1. Essay On Globalization And 21St
Century
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid
email address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete
the 10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing
style, attach a sample of your previous work.
3. Step
When seeking assignment writing help fromHelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for
your request, choose one of them based on qualifications, order history,
and feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing
services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully
met.
Essay On Globalization And 21St Century Essay On Globalization And 21St Century
2. Holistic Health Care For Traditional Chinese Medicine
Holistic Health Care From curing Malaria to relieving migraines, and lowing blood pressure
Traditional Chinese Medicine has been widely used around the world for all sorts of ailments.
Their unique and natural treatments are appealing to many but the lack of evidence and horror
stories seem to cast a dark shadow over TMC, making it not nearly as popular in the Western world
as it is in China and the rest of Asia. Although Traditional Chinese Medicinehas been ridiculed for
years for their unconventional ways of healing, scientific studies and personal accounts demonstrate
the minds deep connection to the body opening up an alternative yet valid form of medicine.
Traditional Chinese Medicine dates back to nearly two thousand five... Show more content on
Helpwriting.net ...
The whole is always present; the yin and yang can only be refined, never abandoned. ( The Web
That Has No Weaver by Ted Kaptchuk pg. 43). Chinese medicine is something Various elements
also help make up the basic beliefs of Chinese medicine. The five elements are wood, water, fire,
metal, and earth. These help healers diagnose, treat, and predict disease and ailments. Qi is another
interesting aspect of Chinese medicine. Qi is a circulating life force that flows through the body to
help maintain health. It is believed that the human is constantly flowing and filled with the energy
of moving particles with bind together to form organs and heal. They use three main diagnostic
techniques which include observation, auscultation, and observation. Western medicine was
introduced into china during the 1800s during the fall of the Qing Dynasty. Chinese practices
became less and less common. Finally during the Communist Era traditional Chinese medicinal
methods became banned and those who practices it would be thrown in jail or killed. Nowadays
Chinese medicine can is still widely practiced but western medicine is preferred by many, simply
due to the lack of proof. Chinese Medicine comes in many different forms including acupuncture,
Tui Na (therapeutic massage), Chinese
... Get more on HelpWriting.net ...
3. The Stock Price Of Cvs
The stock price of CVS increased from $50.53 per share in year 2013 to $96.89 per share in year
2016. The upward trend in the stock price is showing evidence that top management creates
shareholder value. Backing this up with the PEG ratio, which is the Price/Earnings ratio adjusted
for future growth estimation. Investors are always looking for companies with good growth
prospects selling at attractive prices.
Read more: http://www.nasdaq.com/symbol/cvs/peg ratio#ixzz40duIHLPJ
Financial Ratio Analysis
Liquidity:
The current ratio gradually decreased over the last 5 years from 1.56 in 2011 to 1.31 in 2015.
Even though the average current ratio of CVSВґs biggest competitors is 1.21, it is a concerning
factor for CVS. A decreasing current... Show more content on Helpwriting.net ...
A high times interest earned ratio indicates potential lower risk for stockholders.
Efficiency: The asset turnover ratio of CVS has been fairly stable over the last 5 years from 1.66
in 2011 to 1.64 in 2015. However, the direct competitors average 2.72. In general, the higher the
asset turnover ratio, the better the company is performing. It is a concerning factor, that the
competitors are generating more revenues per one dollar of assets.
The inventory turnover is a ratio showing how many times a companyВґs inventory is sold and
replaced over a period. The inventory turnover has been fairly stable over the last 5 years.
Profitability:
The net margin indicates how high the percentage of the profit of a company to its sales is. .....
Marketing
Expanding customer access is an important factor for CVS as well as personalization. The
development of ExtraCare, ExtraCare Beauty Club, and myWeeklyAd was an important twist to
establishing a connection between the customer and CVS for a personalized experience. The
loyalty program, which is called ExtraCare.....
CVS also developed a personalized advertising circular called myWeeklyAds, which is designed to
serve up a personalized version of the sales ad for each customer based on what they have purchased
in the past. These marketing measures monitor customer activity and try to enhance customer
satisfaction, through personalized product offerings and discounts, which is one of CVS
... Get more on HelpWriting.net ...
4. The Pros And Cons Of Hypertension
According to CDC (2016), one out of three American adults suffers from hypertension (HTN).
This accounts for about 75 million or 29% of the adult population in the United States.
Uncontrolled HTN is the leading cause of myocardial infarction, chronic kidney diseases (CKD),
strokes, and hypertensive heart diseases (HHD) (CDC, 2016). According to a report from CDC
(2016), HTN costs 48.6 billion dollars including health care expenditures, medications and
missed days of work. According to the Texas Department of State Health Services (2013), among
26,448,196 residents of Texas, 170.1 death rates related to HHD, 40.1 related to stroke and 15.9
related to CKD consecutively. AHRQ (2013) health expenditure data demonstrates that the
southern region of the United States, which includes Texas, exceeded the average health
expenditure for a hypertensive patient to a cost of $805 per hypertensive person. Two recent peer
review audits of twenty charts at Southmore Medical Clinic revealed that we were practicing with
only a 45% compliance rate with the Joint National Committee (JNC) 8 guideline
recommendations for managing HTN. In Southmore Clinic HTN management protocol is based on
JNC 6 guidelines and HTN parameters are more relaxed due to patients noncompliance and the
physician s laid back attitude. Therefore, the revision of existing protocol and the aggressive
management of HTN is recommended in conjunction with JNC 8 guidelines (see Appendix A for
more details). Available
... Get more on HelpWriting.net ...
5. Essay on The Everlasting Dark Shadow of Romanticism
For many, saying or hearing the word romanticism evokes numerous stereotypical and prejudged
definitions and emotions. The biggest reason this probably happens is because of how closely
romanticism sounds like romance. The similarity of the sounds and spelling of the two words can
lead to some thinking that the two words mean the same thing or are closely related. Although
romanticismand romance do share some similarities in their spelling and pronunciation they
couldn t be more different. In the Merriam Webster Dictionary romance is defined as, a love story
. The Romantic Period was not necessarily a time of true romance and love stories, although love
was written about, but was instead a time of extreme emotion expressed in many... Show more
content on Helpwriting.net ...
Whether Shelley anticipated that her story of reanimation and death turning to life would be her
masterwork is unknown, although it is likely that she never anticipated the kind of response that
her little tale would immediately receive and the impact that it would still have today. Frankenstein
is one of the greatest examples of Romantic writing. One of the biggest traits of Romanticism that
the story possesses is the inclusion of the Byronic hero. Victor Frankenstein s creation is a hideous,
murdering, and vengeful being but the reader can t help being fascinated by the monster and
wanting to see what he will do next. The way that the monster is written can also make the reader
want to root for him in certain parts of the story. The monster is actually an incredibly sympathetic
character. Even though the monster kills everyone that Victor loves and he performs numerous acts
of evil, the reader can still sympathize with the character and understand his motives. Unlike in
most of the film interpretations of Frankenstein and the stereotypical idea of what the monster is,
he is textually very intelligent, calculated, and isn t the slow moving speechless mongoloid that
pop culture has made him out to be. The monster even sorrowfully gives his own type of self eulogy
... Get more on HelpWriting.net ...
6. The League Of Extraordinary Gentlemen
Movies that feature characters adapted from novels often change personality traits in order to suit
the film s plot. The League of Extraordinary Gentlemen is no exception; Mina Harker and the
Invisible Man had drastic changes made to their personality in order to better suit the storyline.
Both of them were given traits that starkly contradict their book personas to create more flawed and
realistic characters.
The Invisible Man by H.G. Wells features Griffin, a scientist who has discovered how to turn
himself and other things invisible. The story follows the undoing of Griffin and his fall into
notoriety. Wilhelmina Mina Harker is the opposite of Griffin. In Draculaby Bram Stoker she is the
dutiful wife to Jonathan Harker, who has ... Show more content on Helpwriting.net ...
