includes some of the required components as speci�ed in the assignment.
Includes most of the required components as speci�ed in the assignment.
Includes all of the required components as speci�ed in the assignment.
Requirements
--
No Evidence 0 (0.00%) points
Limited Evidence 3 (3.00%) points
Below Expectations 7 (7.00%) points
Approaches Expectations 11 (11.00%) points
Meets Expectations 15 (15.00%) points
Fails to provide enough content to show a demonstration of knowledge
Major errors or omissions in demonstration of knowledge.
Some signi�cant but not major errors or omissions in demonstration of knowledge.
A few errors or omissions in demonstration of knowledge.
Demonstrates strong or adequate knowledge of the materials; correctly represents knowledge
from the readings and sources.
Content
--
No Evidence 0 (0.00%) points
Limited Evidence 3 (3.00%) points
Below Expectations 7 (7.00%) points
Approaches Expectations 11 (11.00%) points
Meets Expectations 15 (15.00%) points
5/25/2020 Rubric Detail – 31228.202030
https://ucumberlands.blackboard.com/webapps/rubric/do/course/gradeRubric?mode=grid&isPopup=true&rubricCount=1&prefix=_843783_1&course_i… 2/4
g
Fails to provide a critical thinking analysis and interpretation
Major errors or omissions in analysis and interpretation.
Some signi�cant but not major errors or omissions in analysis and interpretation.
A few errors or omissions in analysis and interpretation.
Provides a strong critical analysis and interpretation of the information given.
Critical Analysis
--
No Evidence 0 (0.00%) points
Limited Evidence 5 (5.00%) points
Below Expectations 10 (10.00%) points
Approaches Expectations 15 (15.00%) points
Meets Expectations 20 (20.00%) points
Fails to demonstrate problem solving.
Major errors or omissions in problem solving.
Some signi�cant but not major errors or omissions in problem solving.
A few errors or omissions in problem solving.
Demonstrates strong or adequate thought and insight in problem solving.
Problem Solving
--
No Evidence 0 (0.00%) points
Limited Evidence 5 (5.00%) points
Below Expectations 10 (10.00%) points
Approaches Expectations 15 (15.00%) points
Meets Expectations 20 (20.00%) points
Source or example selection and integration of knowledge.
1- After Each question, write down references2- 300 minimum wo.docxcroftsshanon
1- After Each question, write down references
2- 300 minimum words for each question, you can go up to 700 words.
3- 2-3 references for each question
4- References should be within 5 years
5- I am in acute care nurse practitioner program.
Chamberlain College of Nursing NR449 Evidence-Based Practice
NR449 RUA Topic Search Strategy.docx Revised 07/25/16 1
Required Uniform Assignment: Topic Search Strategy
PURPOSE
The Topic Search Strategy Paper is the first of three related assignments which are due in Unit 3. The purpose of
this initial paper is to briefly describe your search strategies when identifying two articles that pertain to an
evidence-based practice topic of interest.
COURSE OUTCOMES
This assignment enables the student to meet the following course outcomes.
CO 1: Examine the sources of knowledge that contribute to professional nursing practice. (PO #7)
CO 2: Apply research principles to the interpretation of the content of published research studies. (POs #4 and
#8)
DUE DATE
Refer to the course calendar for due date. The college’s Late Assignment policy applies to this activity.
POINTS POSSIBLE
This assignment is worth 160 points. The college’s Late Assignment policy applies to this activity.
REQUIREMENTS
You will be assigned a group in unit 2 (located in the team collaboration tab) to formulate an evidence-based
practice topic of interest that will be used to complete the unit 3 and unit 5 independent assignments, as well as
the group PowerPoint presentation in unit 7.
The paper will include the following.
a. Clinical Question
a. Describe problem
b. Significance of problem in terms of outcomes or statistics
c. Your PICOT question in support of the group topic
d. Purpose of your paper
b. Levels of Evidence
a. Type of question asked
b. Best evidence found to answer question
c. Search Strategy
a. Search terms
b. Databases used (you may use Google Scholar in addition to the library databases; start with
the Library)
c. Refinement decisions made
d. Identification of two most relevant articles
d. Format
a. Correct grammar and spelling
b. Use of headings for each section
c. Use of APA format (sixth edition)
d. Page length: three to four pages
PREPARING THE PAPER
1. Please make sure you do not duplicate articles within your group.
2. Paper should include a title page and a reference page.
Chamberlain College of Nursing NR449 Evidence-Based Practice
NR449 RUA Topic Search Strategy.docx Revised 07/25/16 2
DIRECTIONS AND ASSIGNMENT CRITERIA
Assignment
Criteria
Points % Description
Clinical Question 45 28 1. Problem is described. What is the focus of your group’s work?
2. Significance of the problem is described. What health
outcomes result from your problem? Or what statistics
document this is a problem? You may find support on
websites for government or professional organizations.
3. What is your PICOT question?
4. Purpose o.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
More Related Content
Similar to CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
· Assignment List
· Week 7 - Philosophical Essay
Week 7 - Philosophical Essay
DUE: Mar 22, 2020 11:55 PM
Grade Details
Grade
N/A
Gradebook Comments
None
Assignment Details
Open Date
Feb 3, 2020 12:05 AM
Graded?
Yes
Points Possible
100.0
Resubmissions Allowed?
No
Attachments checked for originality?
Yes
Top of Form
Assignment Instructions
Objective: Students will write a Philosophical Essay for week 7 based on the course concepts.
Course Objectives: 2, 3, & 4
Task:
This 4 - 5 full page (not to exceed 6 pages) Philosophical Essay you will be writing due Week 7 is designed to be a thoughtful, reflective work. The 4 - 5 full pages does not include a cover page or a works cited page. It will be your premier writing assignment focused on the integration and assessment relating to the course concepts. Your paper should be written based on the outline you submitted during week 4 combined with your additional thoughts and instructor feedback. You will use at least three scholarly/reliable resources with matching in-text citations and a Works Cited page. All essays are double spaced, 12 New Times Roman font, paper title, along with all paragraphs indented five spaces.
Details:
You will pick one of the following topics only to do your paper on:
· According to Socrates, must one heed popular opinion about moral matters? Does Socrates accept the fairness of the laws under which he was tried and convicted? Would Socrates have been wrong to escape?
· Consider the following philosophical puzzle: “If a tree falls in the forest and there's no one around to hear it, does it make a sound?” (1) How is this philosophical puzzle an epistemological problem? And (2) how would John Locke answer it?
· Evaluate the movie, The Matrix, in terms of the philosophical issues raised with (1) skepticism and (2) the mind-body problem. Explain how the movie raises questions similar to those found in Plato’s and Descartes’ philosophy. Do not give a plot summary of the movie – focus on the philosophical issues raised in the movie as they relate to Plato and Descartes.
· Socrates asks Euthyphro, “Are morally good acts willed by God because they are morally good, or are they morally good because they are willed by God?” (1) How does this question relate to the Divine Command Theory of morality? (2) What are the philosophical implications associated with each option here?
· Explain (1) the process by which Descartes uses skepticism to refute skepticism, and (2) what first principle does this lead him to? (3) Explain why this project was important for Descartes to accomplish.
Your paper will be written at a college level with an introduction, body paragraphs, a conclusion, along with in-text citations/Works Cited page in MLA formatting. Students will follow MLA format as the sole citation and formatting style used in written assignments submitted as part of coursework to the Humanities Department. Remember - any resource that is listed on the Works Cited page must .
· Assignment List
· Week 7 - Philosophical Essay
Week 7 - Philosophical Essay
DUE: Mar 22, 2020 11:55 PM
Grade Details
Grade
N/A
Gradebook Comments
None
Assignment Details
Open Date
Feb 3, 2020 12:05 AM
Graded?
Yes
Points Possible
100.0
Resubmissions Allowed?
No
Attachments checked for originality?
Yes
Top of Form
Assignment Instructions
Objective: Students will write a Philosophical Essay for week 7 based on the course concepts.
Course Objectives: 2, 3, & 4
Task:
This 4 - 5 full page (not to exceed 6 pages) Philosophical Essay you will be writing due Week 7 is designed to be a thoughtful, reflective work. The 4 - 5 full pages does not include a cover page or a works cited page. It will be your premier writing assignment focused on the integration and assessment relating to the course concepts. Your paper should be written based on the outline you submitted during week 4 combined with your additional thoughts and instructor feedback. You will use at least three scholarly/reliable resources with matching in-text citations and a Works Cited page. All essays are double spaced, 12 New Times Roman font, paper title, along with all paragraphs indented five spaces.
Details:
You will pick one of the following topics only to do your paper on:
· According to Socrates, must one heed popular opinion about moral matters? Does Socrates accept the fairness of the laws under which he was tried and convicted? Would Socrates have been wrong to escape?
· Consider the following philosophical puzzle: “If a tree falls in the forest and there's no one around to hear it, does it make a sound?” (1) How is this philosophical puzzle an epistemological problem? And (2) how would John Locke answer it?
· Evaluate the movie, The Matrix, in terms of the philosophical issues raised with (1) skepticism and (2) the mind-body problem. Explain how the movie raises questions similar to those found in Plato’s and Descartes’ philosophy. Do not give a plot summary of the movie – focus on the philosophical issues raised in the movie as they relate to Plato and Descartes.
· Socrates asks Euthyphro, “Are morally good acts willed by God because they are morally good, or are they morally good because they are willed by God?” (1) How does this question relate to the Divine Command Theory of morality? (2) What are the philosophical implications associated with each option here?
· Explain (1) the process by which Descartes uses skepticism to refute skepticism, and (2) what first principle does this lead him to? (3) Explain why this project was important for Descartes to accomplish.
Your paper will be written at a college level with an introduction, body paragraphs, a conclusion, along with in-text citations/Works Cited page in MLA formatting. Students will follow MLA format as the sole citation and formatting style used in written assignments submitted as part of coursework to the Humanities Department. Remember - any resource that is listed on the Works Cited page must ...
MSc Managerial Psychology
Assessment Brief
SECTION 1
Assessment Point 1
Module Title: Project and Research Management
Module Code: UU-PSY705 ZM
Essay Title: A written research proposal for the research to be carried out in the
dissertation stage
Word Limit: 3500 words
Assessment Point No: 1 (1 out of 1) 100% of final module mark
Online Submission: Date and Time: See your module schedule.
Learning outcomes assessed:
1. Demonstrate an advanced understanding of the key principles of research
design regarding a particular project as well as an appreciation of the various
research strategies.
2. Critically evaluate sources of information and/or argument in relation to
research objectives.
3. Demonstrate effective skills in the communication of research findings.
4. Apply project management tools, processes and techniques.
5. As appropriate to specific student needs, students will develop an advanced
understanding in at least one of the following areas:
6.A range of research methods for data collection;
7.Data management and analysis, and awareness of issues affecting
data interpretation;
Important Guidelines:
1. Title
The title should be clear and specific, but not too detailed. For example, assume
we had done an experiment in which we had examined whether or not having
breakfast affected people’s ability to concentrate later in the day.
A good title would be ‘The effects of breakfast on mid-morning concentration
levels’.
Avoid using titles that are:
• Too vague
• Very detailed
The American Psychological Association suggests the title to be about 10-
12 words long.
2. Introduction and Literature Review
Introduction
This section is very important. In order to get the reader engaged with your
work you need make sure that you set the scene for the whole essay in a clear
way. Clarify the topic and the aim of the essay. Keep in mind that the reader
might not be familiar with your topic, and hence you should provide
explanations for all relevant terms and a brief overview of the structure of the
essay. Avoid lengthy discussions or explanations regarding definitions or
relevant research findings. Such discussions should be incorporated be part of
your literature review.