This can be attributed to the fact that Rodney Skinner is not the original Invisible Man. Skinner
is a petty thief who stole the formula for invisibility and used it on himself. The biggest
difference between Griffin and Skinner is their response to setbacks. In The Invisible Man
Griffin has a terrible temper. When things don t go his way he lashes out or injures those who try
to stop him. Skinner, on the other hand, has a very calm demeanor. After finding out that the
League had been betrayed he didn t lash out; in fact he took that as an opportunity to prove
himself as useful to the team. This difference is caused by Griffin and Skinner s motivations. At
first Skinner used his invisibility as a way to become a better thief. Despite his primary intentions,
Skinner began to use his invisibility for the greater good. Griffin however, wanted to use
invisibility to gain recognition. It was ironic how he turned himself invisible so people would begin
to notice him.
Griffin s selfish behavior is made clear throughout The Invisible Man, especially towards the end.
Griffin uses a man named Mr. Marvel as a pawn and puts the old man in danger in order to protect
himself. We also find out that his selfish behavior started long before he became invisible. We see
Griffin tell Kemp about how he stole money from his father to further his scientific investigations.
This is opposite to Skinner s self sacrificing behavior in the
... Get more on HelpWriting.net ...
7. The Warfare During The American Civil War
The conduct of warfare during the American Civil War best exemplified one characteristic of the
Western way of war, which without its incorporation could have drastically changed the outcome of
the war and the existence of the United States as we know it. This characteristic demonstrated is
innovation. Innovation as a characteristic of the Western way of war best exemplifies the American
Civil Warbased on the telegraph, the rifled musketand the railroad. Had the Union and United States
government not leveraged the above mentioned technologies the outcome of the war could have
resulted in the division of this country. From the onset of the Civil War the South possessed two
advantages. One was geography and the other was that it did not have to win the war. The
vastness of the United State presented command and control challenges and logistical challenge
for both Union and Confederal forces. This before mentioned challenge played into the
Confederate forces other advantage which was they could simple keep the Union forces to a draw
during the war and thus ensuring their future as an independent country. For the Union forces to
overcome the challenge of geography and to not result in a draw they used innovations such as the
telegraph to communicate orders to Soldiers over vast distances and thus making geography and
the tyranny of distance a less of an advantage for the Confederate forces. The ability for leadership
to convey timely orders to their military
... Get more on HelpWriting.net ...
8. Matching Game Analysis
In addition to helping other groups prepare for the exam, the game we created also covers three
aspects of learning and three principles of memory. Not only does game itself provide pertinent
information (covers all the chapters assigned for the exam and will serve to help jog the memory
of those playing the game), but it also has aspects of learningand memory built into the game itself.
The aspects of learning include: positive reinforcement, negative reinforcement, and observational
learning. Positive reinforcement is the administration of a stimulus to increase the probability of a
behavior s being repeated. Positive reinforcement is usually called reward. Within our matching
game, the positive reinforcement/reward/stimulus would be gaining
... Get more on HelpWriting.net ...
9. Perfume Analysis Of Perfume
Perfume, by Suskind conforms to conventional standards of the horror genre. The author takes
advantage of this conformity by making Grenouille into the typical horror genre killer or monster to
produce a story with a chilling and dark atmosphere. The author effectively uses both
characterization and stylistic features to develop and shape Grenouille s character into such monster.
According to horror conventions a story must have a monster, whether it be a serial killer or
supernatural entity There is usually an element involving death. For example, a murderer, a ghostly
presence. (Crouse 4). Grenouille s character can fit into the former of these two categories as a
murder. Throughout the book he develops into a monster by taking several lives in many
different settings. For instance his first kill involves the remorseless strangulation of a young
girl in Paris She was so frozen with terror at the sight of him that he had plenty of time to put his
hands on her throat...keeping his eyes closed tight as he strangled her...When she laid dead he
laid her on the ground. (suskind 42 43). Notice the description of Grenouille s first murder and the
language the author uses to describe the agony the victim feels compared to the feelings of the
main character. The victim is frozen in terror while Grenouille has plenty of time to put his hand
on her throat. the victim dies she laid dead and the way he handles the body laid her on the ground.
. The amount of detail to
... Get more on HelpWriting.net ...
10. Status of Women Entrepreneurs in India
Status of Women Entrepreneurs in India
Miss Pooja, Lecturer Mr. Surinder Bhatia, Lecturer
SSIMT, Dinanagar SSIMT, Dinanagar
____________________________________________________________
______________________
Executive Summary
One primary objective of this paper is to find out the status of women entrepreneurs in India. In
Hindu scriptures, woman has been described as the embodiment of shakti. But in real life she is
treated as Abla.. This paper includes rationale behind the women entrepreneurship. Another main
objective of this paper was to analyse policies of Indian government for women and also to analyse
that are ... Show more content on Helpwriting.net ...
These women own textile mills, trucking firms, highway and construction firms, beauty parlours,
drycleaning shops, photographic studios and dozens of other businesses.
In India, women entrepreneurs constitute a negligible proportion of the total entrepreneurs. the
typical enterprises are the extension of kitchen activities i.e. the 3 P s: Pickle, Powder, Papped or
traditional cottage industries of basket making etc. in India women have contributed mainly in
household industries due to less technical know how required and little competition from men in
these industries.
In recent survey of business women in Delhi and surrounding areas it was estimated that 40% of
these entrepreneurs have ventured into non traditional areas such as electronics, engineering,
consultancy etc.
The state of Kerla where the literacy among women is highest in India provides a good example of
women entrepreneurship. As on march 1984, there were 782 women s industrial units in Kerla, of
these 592 were Proprietary concerns, 43 partnership concerns, 42 charitable institutions, 3 joint
stock companies and 102 cooperative societies.
According to a research study conducted in Tamil Nadu following are the businesses pursued by
women entrepreneurs:
Nature of Business
|Sr. No |Nature of Business |Percentage |
|1 |Agro engineering
... Get more on HelpWriting.net ...
11. Kelly Thomas Research Paper Outline
Kelly Thomas (April 5, 1974 July 10, 2011) was a homeless man diagnosed with schizophrenia
who lived on the streets of Fullerton, California. He was killed by six members of the Fullerton
Police Department, on July 5, 2011.[2] Thomas was taken to St. Jude Medical Center before
being transferred to the UC Irvine Medical Center, where he was comatose on arrival and not
expected to recover. He never regained consciousness, and died on July 10, 2011.[3][4] Medical
records show that bones in his face were broken and he choked on his own blood.[5] The coroner
concluded that compression of the thorax made it impossible for Thomas to breathe normally and
deprived his brain of oxygen.[6] His parents removed him from life support five days later,
... Get more on HelpWriting.net ...
12. The Judicial Branch of the American Government as a...
The Judicial Branch of the American government has potential to be the best protector of private
property because it is highly insulated from rent seeking. However, its ability to protect can be
compromised where it elects to defer to the legislative branch in making decisions like in cases
where public use and eminent domaintakings are argued. This inclination to defer to the legislatures
hinders the Judicial Branch from reaching its full potential as protector of private propertydue to the
fact that legislatures are not very insulated against rent seeking. To understand the judiciary s role
as a private property protector, we must first understand what private property rights are, the
motivation of the judiciary to protect these rights and the kind of power that the judiciary has at its
disposal to successfully execute this role. To understand why this role maybe be compromised, we
must take a look at the legislative branch and how rent seeking influences the laws that it passes.
Throughout American history, the definition, allocation and protection of property rights has
been one of the most controversial and combative issues. According to Armen and Demsetz
(1973), ...a private property right includes the right to delegate, rent, or sell any portion of the
rights by exchange or gift at whatever price the owner determines (provided someone is willing
to pay that price). If person A is not allowed to buy some rights from Person B and Person B
therefore is not allowed to
... Get more on HelpWriting.net ...
13. Essay On Venture Capital
Venture Capital is a specific term that refers to funding obtained from a venture capitalist. These
are professional serial investors and may be individuals or part of a firm. Often venture
capitalists have a niche based on business type and or size and or stage of growth. They are
likely to see a lot of proposals in front of them (sometimes hundreds a month), be interested in a
few, and invest in even fewer. Around 1 3% of all deals put to a venture capitalist get funded. So,
with the numbers that low, you need to be clearly impressive.
Growth is usually associated with access to, and conservation of cash while maximising profitable
business. People often see venture capital as the magic bullet to fix everything, but it isn t. Owners
... Show more content on Helpwriting.net ...
There are specialists in each area and you ll find different companies with their own criteria.
FF F Family, Friends and Fools. Those closer to the business and often not sophisticated investors.