Basically, this section introduces the reader to the topic:
Give an introduction to the area of
Provide a rationale for the study using previous studies
Show how the current study fits in with existing literature
Literature Review
Literature review will be focused around your chosen topic -should summarize
and discuss the most recent and most relevant research findings related to the
current research project.
This part should highlight the research gap
The review provides the background of the problem
Critical evaluation is essential
Stat.
Running head ABBREVIATED TITLE OF YOUR PAPER1ABBREVIATED TITLE.docxtoddr4
Running head: ABBREVIATED TITLE OF YOUR PAPER 1
ABBREVIATED TITLE OF YOUR PAPER 13Full Title of Your PaperLearner’s Full Name (no credentials)Capella UniversityAbstract
It is necessary to complete the abstract after the entire project has been developed. The abstract contains an abbreviated overview of the entire project. This overview will reference the following elements of the project:
The Research Question_________________________________
The Research Problem: _____________________________________
The Significance of the Study: _______________________________
Theory or theories that apply to the concepts associated with the RQ: ________________
A Narrative describing the quantitative approach planned, implications for stakeholders, significance to the scientific community, and a description of expected results. The abstract is one concise paragraph.
Keywords: [Add keywords here.]
Table of Contents
CHAPTER 1. INTRODUCTION 1
Background of the Problem 1
Statement of the Problem 1
Purpose of the Study 1
Significance of the Study 1
Research Questions 1
Definition of Terms 1
Research Design 1
CHAPTER 2. LITERATURE REVIEW 1
Theoretical Orientation for the Study 1
Review of the Literature 1
Synthesis of the Research Findings 1
Critique of Previous Research Methods 1
CHAPTER 3. METHODOLOGY 1
Purpose of the Study 1
Research Question and Hypotheses 1
Research Design 1
Target Population and Sample 1
Procedures 1
Ethical Considerations 1
CHAPTER 4. EXPECTED FINDINGS/RESULTS 1
CHAPTER 5. DISCUSSION 1
Implications 1
Methodological Strengths and Weaknesses 1
Suggestions for Future Research 1
CHAPTER 1. INTRODUCTION
[Note, the Final draft of Chapter 1 is typically written after the entire project has been completed and just prior to the Abstract. It is important to understand that the project is iterative. You will work on, change and refine all elements of the project. In your initial submission, begin to provide an evidence-based rationale for each of the sections listed below.]
Background of the Problem
Statement of the Problem
Purpose of the Study
Significance of the Study
Research Questions
Definition of Terms
Research Design
[Note, under the Research Design, make mention of the relevant APA Code of Ethics, but not how you intend to address them. How you will address the codes and ensure they are adhered to will be covered in Chapter 3.]
CHAPTER 2. LITERATURE REVIEW
Note, this is typically the entry point for beginning the project. It is important to understand that the project is iterative. You will work on, change and refine all elements of the project. You will begin by understanding and synthesizing what is known so far in the Literature Review, (Chapter 2). Theoretical Orientation for the Study
The Literature Review provides detailed information about theory that applies to the research topic, theory that applies to the research method, population(s) studied and key concepts under review. Seminal and current sources are analyzed and eva.
At the beginning of each topic a Weekly Homework Assignment is due.docxikirkton
At the beginning of each topic a Weekly Homework Assignment is due. Each Weekly Homework Assignments must have the following:
a. Articles must be from newspapers or magazines, published within the past 30 days (10-points).
b. Articles are to be related to a topic/concept/terminology found in the chapter to be discussed in class (10-points).
c. Students must clearly indicate the title, author, date, and publisher (10-points).
d. Submissions must be minimum of two single space paragraphs:
1. Paragraph one is a descriptive summary of the article (25-points).
2. Paragraph two details the relationship of the article to a topic/concept/terminology found in the chapter to be discussed in class. This paragraph analyzes content and educates the reader as to the relationship with course content (25-points).
e. Students are to paraphrase the chapter, provide examples, and incorporate additional external sources (10-points).
f. All sources are to be cited on a separate page (10-points)
Date:
Title:
Author:
Publisher:
Use this format in future submissions.
NR361 Information Systems in Healthcare
Telenursing…the Future Is Now Paper
Guidelines and Grading Rubric
Purpose
The purpose of this assignment is to explore the specialty of telenursing as one example of the use of technology in various practice settings. Advantages and disadvantages for the patient and legal and ethical principles for the nurse of this technology will be explored.
Course Outcomes
This assignment enables the student to meet the following course outcomes:
CO #2: Investigate safeguards and decision-making support tools embedded in patient care technologies and information systems to support a safe practice environment for both patients and healthcare workers. (PO #4)
CO #6: Discuss the principles of data integrity, professional ethics, and legal requirements related to data security, regulatory requirements, confidentiality, and client’s right to privacy. (PO #6)
Points
This assignment is worth a total of 200 points.
Due Date
Your completed Telenursing…the Future Is Now paper is due at the end of Week 4. Submit it to the basket in the Dropbox by Sunday at 11:59 p.m. mountain time. Post your questions to the weekly Q & A Forum. Contact your instructor if you need additional assistance. See the Course Policies regarding late assignments. Failure to submit your paper to the Dropbox on time will result in a deduction of points.
Background
Our text (Hebda, 2013) provides us with a broad perspective on telehealth. However, the specialty of telenursing is only briefly discussed. Healthcare is readily embracing any technology to improve patient outcomes, streamline operations, and lower costs. This technology includes the use of various applications based in various environments where registered nurses indirectly provide professional nursing care.
Scenario
The following scenario serves as the basis for your paper:
Manuel, one of your colleagues, is considering leaving his m ...
DHA8013 Management Plan Task WorksheetManagement Plan Tas.docxduketjoy27252
DHA8013: Management Plan Task Worksheet
Management Plan Task Worksheet
List your project activities and related details. An example is given in the first row.
Task or Activity
Person Responsible
Duration
Due Date
Resources Needed
Comments
Approximate Cost
Meet with organizational CEO to obtain permission letter for research project
Researcher
2 hours
July 2012
Description of Research Project
Check address and directions
Travel: $10.00
1
Capella Proprietary and Confidential
Course_File_Template_Landscape.doc
Last updated: 5/29/2015 4:13 PM
Op-Code Operand Description
1 RXY LOAD the register R with the bit pattern found in the
memory cell whose address is XY
2 RXY LOAD the register R with the bit XY
3 RXY STORE the bit pattern found in register R in the memory
cell whose address is XY
4 0RS MOVE the bit pattern found in register R to register S
5 RST ADD the bit patterns in registers S and T as though they
were two’s complement representations and leave the
result in register R
6 RST ADD the bit patterns in registers S and T as though they
represented values in floating-point notation and leave the
result in register R
7 RST OR the bit pattern in registers S and T and place the result
in register R
8 RST AND the bit patterns in register S and T and place the
result in register R
9 RST Exclusive OR the bit patterns in registers S and T and
place the result in register R
A R0X ROTATE the bit pattern in register R one bit to the right X
times. Each time place the bit that started at the low-order
end at the high-order end.
B RXY JUMP to the instruction located in the memory cell at
address XY if the bit pattern in register R is equal to the bit
pattern in register number 0. Otherwise, continue with the
normal sequence of execution.
C 000 HALT execution
SCIENTIFIC MERIT REVIEW FORM
SCIENTIFIC MERIT REVIEW FORMSchool of Public Service Leadership
Scientific Merit Process
Dissertation researchers will use this form to go through the process of scientific merit review (SMR). The goals of this process are to:
(1) Facilitate the planning of the details of your dissertation research project.
(2) Allow for scientific merit review.
(3) Facilitate your progress through the dissertation.
This is not an addition to your dissertation but rather a step to assist you in obtaining mentor, committee, school, and IRB approval more efficiently. You must obtain scientific merit approval before writing your full dissertation proposal. Scientific merit approval is part of Dissertation Milestone 3, Mentor Approval. Scientific Merit Criteria
The following criteria will be used to establish scientific merit. The purpose of the review will determine if the study:
· Advances the scientific knowledge base.
· Makes a contribution to research theory.
· Meets certain “Hallmarks” of good research methodolog.
Question 1The Uniform Commercial Code incorporates some of the s.docxmakdul
Question 1
The Uniform Commercial Code incorporates some of the same elements as the Statute of Frauds. Under the Statute of Frauds, certain contracts must be in writing to be enforceable. Research the types of contracts that must be in writing under the Statute of Frauds.
Do you agree with the contracts that need to be in writing and explain why or why not? Imagine that you were asked to be part of a team to draft revisions to the Statute of Frauds. What changes or proposals would you make? Why?
Respond to this… The Statute of Frauds requires that certain types of contracts be in writing to be able to be enforced. These types of contracts include goods that are priced at $500 or more, interest in land, promises to pay off debt, and contracts that cannot be performed within one year, all of which have been signed by the defendant to be enforceable. I do think that all of these contracts should be in writing because it is a type of safeguard of the resource to ensure that each party is responsible for whatever the contract is regarding. For example, if we did not have to sign for a car loan, the responsible party that needs to pay the loan back could walk away, and without a signature of agreement to the terms of the loan, it would be hard for the company to fight for their money, as there is no signature enforcing the agreement.
If I had to revise something with the Statute of Frauds, I would change the contacts that cannot be performed within one year. I think one year is a long time to let a contract slide. I feel that six months sounds more reasonable. I guess if I was a business and I did not get commitment to a contract for a whole year, I feel this would greatly affect my business. I also think it might be a harder fight to get whatever the other party is responsible for as it was a year ago. As a business, I think I would want to pursue a breach of contract in three or four months even. That is a long time to not pay up.
Question 2
Let’s assume that you are interested in doing a statistical survey and you use confidence intervals for your conclusion. Describe a possible scenario and indicate what the population is, and what measure of the population you would try to estimate (proportion or mean) by using a sample.
· What is your estimate of the population size?
· What sample size will you use?
· How will you gather information for your sample?
· What confidence percentage will you use?
Let’s assume that you have completed the survey and now state your results using a confidence interval statement. You can make up the numbers based on a reasonable result.
Respond to this… had found a study in Australia and New Zealand where they wanted to see if there was efficient care when dealing with people that suffered from acute coronary syndrome, that required an understanding of the sources of variation in their care. Basically, they wanted to see if the people that did not speak English well were receiving the same amount of care a ...
GE 3000 – Introduction Section (Research Problem Statement)Int.docxshericehewat
GE 3000 – Introduction Section (Research Problem Statement)
Introduction: Formulating a Research Problem is the first and most important step of the research process. While the main portion of your work for this semester is focused on the Literature Review, the introduction to the research paper - The Research Problem Statement – is an important step in setting up the research problem to be investigated.
The Research Problem Statement comes before the Literature Review and acts as an introduction in a full-length research paper. The Research Problem Statement should be about 250-350 words in length, or about a page to a page-and-a-half when double-spaced. You must cite a minimum of two references (two scholarly sources) in proper MLA or APA format.
The main questions a Research Problem answers are:
· What will be researched? Identify a specific problem, program, or phenomenon
· Who will be researched? Who is the study population (people)?
Questions you should ask yourself when composing the Research Problem:
(Note that these questions are not necessarily going to be explicitly answered question-by-question in the Research Problem Statement. Rather, these are things that you should be thinking about and able to answer for yourself before you begin constructing the document).