This type of money can come with more emotional baggage and interference (as opposed to help)
from its providers, but may be the fastest way to access smaller amounts of capital. Often multiple
investors will make up the overall amount needed.
Angel Investors The main business angels vary from venture capitalists in their motives and level
of involvement. Often angels are more involved in the business, providing ongoing mentorship
and advice based on experience in a particular industry. For that reason, matching angels and
owners is critical. There are substantial easily locatable networks of angels. Pitching to them is no
less demanding than to a venture capitalist as they still review hundreds of proposals and accept
only a handful. Often the demands around exit strategies are different for an angel and they are
satisfied with a slightly longer term investment (say 5 7 years compared to 3 4 for a venture
capitalist).
Bootstrapping growing organically through reinvesting profits. No external capital injected.
Banks banks will lend money, but are more concerned about your assets than your business. Expect
to personally guarantee everything.
Leases this may be a way to fund particular purchases that allow for expansion. They will normally
be leases over assets,
... Get more on HelpWriting.net ...
14. Gestalt Therapy Essay
Gestalt Therapy
I. Summary and Integration of Major Concepts
Founded by Frederick (Fritz) and Laura Perls in the 1940 s, Gestalt therapy is a phenomenological
existential methodology which emphasizes experience and experimentation. Gestalt is a German
term that means a complete pattern or configuration (p. 112). Though there are many modalities
and styles in Gestalt therapy, it is holistic in its approach uniting mind, body, and feeling (p. 112).
Some concepts at the core of Gestalt therapy are the organism as a whole , emphasis on the here
and now , and awareness (pp. 223 225). Perls believed that human beings are unified organisms
(p.223) and that mind and body were not separate entities. It was ... Show more content on
Helpwriting.net ...
It is through this increased awareness that the health (or mental health) of the individual is restored.
II. Breakthroughs and Steps in Learning Practicing Client Centered therapy helped me get over
most of my fear and apprehension about performing as therapist and client in front of my
classmates. So, as we (the class) began our first session in Gestalt I initially felt less nervous about
participating, in fact, I volunteered to be the first client in my group during the first
demonstration. Just like client centered therapy, I had again been in a group that was assigned
to Dr. Fiebert and I felt fortunate to have him demonstrate because I knew that I would learn a
great deal given his years of experience. I had learned through the reading and class lecture that
this was a therapy that called for the therapist to be creative in getting the client to express
emotions and feelings. I was anxious to see what creative techniques Dr. Fiebert would employ.
He began the session by asking me what I was aware of and I told him that I was feeling some
tension in my neck and shoulders. He then asked me to describe the tension, rate the level of
tension on a scale of 1 10, increase the tension and relate it to and experience or incident in my life.
I linked to a recent situation I had experienced with my mother, whom he then brought in to the
empty chair to begin the
... Get more on HelpWriting.net ...
15. Handles and Hinges Ltd
Introduction :Handles and Hinges Ltd
H amp;H was established in Birmingham, England, by two young entrepreneurs, Dave Philips and
Chris Agnew, both experienced in the hardware trade. The business specialized in the designer
market for polished metal (brass or stainless steel) door handles, cupboard knobs, furniture fittings
(mostly used in shop/office furniture) and hinges. Their company was successful, was based on H
amp;H s reputation for high quality, unique designs of both traditional and modern products, many
of which were selected and specified by architects for large and prestigious projects such as new
office developments in London s Docklands. Dave, the Chief Executive Officer, with responsibility
for sales, believed that most ... Show more content on Helpwriting.net ...
Batches which fail are either rejected or reworked, and all material where we have identified
any fault at all is returned to the supplier, and our buyers routinely threaten to place orders
elsewhere. I instructed the supervisors to inspect press tooling just before the start of each
production batch to ensure that there are no surface faults, so I think it is unlikely that the dents
and blemishes are caused in production. I must make a point of checking that this is happening.
Anyway, our final inspection sampling has been changed to give an acceptable quality level
(AQL) of 2 per cent whereas until recently it was only 5 per cent. We have had to increase the
number of final inspectors by four at a cost of ВЈ15 000 each per annum, but all the management
team agrees that with quality products we must be confident of the final quality before packing.
We trained some of our best assemblers in SPC and made them full time inspectors; the
combination of their technical and statistical skills ensures that we have the right people for this
job. We could not rely on our operators to do any dimensional checks; hardly any of them know
how to measure using a metric rule, let alone a micrometer or vernier gauge. It is best to keep them
concentrating on achieving correct output targets. I believe that most quality problems here must
be caused by occasional operator carelessness.
The batch
... Get more on HelpWriting.net ...
16. Feminist Perspective In The K-12 Art Education Curriculum
A clearly defined Black feminist perspective cannot be found in the K 12 art education curriculum
at this time. Although several articles from Wanda Knight and Jessie Whitehead have discussed the
importance of including a Black feminist and woman of color perspective, nothing definitive can be
found in the current art education curriculum. Through the use of Charles Mills theory of
revisionist ontology, I will discuss the importance and value of including a Black feminist
perspective in the K 12 art education curriculum.
Overview of K 12 Art Education and the Need A Feminist Perspective in Art
Art education has many facets that are beneficial to art students. In the field of art education,
aesthetics (as in the philosophy of art) attends to the development of critical thinking skills and
philosophical inquiry through classroom dialogue (Ambush, 2008, p.14). In art education, the
student has the opportunity to understand and learn visual aesthetics, cognitive, motor, emotional,
social, and artistic skills to express critical thinking, sensitivity, and cultural identity (SchoГ±au,
2013). In An Exploration of the Issue of Stereotyping in the Artroom, Sheng Kuan Chung (2008)
examines the issue of stereotypes and claims art education offers students the opportunity to
examine prejudiced or unjust social practices that permeate society and to confront such practices
from a critical point of view (p. 24). Analyzing the concept of race and gender stereotypes is critical,
... Get more on HelpWriting.net ...
17. The Effect Of The Judgemental Nature Of Puritans In...
Junior Research Paper Society is made of many different types of people. Some people commit their
lives to the church, others commit their lives to helping others. No matter how different and noble
members of society may appear, they all have something in common: sin. Members of Puritan
society all have this in common, and therefore should be less critical of each other. The effect of the
judgemental nature of Puritans in Nathaniel Hawthornes The Scarlet Letteris demonstrated by
recurring dark and light themes, representing restriction and freedom from judgement. Hawthorne s
use of the archetypal symbols of darkness and light suggests his view that the Puritansociety was
excessively judgemental of their members and that all societies should be less critical. Hawthorne
uses the symbol of darkness to communicate his view of Puritan society and judgement. Hawthorne
applies darkness to the conventional Puritan citizens and to those who do not follow the societal
rules to show the effect that Puritan judgement has. Darkness archetypally represents evil, and
when parallelled with light in The Scarlet Letter also symbolizes restriction. The Puritan society
has in place many restrictions, one of which being strictly against adultery. These restrictions are
enforced by characters such as the town beadle, or officer. When Hester, the protagonist guilty of
adultery is freed from jail, a figure appears with her like a black shadow emerging into sunshine,
the grim and grisly
... Get more on HelpWriting.net ...
18. Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus.
In order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The
results for my DNA was not able to be determined through sequencing. The DNA samples of the
class recorded that 62% of the participants were tasters (carries the allele at the TAS2R38 locus)
and 38% of the participants were non tasters (does not carry the allele at the TAS2R38 locus).
Objective: The objective of the project is to be able to determine which alleles are carried at the
TAS2R38 locus and verify if the genotype reflects the expected phenotype. Methods:... Show more
content on Helpwriting.net ...
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a
flavor and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng
/ВµL (6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/ВµL DNA /100 ВµL H2O). The DNA
sample was divided by 100 ВµL instead of 25 ВµL of H2O because the sample was diluted 4
times. Experiment 3: The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The
reverse primer found is 5 ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work
for my obtained DNA as there was no evidence of movement of the DNA. PCR did work for lab
numbers 33 and 12. The size of my fragment could not be determined and cannot compare to the
size that was expected. The negative control was clean as there was no traces of movements.
Experiment 6: The DNA concentration after TAS2R38 PCR purification and quantification was
0.344 ng/ВµL (34.4 ng/mL). My genotype at the TAS2R38 locus was not determined by the
sequencing. The genotypic frequencies of the class obtained by sequencing: 0.4 (40%) TT, 0.4
(40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class obtained by sequencing: 0.6 (60%) T
and 0.4 (40%)
... Get more on HelpWriting.net ...