· Who is the study population? How can you further refine the study population?
· What exactly do you want to understand about the topic/problem?
· Is the Research Problem too broad?
· How relevant is the research to your study area/discipline/major/interests?
· What motivates you to do the research on the chosen topic/problem?
· Why should others be interested in your chosen topic/problem?
· What are the concepts and issues to be studied?
· What concepts and measurements have to be further defined before the study begins?
· Do you have enough time to complete the research?
· Is an answer to the Research Problem obvious?
Constructing a Research Problem
A Research Problem typically consists of three parts: 1) the ideal, 2) the reality, and 3) the consequences.
1. Part A- the ideal: Describes a desired goal or ideal situation; explains how things should be.
2. Part B - the reality: Describes a condition that prevents the goal, state, or value in Part A from being achieved or realized at this time; explains how the current situation falls short of the goal or ideal.
3. Part C - the consequences: Identifies the way you propose to improve the current situation and move it closer to the goal or ideal.
Steps to Writing a Research Problem:
Step 1 (statement 1): Construct statement 1 by describing a goal or desired state of a given situation, phenomenon etc. This will build the ideal situation (what should be, what is expected, desired). How should things be in your topic? What is the ideal scenario?
Step 2 (statement 2): Describe a condition that prevents the goal, state, or value discussed in step 1 from being achieved or realized at the present time. This will build ...
#35537 Topic Course Project Part 3—Translating Evidence Into Pra.docxAASTHA76
#35537 Topic: Course Project: Part 3—Translating Evidence Into Practice. Continuation of the assignment attached
Number of Pages: 3 (Double Spaced)
Number of sources: 3
Writing Style: APA
Type of document: Coursework
Academic Level:Master
Category: Nursing
VIP Support: N/A
Language Style: English (U.S.)
Order Instructions: Attached
In Part 3 of the Course Project, you consider how the evidence you gathered during Part 2 can be translated into nursing practice.
Now that you have located available research on your PICOT question, you will examine what the research indicates about nursing practices. Connecting research evidence and findings to actual decisions and tasks that nurses complete in their daily practice is essentially what evidence-based practice is all about. This final component of the Course Project asks you to translate the evidence and data from your literature review into authentic practices that can be adopted to improve health care outcomes. In addition, you will also consider possible methods and strategies for disseminating evidence-based practices to your colleagues and to the broader health care field.
To prepare:
Consider Parts 1 and 2 of your Course Project. How does the research address your PICOT question?
With your PICOT question in mind, identify at least one nursing practice that is supported by the evidence in two or more of the articles from your literature review. Consider what the evidence indicates about how this practice contributes to better outcomes.
Explore possible consequences of failing to adopt the evidence-based practice that you identified.
Consider how you would disseminate information about this evidence-based practice throughout your organization or practice setting. How would you communicate the importance of the practice?
To complete:
In a 3- to 4-page paper:
Restate your PICOT question and its significance to nursing practice.
Summarize the findings from the articles you selected for your literature review. Describe at least one nursing practice that is supported by the evidence in the articles. Justify your response with specific references to at least 2 of the articles.
Explain how the evidence-based practice that you identified contributes to better outcomes. In addition, identify potential negative outcomes that could result from failing to use the evidence-based practice.
Outline the strategy for disseminating the evidence-based practice that you identified throughout your practice setting. Explain how you would communicate the importance of the practice to your colleagues. Describe how you would move from disseminating the information to implementing the evidence-based practice within your organization. How would you address concerns and opposition to the change in practice?It should be combined with the other two components of the Course Project and turned in as your Portfolio Assignment for this course.
IMPORTANT
Reminder: The School of Nursing requires th.
ASSIGNMENT 2 - Research Proposal Weighting 30 tow.docxsherni1
ASSIGNMENT 2 - Research Proposal
Weighting: 30% towards final grade
Word limit: 3000 (-/+10%) – text only, excluding tables, appendices, references,
covers page, contents.
This is an individual piece of work
Apply the requirements of the Harvard Referencing System throughout the
report.
Use the structure appearing below:
Research Proposal Specifics
You are about to commence a new research project in a field of your choice.
You are expected to write a report that constitutes a research proposal.
1. Working individually, you will:
- Have chosen a clear and specific research question/ aim/ hypothesis for your research;
- Have contextualised your research question/ aim within the academic literature;
- Understand the philosophical and methodological bases for your research;
- Have a sound method to address the research question/ aim/ hypothesis.
2. Use Harvard style in-text citation and referencing.
3. Do not copy any materials you use word for word unless you identify these sections clearly as
quotations.
4. If you paraphrase any materials, you must identify sources through in-text referencing.
5. This is an individual assignment please do not work closely with anyone else.
6. Write 3000 words (+ or – 10%) excluding the header sheet, cover page, contents page, reference
list, footnotes and appendices.
Marks for criteria: Criteria
10% Focus and Completion Does the proposal
address the set tasks in a meaningful
manner?
20% Research Objective Does the proposal
clearly articulate
20% Synthesis and Soundness Does the
proposal place the research objective in
the context of the relevant academic
literature and any relevant past studies?
Does the discussion demonstrate a
comprehensive understanding of that
literature?
30% Research Methods and Methodology Does
the proposal sensibly outline methods for
accessing sources of data that will address
or answer the research objective? Is the
method consistent with the methodology?
10% Clarity of Approach Is the proposal well
organised, logically constructed and
attentive to the needs of the reader? Does
the timeline include an Gantt chart or key
milestones for research?
10% Mechanical Soundness Is the portfolio
clearly written, spell
Structuring the research proposal
1. Introduction (~200 words)
Explain the issue you are examining and why it is significant.
Describe the general area to be studied
Explain why this area is important to the general area under study (e.g., psychology of
language, second language acquisition, teaching methods)
2. Background/Review of the Literature (~1000 words)
A description of what has already known about this area and short discussion of why the background
studies are not sufficient.
Summarise what is already known about the field. Include a summary of the basic
background information on the topic gleaned from your literature re ...
The Outsiders Essay Questions And AnswersAshley Mason
The Outsiders Study Guide Answers. Essay the Outsiders-Eng. The Outsiders (Papers and Projects) | PDF | Essays | Paragraph. Outsiders, Chapter Short Answer Question Sets, S.E. Hinton's The .... Year 9 English The Outsiders Essay Guide C.McDonnell Essay Questions .... The Outsiders essay. The Outsiders Essay | English - Year 11 SACE | Thinkswap.
5/25/2020 Rubric Detail – 31228.202030
https://ucumberlands.blackboard.com/webapps/rubric/do/course/gradeRubric?mode=grid&isPopup=true&rubricCount=1&prefix=_843783_1&course_i… 1/4
Rubric Detail
A rubric lists grading criteria that instructors use to evaluate student work. Your instructor linked a rubric to this item
and made it available to you. Select Grid View or List View to change the rubric's layout.
Show Descriptions Show Feedback
Name: ITS836 (8 Week) Research Paper Rubric
Description: Please use this rubric for grading research papers
Exit
Grid View List View
No requirements are met
Includes a few of the required components as speci�ed in the assignment.
Includes some of the required components as speci�ed in the assignment.
Includes most of the required components as speci�ed in the assignment.
Includes all of the required components as speci�ed in the assignment.
Requirements
--
No Evidence 0 (0.00%) points
Limited Evidence 3 (3.00%) points
Below Expectations 7 (7.00%) points
Approaches Expectations 11 (11.00%) points
Meets Expectations 15 (15.00%) points
Fails to provide enough content to show a demonstration of knowledge
Major errors or omissions in demonstration of knowledge.
Some signi�cant but not major errors or omissions in demonstration of knowledge.
A few errors or omissions in demonstration of knowledge.
Demonstrates strong or adequate knowledge of the materials; correctly represents knowledge
from the readings and sources.
Content
--
No Evidence 0 (0.00%) points
Limited Evidence 3 (3.00%) points
Below Expectations 7 (7.00%) points
Approaches Expectations 11 (11.00%) points
Meets Expectations 15 (15.00%) points
5/25/2020 Rubric Detail – 31228.202030
https://ucumberlands.blackboard.com/webapps/rubric/do/course/gradeRubric?mode=grid&isPopup=true&rubricCount=1&prefix=_843783_1&course_i… 2/4
g
Fails to provide a critical thinking analysis and interpretation
Major errors or omissions in analysis and interpretation.
Some signi�cant but not major errors or omissions in analysis and interpretation.
A few errors or omissions in analysis and interpretation.
Provides a strong critical analysis and interpretation of the information given.
Critical Analysis
--
No Evidence 0 (0.00%) points
Limited Evidence 5 (5.00%) points
Below Expectations 10 (10.00%) points
Approaches Expectations 15 (15.00%) points
Meets Expectations 20 (20.00%) points
Fails to demonstrate problem solving.
Major errors or omissions in problem solving.
Some signi�cant but not major errors or omissions in problem solving.
A few errors or omissions in problem solving.
Demonstrates strong or adequate thought and insight in problem solving.
Problem Solving
--
No Evidence 0 (0.00%) points
Limited Evidence 5 (5.00%) points
Below Expectations 10 (10.00%) points
Approaches Expectations 15 (15.00%) points
Meets Expectations 20 (20.00%) points
Source or example selection and integration of knowledge.
1- After Each question, write down references2- 300 minimum wo.docxcroftsshanon
1- After Each question, write down references
2- 300 minimum words for each question, you can go up to 700 words.
3- 2-3 references for each question
4- References should be within 5 years
5- I am in acute care nurse practitioner program.
Chamberlain College of Nursing NR449 Evidence-Based Practice
NR449 RUA Topic Search Strategy.docx Revised 07/25/16 1
Required Uniform Assignment: Topic Search Strategy
PURPOSE
The Topic Search Strategy Paper is the first of three related assignments which are due in Unit 3. The purpose of
this initial paper is to briefly describe your search strategies when identifying two articles that pertain to an
evidence-based practice topic of interest.
COURSE OUTCOMES
This assignment enables the student to meet the following course outcomes.
CO 1: Examine the sources of knowledge that contribute to professional nursing practice. (PO #7)
CO 2: Apply research principles to the interpretation of the content of published research studies. (POs #4 and
#8)
DUE DATE
Refer to the course calendar for due date. The college’s Late Assignment policy applies to this activity.
POINTS POSSIBLE
This assignment is worth 160 points. The college’s Late Assignment policy applies to this activity.
REQUIREMENTS
You will be assigned a group in unit 2 (located in the team collaboration tab) to formulate an evidence-based
practice topic of interest that will be used to complete the unit 3 and unit 5 independent assignments, as well as
the group PowerPoint presentation in unit 7.
The paper will include the following.
a. Clinical Question
a. Describe problem
b. Significance of problem in terms of outcomes or statistics
c. Your PICOT question in support of the group topic
d. Purpose of your paper
b. Levels of Evidence
a. Type of question asked
b. Best evidence found to answer question
c. Search Strategy
a. Search terms
b. Databases used (you may use Google Scholar in addition to the library databases; start with
the Library)
c. Refinement decisions made
d. Identification of two most relevant articles
d. Format
a. Correct grammar and spelling
b. Use of headings for each section
c. Use of APA format (sixth edition)
d. Page length: three to four pages
PREPARING THE PAPER
1. Please make sure you do not duplicate articles within your group.
2. Paper should include a title page and a reference page.
Chamberlain College of Nursing NR449 Evidence-Based Practice
NR449 RUA Topic Search Strategy.docx Revised 07/25/16 2
DIRECTIONS AND ASSIGNMENT CRITERIA
Assignment
Criteria
Points % Description
Clinical Question 45 28 1. Problem is described. What is the focus of your group’s work?