19. Agency Nurse Benefits
Reasons Being an Agency Nurse Is More Beneficial
Working as an agency nurse in Australia has advantages over being employed as a regular nurse in
clinics and hospitals. As if nursing in Australia isn t rewarding enough, you can still enjoy more
with this kind of work arrangement.
Nursing agencies provide nurses to people or entities in need of their services, usually on temporary
contracts. Healthcare professionals are seconded to private clients, care homes, and hospitals,
depending on the demand.
Benefits of being an agency nurse
Better control over time and work site
Higher pay, more benefits
Better working environment
Obtain more experience and education
Provide quality patient care
As an agency nurse, you get to choose a flexible ... Show more content on Helpwriting.net ...
Although you can always apply for tax refund, it is best to get all the pay you deserve when it is
paid out to you and not later, as a tax back amount.
What is PAYE?
PAYE or Pay As You Earn is the system of collecting tax or pension within a tax year, which starts
on 6 April of the present year and ends on 5 April the next year.
Three parties are involved in the entire process you, your employer and HMRC. If there are
discrepancies in your tax code or the tax deduction itself, you can complain to either your employer
or HMRC.
The frequency with which tax is deducted depends on how often you will get paid, whether it s
weekly or monthly. Some pensions, however, are only taxed every quarter of a year or once a year.
How does PAYE work?
HMRC will be responsible for calculating your tax code and then providing it to your employer.
When required, the agency will send you a PAYE coding notice that shows how your code
number was worked out. If you didn t receive any, you can ask one from HMRC.
Based on the tax code, your employer will then calculate how much tax will be deducted from
your pay or pension. Whatever deductions made will then be paid over to
... Get more on HelpWriting.net ...
20. Descriptive Essay On An Ethiopian Restaurant
Upon driving into the small neighboring outlet behind the main N. Germantown Pkwy, stood an
African restaurant in bulky, bold letters that read: Ethiopian Restaurant Coffee; each word a
different color of the Ethiopian flag: green, yellow, and red. Standing in front of the empty
restaurant, I was bombarded with several modern advertisements on the clear, see through
windows in the form of stickers promoting their restaurant meant to attract customers such as
Free Wifi Inside , We Deliver , and XFINITY WIFI is here . In addition to the advertisements, the
door held two open signs one electric and one plastic along with the name Nani Hareg in striking
gold and red letters, and upon further research on the restaurant, it represented the name of the
current manager. Reaching for the rectangular door handle, I was instantly greeted with bell
chimes and a African waitress who seated me in chairs covered with white textiles in the center of
the room. Having given me the menu, she had went away to turn on modern pop music and the
lights near the counter. Once seated inside, I scanned the room. The windows were covered with
deep red and white striped curtains neatly tied with a red, yellow, and green patterned cloth in a
elegant fashion. The walls were a deep maroon with a slight orange tint decorated with paintings of
African ancestors and sacred animals, posters of national monuments, and vividly imitated flowers.
Fascinatingly, one wall was left white in the center
... Get more on HelpWriting.net ...
21. The Tortilla Curtain Racist
In the exposition of the T.C Boyle s novel The Tortilla Curtain we are introduced to the characters,
one of the protagonist characters Delaney Mossbacher. Whom is introduced as a liberal humanist
but as the novel progresses he becomes a reactionary racist. This all occurred when CГЎndido and
Delaney first encountered, which in the events to follow their decisions and actions are
impacted by each other s personal worlds. However mainly focusing on Delaney psychological
behavior, he evolved to be a racist towards Mexicans. They are main influences in Delaney s
personal life which gives us an insight on why he gradually evolved to be a racist as the novel
progressed. Closely looking at the very people he hung around with, the following environment...
Show more content on Helpwriting.net ...
Examining his first reaction when he collided with CГЎndido was what the damage done to the car
and the car insurance going up. A person who is said to be liberal humanist, wouldn t have those
initial thoughts. Lacking the empathy in the incident regarding with the car accident. Makes you
wonder, why such a person would have that first thought. Next he admitted to himself, he s ashamed
of not thinking about the human he just hit rather that of the car. At the first moment together,
CГЎndido asked for money which Delany complied by giving him twenty dollars. Now regarding
the fact CГЎndido is undocumented and Mexican, would Delaney gave twenty dollars to a white
person? No. Would he cared for the person more if he ran into a white person? He might have.
Following the accident, when he took his car to the mechanic, he lied saying it was an animal who
dented the car. Right after that, he said he s glad of leaving CГЎndido behind. Subconsciously
Delaney is experiencing racist tendencies, by disregarding another being because of their race, and
not liking them. Looking about his thoughts on illegal campers polluting the rivers and trials, that
infuriates him but narrowing a group of people because they committed that act isn t right. As the
novel progresses, his naturalistic view go over his humanistic view for the sake of keeping the
surrounding environment around him clean. Having a reason to
... Get more on HelpWriting.net ...
22. The Mayan Civilization In Guatemala
The Maya civilization was one of the most dominant indigenous societies of Mesoamerica. The
growth of the great Mayan civilization is as much a mystery as its disappearance. The Maya
Empire, centered in the tropical lowlands of what is now Guatemala, reached the peak of its power
and influence around the sixth century A.D (http://www.history.com/topics/maya#). As a youth
growing up in Belize Central America, I was very much intrigued by the Mayan civilization as we
would regularly take educational field trips to the massive stone temples of Xunantunich and Altun
Ha. Both Mayan ruins were no more than 50 miles away from my childhood home. Most of what
we know about the Maya comes from what remains of their architecture and art, including stone
carvings and inscriptions on their buildings and monuments. The Maya were deeply religious, and
worshiped various gods related to nature, including the gods of the sun, the moon, rain and corn.
BELIEFS AND PRACTICES The Mayan religion was characterized by the worship of nature gods.
Main practices in the Maya included astronomy, divination, human sacrifice, elaborate burial for
royalty and worshipping in stone pyramid temples (http://www.religionfacts.com
/big_religion_chart.htm). Much of what is believed relating to the beliefs and practices of the
Maya result from what archaeologists have uncovered and studied along with historians. In a book
written by a Franciscan Priest named Diego de Landa, he described in some detail the
... Get more on HelpWriting.net ...
23. Market Analysis Of Amidipine
Executive Summary:
Manidipine is a long acting dihydropyridine calcium channel blocker, a subclass of antihypertensive
drugs.
Manidipine competes direct with CCBs especially with Amlodipine Molecule (CCBs Market
Leader).
The total Amlodipine market volume reached 4.4 million strips (10 Tablets) for Amlodipine5 mg
and 1.9 million strips for 10 mg.
Amlodipine is considered a first line of treatment of hypertension, especially in elderly patient,
according to international guidelines.
Manidipine is newly oriented to the market.
Situation Analysis:
Market Overview:
Defined Market
Long acting Calcium Channel Blockers (Mono Molecule).
Sub Market: Amlodipine Antihypertensive (Mono Molecule).
Current Market Trend (5 Years) IMS Data:... Show more content on Helpwriting.net ...
Financial Objectives:
Thousands EGPFY/2013FY/2014FY/2015
Total Brand3,7465,5947,033
Amlodipine 5 mg Tablets2,4744,0045,045
Amlodipine 10 mg Tablets1,2721,5901,988
Target Audience:
Cardiologist
Internist
General Practionner
Positioning Statement:
Amlodipine Tablets (Amriya) offers a 24 hour cardio protection beyond hypertension control for
those patient suffering hypertension with or without other risk factors, Amlodipine offers a high
quality product at an affordable cost and convenient once daily dose.
Main Indications:
Hypertension
Angina
Strategies:
Growth strategy:
Drive growth through market penetration:
24. Expanding prescribing doctor list.
Maintain current lists.
Addition of new pack (3 strips) for Amlodipine 5 mg Tablets.
Working in two dimensions:
Newly diagnosed patients.
Current un controlled patients.
Marketing Mix:
Customer services
Revising calling lists and working on expanding prescribing and loyal doctor list in all regions.
Hammering in physicians in AM centers.
Regular PM visits/
... Get more on HelpWriting.net ...