2. Significance of the problem is described. What health
outcomes result from your problem? Or what statistics
document this is a problem? You may find support on
websites for government or professional organizations.
3. What is your PICOT question?
4. Purpose o.
Similar to CSCI 561Research Paper Topic Proposal and Outline Instructions.docx (16)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Cryptography Keys
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
1. CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might
be to review the various subject areas covered in the course
readings (i.e., search the bibliographies of the textbooks).
Although the chosen topic must relate directly to the general
subject area of this course, you are not limited to the concepts,
techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet)
overview of the research topics of your paper – you will need to
address these in the actual paper. This will be titled “Research
Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend
your research to ask and hopefully answer. These must be
questions that will require you to draw conclusions from your
research. These must not be questions to answer your research
objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic
journal or other peer reviewed source. These should match APA
formatting of sources.
Example formats for Topic Outlines (an example, not a
template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration
including the major advantages and disadvantages of this
approach.
· Discuss the traditional approaches of top-down and bottom-up
integration and their major advantages and disadvantages.
2. · Discuss the traditional approach of mixed integration,
combining the desirable advantages from the top-down and
bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software
development process?
2. Why has big-bang integration not survived as a useful testing
method?
3. Why have top-down and bottom-up integration not been
replaced by more modern methods?
4. Why would you use mixed integration all the time rather than
sometimes using top-down and bottom-up integration
exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information
security behaviors in the best organizations: Role of penalties,
pressures, and potential effectiveness. Descision Support
Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to
Building Dependable Distributed Systems (2nd ed.). Cambridge,
MA: Wiley.
During your research, if any substantial changes to your
objective(s) are necessary, or a topic change is required,
communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due
by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is
due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
3. Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJECT
2
QUANTITATIVE REASONING 2 PROJECT
2
Quantitative Reasoning 2 Project
I choose the topic of Predicting Total U.S. correctional
population in 2018. The down sizing of U.S. jails and prisons
should affect these numbers. I am interested to see as more
crimes receive a lesser sentence, in to which only requires a
probationary sentence, how it should increase the numbers of
adults supervised by the correctional system. I firmly predict
that the number for people supervised by U.S. adult correctional
system will increase for 2018. Probation and Parole are closely
similar for those who end up on the wrong side of the law.
Probation is used for lighter sentences, or first-time non-federal
offenders to maintain a certain lifestyle to stay out of trouble.
Parole is for serious offenders that have served their time in
prison and must also maintain a certain lifestyle under the
correctional system. I hope to discover in my analysis of the
incline of persons supervised by the U.S. adult correctional
systems in 2018.
4. Topic 1 - Health & NursingHealth Services and Nursing
ScenarioTopic 1Predicting Expected Medicare PayersScenario
1Review data of the expected payers that used Medicare
between 2003 and 2014. Predict the percentage of expected
payers that will use Medicare in 2018.YearCountyZip
CodeMedicare
payers2003Humbolt90001356122004Humbolt90001374122005H
umbolt90001398412006Humbolt90001401232007Humbolt90001
431222008Humbolt90001441252009Humbolt90001512292010H
umbolt90001597482011Humbolt90001570082012Humbolt90001
567272013Humbolt90001579852014Humbolt9000163123
Topic 2 - Criminal JusticeSecurity and Criminal Justice
ScenarioTopic 2Predicting Total U.S. correctional
populationScenario 2Review the data on persons supervised by
U.S. adult correctional systems by correctional status. Predict
the number of the United States population that will be
supervised by U.S. adult correctional system in 2018.YearTotal
U.S. correctional
populationProbationParole20006,467,8003,839,400725,5002001
6,584,9003,934,500731,10020026,730,9003,995,000753,100200
36,886,8004,073,800773,50020046,997,0004,140,400775,90020
057,055,6004,162,300784,40020067,199,7004,236,800798,2002
0077,339,6004,293,000826,10020087,313,6004,270,100828,200
20097,235,2004,196,200824,10020107,086,5004,053,600840,70
020116,989,2003,969,400854,60020126,945,1003,940,800857,8
0020136,903,2003,910,600855,20020146,851,0003,864,100856,
900
Topic 3 - Hum. & SciencesHumanities and Sciences
ScenarioTopic 3Predicted College Tuition and FeesScenario
3Review college data of the yearly tuition and fees. Predict the
cost of yearly tuition and fees in 2018.YearYearly TuitionBooks
& SuppliesLiving CostsYearly Tuition and
Fees2015$29,450$1,250$12,400$44,1902014$24,444$1,038$10,
5. 292$36,6792013$20,288$861$8,542$30,4422012$17,245$732$7
,261$25,8762011$16,412$625$6,532$24,1122010$15,984$600$
5,899$22,9842009$8,618$1,200$15,682$25,7702008$7,153$996
$13,016$21,3892007$5,937$827$10,803$17,7532006$14,658$7
03$9,183$24,7022005$13,549$699$5,771$20,1422004$12,435$
612$5,256$18,415
Topic 4 - Social SciencesSocial Sciences ScenarioTopic
4Predicting Teen Communication PreferencesScenario 4 Review
the data on communication preferences with teens. Predict how
many high school teens will prefer to use face-to-face
communication in 2018.YearCommunication
PreferenceAgeSchool LevelNumber of Teens 2000Face to
FaceTeenHS872001Face to FaceTeenHS982002Face to
FaceTeenHS862003Face to FaceTeenHS762004Face to
FaceTeenHS552005Face to FaceTeenHS492006Face to
FaceTeenHS502007Face to FaceTeenHS432008Face to
FaceTeenHS422009Face to FaceTeenHS362010Face to
FaceTeenHS232011Face to FaceTeenHS302012Face to
FaceTeenHS152013Face to FaceTeenHS132014Face to
FaceTeenHS82015Face to FaceTeenHS5
Logarithmic Regression
Number of Teens
2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011
2012 2013 2014 2015 87 98 86 76 55 49 50 43
42 36 23 30 15 13 8 5
Year
Number of Teens
Topic 5 - BusinessBusiness ScenarioTopic 5Predicting Tires
PurchasedScenario 5Review the yearly data involving tires
6. purchased at a tire shop with declining business. Predict how
many tires will need to be in stock to have available for the
customers in 2018.YearTires PurchasedWheels
PurchasedLugnuts
Purchased199620,47820,01828,592199715,47818,2749,9671998
11,14813,08611,148199917,91614,65914,659200013,3909,6978,
080200116,14625,69818,425200218,45632,23715,132200312,57
021,4049,173200416,24314,9937,184200515,62818,3469,85220
0618,06314,1936,99920077,1223,0523,71320086,6493,7403,586
20099,2174,7483,99420106,2353,6622,733201116,54212,4268,1
45201212,4598,74311,40520139,3225,2436,03320148,7044,687
4,49120159,9044,6615,028
Topic 6 - EducationEducation ScenarioTopic 6Predicting SAT
Test ScoresScenario 6Review the data on the average SAT
scores of college-bound seniors between 2002 and 2015.
Predict the average SAT scores of college-bound seniors in
2018.Average SAT Mathematics of college-bound
seniorsYear2002200320042005200620072008200920102011201
2201320142015All students
Average540529530522531523525530525520519516518514Whit
e530531533534531536536534537536536535536534Black42642
6427426427431429429426426428427428429Mexican
American460458457457458463465466463463467466465464Pue
rto
Rican566451451453452457456454453450452452452453Other
Hispanic467465464464465469463463461461462462461461Asia
n/Pacific
Islander565566569575577580578578581587591595595597Ame
rican Indian/Alaska
Native481479483482488493494494491493492488489486
CSCI 561 Research Paper Outline Rubric
50 Points
Criteria
Levels of Achievement
7. Content
Advanced
Proficient
Developing
Not present
Student creates an overview of their intended topic with at least
3-4 bullets that provides satisfactory depth to support the paper.
(12 pts)
12 to 11 points*
Student creates 4 bullets that are distinct but relevant to the
overall topic they wish to discuss and that when all four points
are added together, a clear understanding of scope is achieved
10 points*
Student creates 3 bullets that are distinct and conceivably
relevant to the overall topic they wish to discuss. When all three
points are added together, student offers a unique enough aspect
of the topic to address it with some depth.
9 to 1 points*
Student creates some number of bullets or list of key topic to
discuss in their paper. Overall message may be unclear or
indirect so that their purpose for the paper may be somewhat
unclear.
0 points
Student did not provide any list or reference of topics or the
purpose of the paper is too unclear to allow paper to be written.
Topic suggested by student is relevant to class material (3 pts)
3 points*
Topic is relevant to our course material and fits the genre (1st
paper is policy-focused, second is technology-focused)
2 points*
Topic is somewhat relevant to our course material and fits the
genre (1st paper is policy-focused, second is technology-
focused)
1 points*
Topic is only partially relevant to course material or does not fit
into the proper genre for the paper (Perhaps paper is too
8. technical for a policy paper or too policy focused for a
technology paper)
0 points
No topic was present, or topic is not remotely relevant to the
genre and focus of the paper.
Student provides 3-4 questions that will add depth to the
paper’s conclusion
(10 pts)
10 points*
Student lists 4 clear questions that are distinctly different from
their research objectives and that when coupled with the
material will add depth to the Conclusion
9 to 8 points*
Student lists 3 questions that are moderately different from their
research objectives that when coupled with material will add
some depth to the Conclusion
7 to 1 points*
Student lists 1-2 questions that may or may not be different
from the research objectives or will not add much depth to the
Conclusion
0 points
Student does not provide a list of questions, questions are exact
answers of the research objectives or add nothing to the
conclusion.
Student includes at least 3, academically approved sources to
support their paper (10 pts)
10 points*
Student lists 4-5 academically approved sources that are clearly
relevant to the subject of their paper.
9 to 8 points*
Student lists 3 academically approved sources that are
conceivably relevant to the subject of their paper.
7 to 1 points*
Student lists 1-2 sources that may or may not be academically
approved or may not seem to be relevant to the subject of the
9. paper.
0 points
Student lists some of the sources needed or lists sources that are
not academically approved or are irrelevant to the subject of the
paper.
Structure
Advanced
Proficient
Developing
Not present
Outline is formatted as directed by the instructions (10 pts)
10 points*
Student includes the Objectives, Questions, and References
sections with proper APA formatting. Objectives are in a bullet
list, Questions are in a numbered list.
9 to 8 points*
Student includes the Objectives, Questions, and References
section with most APA formatting included. Objectives should
be in a bullet list, Questions should be in a numbered list.
7 to 1 points*
Student includes some of the required sections or includes all
but they are not in proper list formats. APA formatting issues
are notable and reduce ease of readability
0 points
Student does not follow proper formatting items or makes
significant enough formatting errors that the paper is deemed
too difficult to read.
Grammar usage was satisfactory (5 pts)
5 points*
Student uses perfect grammar and spelling for all items.
4 points*
Student makes few grammar and spelling errors that do not
affect readability.
3 to 1 points*
Student makes notable grammar or spelling mistakes that may
or may not affect readability.
10. 0 points
Student makes an excessive number of grammar or spelling
issues that negatively impact readability.
*Please see the Levels of Achievement Points spreadsheet for
standardized point values based off your school/department’s
grading scale.