25. Billy Elliot Stereotypes
The Graceful Man
Since primitive times, men were been considered the primary providers and protectors for their
family (Hinshaw). This role has diminished through the twentieth and twenty first centuries, but the
need to be macho remains in countless men. Makeup, tights, and ballet shoes are rarely considered
masculine. Therefore, a subsequent stereotype has become prevalent. People erroneously believe
all danseurs to be gay, weak, and feminine. Frequently, maledancers are left to feel inadequate and
are discouraged from their art because their manliness is questioned. However, the 2000 film, Billy
Elliot, juxtaposes the stereotype of male ballet dancers with a titular character who defies all
expectations. The man s historical role as provider ... Show more content on Helpwriting.net ...
Furthermore, the Elliot family were not well off by any means; nevertheless, no one would
question the validity of mining as a career as they would ballet. Mining is considered a perfectly
reasonable profession for a man. Still, neither profession acquires a significant income. Still, Billy
s passion makes dancing worth the risk and certainly would fulfill Billy more than boxing (Daldry,
Billy Elliot). The short careers of ballet dancers can cause issues for dancers (Columbus).
Fortunately, ballet dancers have options for their life after they retire from ballet. At that point, they
can settle down and find
... Get more on HelpWriting.net ...
26. Case Study Of Pane Rottura
Takeout s and party trays convenience
2.1 Customers
Customers play a very crucial role in a success of a company, without the customers a business
especially a restaurant business cannot succeed. It is essential for the restaurant to understand the
needs and wants of the customers and provides them with top quality food items so that it provides
them with satisfaction and exceed beyond their expectations. If the customer is completely satisfied
with the food and the service that is being provided by the restaurant then it would to them
becoming loyal to the restaurant and would not switch over to their competitors.
2.2 Partners
Alliances are very crucial for the restaurant, because Pane Rottura is an upcoming Italian restaurant
and having alliances within the industry would help the company to promote its food products to
the market it easily. Therefore Pane Rottura is going to treat its suppliers and its customers along
with their employees as partners (Gitman. McDaniel 2008)
2.3 Suppliers
Pane Rottura needs to have strong supplier links within the industry for their products.Pane Rottura
is going to treat its supplier as partner, and it planning on going in a joint venture with for their
services.
3.0 Target Market Segment
The ... Show more content on Helpwriting.net ...
This shows that the consumers are very much interested in socializing and having a good with
friends in cafes, restaurants or even fast food chains. In this day and age there is an increasing
demand for convenience and time saving and this has led to an increase in the food service
industry. The Oman food hospitality industry is booming, i.e. the demands of the consumers are
changing because it seems that they prefer to eat out, for example, as of 2015, Oman has made
$1.1 billion in its restaurant industry (Saudi Gazette 2015), this shows an increase trend in the sales
of restaurant industry in the Oman
... Get more on HelpWriting.net ...
27. Special Education Workbook Summary
Workbook Summary
TГіnya Harris
Liberty University Introduction: Special Education in the Individualized Education Program
Special education is a form of instruction that serves to help individual students with disabilities in
the classroom, or any other setting that is considered acceptable by the Individualized Education
Program (IEP) team. The process used to determine special education starts when either a teacher
or a parent makes a referral to have an individual student evaluated to determine if there is a
disability. Special education comes at no extra cost to the parents of the student. Gibb and Dyches
(2016), mention how students with disabilities ages 3 to 21 must be granted Free Appropriate
Public Education (FEPA), ... Show more content on Helpwriting.net ...
Gibb and Dyches (2016) state, Academic achievement refers to gaining requisite skills and
knowledge for success in school (p. 47), and functional performance can be defined as applying
knowledge and skills to meet daily needs (p. 47). Reading, writing, and math are academic
achievement skills that are crucial to the students learning because they all are required for other
subjects. In contrary, functional performance involves adaptive skills such as feeding and dressing
oneself, and meeting appropriate school behaviors. Gibb and Dyches (2016) mention that the
PLAAFP statement derives from reviewing the curriculum standards for academic achievement,
determining the students current academic strengths and limitations, and assessing the students
current functional strengths and limitations (p. 48).
Measurable Annual Goals
Measurable annual goals are used to identify what the individual student is expected to achieve
within one year to address what effects the disability has caused. Gibb and Dyches (2016) define
the word measurable as the behavior stated in the goal can be observed and measured to determine
when it has been achieved (p. 60). Therefore, in order to be considered a measurable academic and
functional performance goal the goal must be able to be measured, must meet the individual student
needs that are in relation to the disability and cause problems within the general education
curriculum, and must also meet any other additional
... Get more on HelpWriting.net ...
28. The Exploitation Of The Natural Environment
Despite the fact that efforts were made in the past to entrench the rights of the people, people are
still born into a miserable life with no possibilities of escaping of poverty, while others may inherit
fortunes and financial freedom empires. Inequality, like the gap between the rich and the poor, has
never been as critical as it is a present. Unfortunately, the future does not appear to be bright if the
degrading activities of the natural environment continues(7), the expanding shortage of resources,
overpopulation especially in under developing countries as well as the apathy of the majority of
the world brings even worse issues of poverty.
Many under developed countries are trapped in poverty because of the shortage of raw materials,
being forced to resort to trade in order support themselves, as well as overexploitation of the limited
resources they posses. Unable to implement eco friendly technologies in the production processes
and therefore force to use hazardous and cheap methods of production, which is contributed further
degradation of the environment. For instance, many suffer from poverty live on soil that is not
fertile; as a consequence, they are forced to resort to intensive farming. This practice is damaging to
the environment and furthermore, these people do not have the financial means to improve the
technologies they use in agriculture or basis infrastructure in this aspect. As a result, they can only
produce low and insufficient quantities of food in
... Get more on HelpWriting.net ...
29. Jane Austen s Emma, Madame Chapone s Paradigms Regarding...
What is the ultimate purpose of friendship? What is the desired outcome status, wealth, amusement,
or perhaps, the betterment of morality?
In Jane Austen s Emma, Madame Chapone s paradigms regarding women mentoring young girls are
delineated as a pertinent social guide since both promote the cultivation of inner morality as the
pinnacle of mentorship. Chapone accentuates that qualities and traits are cardinal for the
assessment of prospective mentors; and we see the calamity unfolding between Emma and Harriet
Smith if these criteria are neglected. Austen concurs, and depicts the ideal mentorship through Mr
Knightley and Emma. Chapone, although she recommends an older woman as companion, does
not dismiss the potential intimacy between ... Show more content on Helpwriting.net ...
Emma could not resist. Ah! Ma am but there may be a difficulty. Pardon me but you will be
limited as to number only three at once ; Emma insults Miss Bates, who is a dear friend, in order
to quench her desire for social credit. When Mr Martin s proposal arrives for Harriet, Emma
shakes her head with disdain. Emma has the highest social status, apart from Knightley, and uses
this to diminish those of lower class. Chapone asks us to Observe her manner to servants and
inferiors and whether she treats them always with affability , but we know, Emma does not.
Emma thinks Mr Martin is a very inferior creature and when Harriet asks for advice Emma says
the letter had much better be all your own but sneaks in You need not to be prompted to write the
appearance of sorrow for his disappointment . Harriet refuses Martin, and Emma proclaims that
Harriet, if she accepted, would have been confined to the society of the illiterate and vulgar and
could not have visited Mrs. Robert Martin since she deems the lower class as unsophisticated
primitives. Emma would have lost her latest amusement and her chance to prove her intelligence.
Emma s subtle manipulations illustrates the absence of inner morality, and is thus, an ill qualified
mentor.
A criteria instituted on character is more concrete and practical to determine the legitimacy of a
mentor. A trait, such as good
... Get more on HelpWriting.net ...
30. Don T Go Chasing Waterfalls By TLC
In 1994, a girl group named TLC released a song named Waterfalls. The song served as a
warning, establishing a new character in each verse, and then having them jump into some pretty
serious situations, all of which ended in disaster. The song s message, is then summed up in the
first line of the chorus, which reads, Don t go chasing waterfalls, a metaphor that means not to get
ahead of yourself and start something just because it looks appealing, as the man in the second
verse did when he decided to be unprotected and intimate with a promiscuous women. The message
is both important, and very strongly argued with the given examples, but the metaphor itself, can be
argued based on how you view waterfalls. Many, including TLC, see waterfalls as dangerous....
Show more content on Helpwriting.net ...
In accordance to this argument, it is also important to mention that waterfalls are not permanent, as
they erode themselves away with time. This speaks great volumes when it comes to TLC s
viewpoint, as these dangerous things that the characters they introduce in their song are interested
in, such as the character in the first verse s interest in selling drugs, usually have a short shelf life.
To clarify, with this particular viewpoint of waterfalls, the group, and those that see waterfalls the
same way, are further cementing their point of not chasing after dangerous things, as though they
may be alluring, they usually don t last long, and have terrible endings. A message that is very
helpful, and rightfully should be as widespread as the song s popularity made it. Others, simply
view waterfalls as beautiful, natural occurrences. They are also aware that finding these waterfalls
can be difficult, as naturally occurring ones are usually located on steep
... Get more on HelpWriting.net ...
31. Love In Love, My Love For Basketball
Hello, my name is Tamara, and I m in love with this sport. I m 18 years old, a senior in high
school. I m a sprinter in the 100 200m 400m events. It may not be much, but I just thought I d
share my story and my dreams simply because I enjoy doing so. It all started in eighth grade, I
was 15. I never had any experience with sports whatsoever except for basketball earlier that year,
and honestly had no idea what I was doing. I felt I had no physical ability and had low self
esteem when it came to my athletic ability. I was 4 6 and still managed to get on picked for the
team for basketball, though probably being one of the shortest people in the group. Basketball
has been a sport I ve always liked, and realizing how hard it really was to actually play was a hard
pill for me to swallow. During the period of the season, I spent the time in basketball off season
to practice on what needed to know and what can help me during next season. After the
basketball season ended, our head coach called us all to the gym, and began telling us it was
time for a new sport; Track and Field. she told us it was for the best of the best. We went outside
and got all of our times. Being inexperienced, I was wearing casual high top reeboks that were
extremely heavy. I did well. The next day, my friend encouraged me to try some old shoes she
had, emphasizing how light they were. The time we needed to make to be considered for the team
was 15 seconds on the 100m (keep
... Get more on HelpWriting.net ...
32. What Is Hairspray Made Of
What is hairspray made of?
Hairspray is a solution of long, chainlike molecules (called polymers) in a very volatile solvent.
Spraying deposits a stiff layer of the polymer on your hair after the solvent evaporates.
The solvent used was once a compound of carbon, fluorine, and chlorine (a chlorofluorocarbon, or
CFC). CFCs are nontoxic, nonflammable, and make almost ideal aerosol propellants. But when it
was learned that they causedestruction of stratospheric ozone, they were replaced with other
solvents, like alcohols and hydrocarbons. Unfortunately, these are flammable.
One of the polymers used is polyvinylpyrrolidine, which is also used to glue the layers of wood in
plywood together. An non water soluble polymer called... Show more content on Helpwriting.net ...
Most hairsprays contain a group of ingredients referred to simply as fragrance. Because the
specific ingredients are not listed on the label, it is impossible to accurately assess their safety.
Sponsored Links
Hairspray is a solution of long, chainlike molecules (called polymers) in a very volatile solvent.
Spraying deposits a stiff layer of the polymer on your hair after the solvent evaporates.
The solvent used was once a compound of carbon, fluorine, and chlorine (a chlorofluorocarbon, or
CFC). CFCs are nontoxic, nonflammable, and make almost ideal aerosol propellants. But when it
was learned that they cause destruction of stratospheric ozone, they were replaced with other
solvents, like alcohols and hydrocarbons. Unfortunately, these are flammable.
One of the polymers used is polyvinylpyrrolidine, which is also used to glue the layers of wood in
plywood together. An non water soluble polymer called polydimethylsiloxane is added to make the
hold last a bit longer (the polyvinylpyrrolidine is water soluble).
Other polymers used in plastic based hairsprays are copolymers with vinyl acetate and copolymers
with maleic anhydride .
Some hairsprays use natural polymers and solvents like vegetable gums dissolved in alcohol. One
popular ingredient is gum arabic is made from the sap of certain trees that grow in the Sudan. Gum
tragacanth is another herbal gum that is used to stiffen calico and crepe, as well as hair.
Transcript of
... Get more on HelpWriting.net ...
33. Persecution In The Crucible
From the slave trade to the Salem witch trials, persecution has been part of the foundation of
America since before it was established. The slave trade tore people out of their homes and
forced them to work for someone else s benefit. The witch trials showed the accused as guilty no
matter how they defended themselves. The enslavement of indigenous people in the Indies forced
innocents to give up what was theirs so others could make a profit. While many people came to
America to escape persecution, these events led to America becoming a country based on the
exploitation of others. Equiano and The Crucible s use of hatred and fear towards minority groups
as well as Columbus s use of indigenous people for personal gain emphasize that Americans... Show
more content on Helpwriting.net ...
As soon as Columbus lands in the Indies, he claims the land for Spain. He wrote, There I found
very many islands, filled with people innumerable, and of them all I have taken possession...and
no opposition was offered to me (Columbus 1). He immediately takes possession of everything
despite not knowing exactly where he is. He then renames all of the islands as if they belong to
him. He doesn t care that other people already live there. The letter from de las Casas reveals the
terrible things Columbus and his men did by enslaving the natives. He forced the people living
on the islands to work for him without pay. de las Casas wrote, [The Spaniards] have brought to
the island of Hispaniola and the island of San Juan more than two million souls taken captive,
and have sent them to do hard labor in the mines, labors that caused many of them to die (de las
Casas 6). de las Casas emphasizes that these people were forced to work against their will, and
he notes that many of these people died because of it. Then, like sheep, they are sorted out into
flocks...the ship owners carrying of their share, the best flock, to compensate them for the
moneys they have invested... he wrote (6). He shows that the people were treated and sold like
animals. Columbus and his men used them to make money, forcing them to gather natural
resources that he could sell. de las Casas wrote about one instance of this. Some of the natives
had to dive for pearls, which required them to be underwater for long periods of time. He wrote,
In this harvesting of pearls let us again consider whether the Spaniards preserve the divine
concepts of love for their fellow men, when they place the bodies of the Indians in such mortal
danger... (6). He s calling these men immoral, showing how they don t care about the lives of their
slaves. Columbus wanted more land so he could use its
... Get more on HelpWriting.net ...
34. Yum Brands Financial Statement Analysis
Background Yum Brands Incorporated is the world s largest fast food, or quick service
restaurant (QSR), company in terms of restaurants, which numbered over 37,000 at the end of
2010. It currently operates five restaurant chains, but by the end of 2011, that number will
decrease to three: KFC, Pizza Hut, and Taco Bell. The remaining two chains, A W and Long
John Silver s, will be sold in the 4th quarter of 2011 to companies formed by their franchise
holders. As of November, 2011, Yum is in the process of purchasing a Chinese hot pot chain, Little
Sheep. It has received government approval and is awaiting shareholder approval. Yum started as
the restaurant division of food and beverage giant PepsiCo. In 1997, facing increasing... Show more
content on Helpwriting.net ...
Mexican QSR segment with 52% market share. The pizza QSR segment is a more crowded
market, but Pizza Hut was still the leader with only 14% market share. Long John Silver s easily
led the seafood QSR segment with a 37% market share. A W was the lone exception among the
Yum portfolio, but with only 322 stores it is difficult to gain significant share, and it has been
targeted as a failing brand by many analysts. Yum Brands current strategy can be summed up in
one word, international. The U.S. QSR market is mature and heavily saturated, so instead of
fighting for domestic market share, Yum is primarily focusing on expanding in emerging
markets overseas. The primary market focus is , which has quickly become the top profit
producing segment for Yum Brands, with 26% profit growth in 2010. Outside of , Yum is also
leveraging its franchising model to open hundreds of new stores, 4 per day in 2010, with little
capital investment. One key to Yum s success internationally is adaptation to the local market. In ,
you can enjoy spicy KFC chicken and paneer on your Pizza Hut pizza. In , the KFC menu
includes local dishes such as congee and spicy tofu chicken rice. Pizza Hut has been branded as an
upscale dine in restaurant, offering items as diverse as scallop croquettes and escargot. Restaurants
are also constructed using traditional building designs and restaurant managers are hired locally,
instead of being brought from the as competitors have
... Get more on HelpWriting.net ...
35. The Kathmandu Valley and the Constant Terror of...
The Kathmandu Valley and the Constant Terror of Earthquakes
One important climatic feature that plagues the South Asian region of the Kathmandu Valley is
earthquakes. A few severe earthquakes have taken place in the country s history and caused many
deaths and nearly irreparable damage to impoverished Nepal. The residents of the Kathmandu
Valley experience small tremors nearly every day, whether they can feel them or not. The world
and the nation is waiting for the next big one to terrorize the small country.
The Kingdom of Nepal is a landlocked nation that geographically lies between India and China. The
narrow country also located at the boundary between the Indian and Tibetan tectonic plates and ...
Show more content on Helpwriting.net ...
The earthquake of 1255 was reported to have destroyed many houses and temples, and to have
killed one third to one fourth of the population of the Kathmandu Valley.[11] In 1407, an
earthquake destroyed the famous Machhhendra Nath Temple of Patan. The two strongest
earthquakes in the nationГ•s history were the ones that took place in 1833 and 1934. The
earthquake of 1833 destroyed the Kathmandu Valley and its magnitude was reported to have been
a 7.8 on the Richter scale.[12] The people of Nepal were fortunate however, that it was preceded
by two large foreshocks, and due to the warnings, the casualties were minimal and reported to be
less than 500 people.[13]
The residents of the Kathmandu Valley were not as fortunate in 1934. The Bihlar Nepal Earthquake
is the most devastating in the nationГ•s history. It reached a measurement of 8.0 on the Richter
scale and the rupture length is estimated to be between 100 and 200 kilometers.[14] It produced
strong shaking in the valley, which is the political, economical, and cultural capital of the country.
Of
... Get more on HelpWriting.net ...
36. The Different Ways in Which Unsatisfactory Work and...
The Different Ways in Which Unsatisfactory Work and Behaviour by a Barrister and a Solicitor
Can be Dealt With
If after having dealt with either a solicitor or a barrister you still felt dissatisfied with the way in
which your case has been handled, you can complain about the unsatisfactory work in a number of
ways, depending on the case and who you are unhappy with.
If you are, for example unsatisfied with the way in which a solicitor has handled your case then
you could complain about the services rendered to the Office for the Supervision of Solicitors
(OSS). The OSS has the power to award up to ВЈ5,000 compensation, reduce or abolish the
solicitor s fees and force then to rectify their mistakes ... Show more content on Helpwriting.net ...
Now, as a result of the Access to Justice Act 1999 the Legal Services Ombudsman can order a
solicitor or the Law Society to pay compensation to the client, they can also be sued for negligence
as well as being suspended from practice or struck off by the Solicitors Disciplinary Tribunal.
Under the Access to Justice Act 1999 the Law Society now have greater powers to inspect
solicitors files and accounts if a claim is made against them.
Until recently, barristers could not be sued for negligent work in court as a result of the decision in
Rondel v Worsley (1969) but could be sued for work outside court: Saif Ali v Sydney Mitchell Co
(1978)
Barristers can now be sued for negligence since the decision of the House of Lords in Arthur Hall
Co v Simons (July 2000)
If after you have had dealings with a barrister and felt dissatisfied with their service you could
complain to the Complaints Commissioner, appointed in 1997, to replace internal investigations by
the Bar Council. A Complaints Commissioner can refer complaints to a Complaints Committee
who can then require barristers to reduce, refund or
... Get more on HelpWriting.net ...
37. Young Goodman Brown Essay
The main theme of the Nathaniel Hawthorne s, Young Goodman Brown, is the struggle between
Goodman Brown s faith, power to resist his own evil impulses and his own doubts within him. It
is a story of Young Goodman Brown s personal conflict over his inner desires and its greater
meaning conflict between good and evil in the world. The characteristics of Young Goodman Brown
are similar to the life of Nathaniel Hawthorne. Nathaniel Hawthorne had his own doubts about his
own Puritanlife and beliefs. There are numerous examples in this story whereby Hawthorne clearly
demonstrates to the reader Goodman Brown s personal internal conflict between good and evil.
Hawthorne s knowledge of the historical background of Puritanism combined with the ... Show
more content on Helpwriting.net ...
Upon entering the forest Goodman Brown is suspicious of every rock and tree, thinking something
evil will jump out at him. When he finally does meet someone on the trail, who appears to be of
evil origin, he feels confident that he can refuse any temptations. This evil person makes several
advances and Goodman refuses. At first Goodman feels confident that he can resist any temptation
that the devils throws upon him. Hawthorne describes how closely the devil resembles Goodman.
Hawthorne describes them as though they might have been mistaken for father and son. The devil
resembles him in order to make Goodman feel more comfortable around him. It makes it easier to
tell lies and deceive Young Goodman Brown into coming with him to the witch gathering.
Goodman Brown discusses his self doubt after incidences such as his discovery of the true nature
of his community within the forest. Brown thinks that he recognizes voices of his minister, deacon,
and of his wife, but can t be certain since their figures are not visible. He thinks that everyone in his
community is participating in satanic acts. When he sees this it destroys any faith he might of had
in the community or himself, he appears to give up faith completely. Brown s reluctance to take the
Devil s snake like staff also illustrates his uncertainties and defiance in becoming one of the Devil s
chosen. Even the setting of the winding, long journey through the woods demonstrates indecision
and conflict, as
... Get more on HelpWriting.net ...
38. Cognitive Disabilities
The book discusses the major issues surrounding the advantages and disadvantages of teaching
students with cognitive disabilities in the general education classroom. One of the major issues
addressed is the need and reasoning to why students with cognitive disabilities should be taught in
the general educationclassroom. The other issue addressed is the use of the Universal Learning
Design that allows for adequate adaptions and modifications for students with cognitive and
intellectual disabilities with the intentions to increase educational expectations and access to the
general curriculum. The author believes that all students regardless of severity of disabilitywill gain
some form of knowledge whether it is meaningful social interaction,
... Get more on HelpWriting.net ...
39. Persuasive Essay On Confirmation Bias
You see what you see, you hear what you hear but do you always believe what you see and hear.
Most people do believe everything they see and hear because they only remember what confirms
their own bias. We as people associate with others or certain medias that support the beliefs we
have, and our memories help us remember information that can be used as proof to make what we
believe seem true. The only problem that stands in the way is if the information we are receiving
is true or not. There is where most of us go wrong we don t fact check we just assume. We assumed
pizzagate was true without even considering it. Almost everyone uses confirmation biaswheather
they realize it or not. Confirmation bias is used to show intelligence and boosts self esteem, it is
heavily influenced in the news outlets and social media, and has a huge effect on society today.
Confirmation bias is something that every person is susceptible to, unless you know that you re
doing it. Confirmation bias is our tendency to seek out information that we already believe to be
true. This affects how you interpret information, how you seek information, and also how you
remember things. When you look at the world around you, it is the conformation bias in your head
that is telling you certain things to pay attention to more than others. Your brain tends to seek out
evidence that confirms your beliefs about something. You often do this because you do not want to
be wrong about something and will do anything
... Get more on HelpWriting.net ...
40. The Immediate Causes Of Starvation In African Americans
1. Mehta s purpose was to report how Indians ironically starved without a shortage of food, a
scenario that she compares to starvation in the United States at the end of her writing. She most
directly indicates this purpose in paragraph eight, where she states It must be hard to be hungry
when foodis plentiful. and It must be hard to be hungry, even in the U.S.A. (522).
2. The immediate cause of the starvation was the black marketeers hoarding the food and only
selling it for very high prices. A street food vendor offered three options to its customers: A price
to see the food. A higher price to smell the food. [And, a] third price to eat the food. (Mehta 522).
3. The ultimate cause of the starvation was the villagers giving their entire
... Get more on HelpWriting.net ...
41. What Is The Mood Of The Passionate Shepherd To His Love
The Elizabethan Era author and playwright, Christopher Marlowe, was a romantic writer who
came before his time. Being born hundreds of years before the romantic period around 300 to be
exact, his poem The Passionate Shepherd to His Love, could have and would have fallen
perfectly within the style of the romantic time period. In the poem, the shepherd beckons to his
love, who has not yet accepted his advances. He entices her with promises of lush fields, beds of
roses and the opportunity to dance and sing when she pleases. He uses precise and beautiful words
to lure and persuade the woman of his dreams to live with him and enjoy his bounties. Throughout
the poem he boasts of dressing her in gowns of the finest wool, slippers and belts with... Show more
content on Helpwriting.net ...
For example, imagery is used immensely. Marlowe writes of A belt of straw and ivy buds,
/ With coral clasps and amber studs... (Greenblatt). This type of precise, picturesque imagery
further proves the point this could be a romantic poem, adding to the tone of the full text. To
describe something as beautifully as Marlowe did shows the love the shepherd feels toward the
woman in the poem. Also, alliteration is accomplished as Marlowe articulates ideas on the page.
There are many examples offered in the text, such as: ...mind may move..., ...pleasures prove...,
and ...feed their flocks... (Greenblatt). This device allows the text to be more like a song, letting
the reader s words flow off the tongue in a tantalizing manner. To continue, the poem also
contains consonance. In the line stating That valleys, groves, hills, and fields... the end of the
words in this line almost all end with the s sound (Greenblatt). Just like the use of alliteration, the
device of consonance assists the poem in flowing off the tongue and creating more of a song
than a poem. Additionally, Marlowe uses symbolism; however, it is not used quite as literally as
some other pieces of text. It is common for a rose to symbolise love or many other feelings of
the human heart, so it makes sense for the author to use it in line nine, where it is written, And I
will make thee beds of roses... (Greenblatt). Also, in the fourth stanza, Marlowe could be making
a nudge at innocence when he writes about pretty lambs, and the purest gold. To further the
poem being a lyrical text, there are examples of enjambment that creates even more of a flow to
each line. Come live with me and be my love, / And we will all the pleasures prove / That valleys,
groves, hills, and fields, / Woods, or steepy mountain yields.
... Get more on HelpWriting.net ...
42. Indira Gandhi Research Paper
An online poll showed 81% of people believe Indira Gandhi s assassination was justified. It was a
sunny day in New Delhi, India when the prime minister of India dies. The day was October 31,
1984; she was shot by 2 of her bodyguards named Beant Singh and Satwant Singh. The
assassination of Indira Gandhi was unjustified because she went to war for Indias independence and
wanted to help the environment; however, some people believe she was making unintelligent
decisions for India. Nevertheless, Indira used her power and politics to improve the environment.
She had power and a high position, so she used it. Indira s ministry of Environment and forests
itself is noted in a building called the Indira Rayavana Bahava an energy efficient structure... Show
more content on Helpwriting.net ...
She used her position as Prime minister to help India gain independence. Today is certainly a day
to celebrate the success of our democracy. However, on this occasion, we should also introspect
about what remains to be done (Gandhi
Independence day) While she was the prime minister, she tried her best to make positive
changes in India. She tried to help the environment while fighting alongside others. Indira fought
for India, she took the time to fight for her territory, her people. She used her position as prime
minister to keep India Independent. During her independence day anniversary speech, she said
her people should celebrate this day. While she was the prime minister, she tried her best to
make positive changes in India. Some people believe she was making poor decisions for India.
Indira was not making wicked decisions for India, she was actually being smart and logical. I
once read an article from I am Courage. It said, Indira built upon the foundations laid by
Jawaharlal Nehru to convert India into a growing nuclear power (Nuclear Programme of India.)
Some people believe India was making critical decisions for India, but in reality, she wasn t. The
Nuclear Programme was a very intelligent move on her part and proves my counterclaim wrong,
that she was making faulty decisions for
... Get more on HelpWriting.net ...
43. Gunpowder Plot Analysis
Macbeth is a tragedy written by William Shakespeare that was published in 1623. The
Gunpowder Plot of November 5, 1605 was an attempt to assassinate King James the I of England.
The Gunpowder Plot of 1605 and Shakespeare s Macbeth seem to be unrelated at first, but upon
closer analyzation, the two are closely related. The two are related because of the influence that the
Gunpowder Plothad on the plot of Macbeth. The themes of high treason, conspiracy and execution
are themes from the Gunpowder plot that influenced the plot of Macbeth.
The Gunpowder Plot was a plan to kill King James I of England. Assassinating the King of England
is bad enough, but conspirators did not stop there. The conspirators also wanted to kill the queen,
her first born son, and members of parliament (source: Britannica). The Gunpowder Plot was lead
by Robert Catesby and included four other conspirators. The four other conspirators were Thomas
Winter,Thomas Percy, John Wright, and Guy Fawkes. All of the conspirators were zealous Roman
Catholics angered by James s refusal to grant more religious toleration to Catholics. The
conspirators wanted English Catholics to take over England after the King and his parliament were
out of the picture.
The conspirators of the Gunpowder Plot wanted to (literally) blow up King James and his
parliament members. Conspirators were going to do so by igniting kegs of powder under the room
that parliament was going to meet in with the King. The conspirators rented a cell under where
parliament was to meet. Then, during the summer of 1605 the conspirators smuggled kegs of
gunpowder into the rented room. As the plot progressed more conspirators needed to be recruited.
The additional conspiracy members were: Robert Wintour, Christopher Wright, Francis Tresham,
Everard Digby, Ambrose Rookwood, Thomas Bates, Robert Keyes, Hough Owens, and John Grant
(www.historylearningsite.co.uk).
The day before the kegs of gunpowder were set to be ignited, the plot was discovered. The plot was
discovered, in the official version, through an anonymous letter to Lord Monteagle, a Catholic,
warning him not to attend the State Opening. Whether the letter was genuine or a forgery is
uncertain. In any event, on the 4 November
... Get more on HelpWriting.net ...
44. Macromolecules Essay
Macromolecules rely on their environment for proper folding of their respective three dimensional
structure.10 This makes intuitive sense since the exterior, which is polar, is making contact to a
polar solvent, like the cytoplasm that provide hydrogen bonds, electrostatic interactions, and
conceal the nonpolar residues away from the polar solvent.10 The body has a stable pH and
temperature that proteins take advantage to form amazing functional complexes. They can catalyze
reactions as enzymes, transport compounds, and make complex units to reach a certain goal like
ATP synthase10.They can be dangerous as well, such as binding to receptors on cells for virus
entry4. Proteins lose their conformation when they are out of range in temperature... Show more
content on Helpwriting.net ...
After the addition of water they keep everything intact and functional7. Tardigrades have been
able to adapt these conditions by achieving cryptobiosis. This cryptobiosis is a state where the
tardigrades can reach a standstill in their whole metabolic processes1. The caveat is that water
bears are only capable of surviving such conditions only when they are under this suspended
animation. It is at this state only that release a protein that encapsulates them and is an extreme
fort of defense1. There is a study where this protein is isolated and expressed in E.coli to protect
the enzyme lactate dehydrogenase in dry conditions. When they added to water to the enzyme, it
remained functional7 8. We plan on extracting this microscopic invertebrates protein s, referred
to as bioglass, and applying it to vaccines to preserve the integrity of the vaccines. This will
allow the ability to safely transport vaccines while keeping the vaccines functional; no longer
requiring specific storage and easy, albeit safe handling if our hypotheses are correct. If this
project were to be a success after vigorous testing of keeping these vaccines in stable conditions,
even after being exposed to the abnormal temperature, this can revolutionize the way we handle
vaccines. The cloning and expression of the protein should take no longer than a few weeks or
months by following the protocols
... Get more on HelpWriting.net ...
45. Advantages And Disadvantages Of Test Automation
The perpetual demand for faster time to market high quality products at lower cost, drives
organizations towards test automation. However, only few succeed in reaping the benefits. If test
automation has been there for a long time, then why many organizations fail to implement it
enterprise wide? Though there are enormous benefits in automating test cases, such as reduce cost
and time on manual test execution efforts, safety net over accelerated new development, faster
feedback cycles, error prone consistent testing, and productivity booster within testing teams. There
are some challenges too. The sail is never smooth! When the challenges are not overcome in a
reliable way, most automationprojects tend to fail or discontinued in the middle. Here are the few
main challenges faced by the organizations in general.
1.High initial investment
Automation doesn t pay off right away. It often needs a significant... Show more content on
Helpwriting.net ...
The longer and the more frequent the test cases are executed, the more return is gained. Hence, it is
not advisable to invest in automation when the life of product is short; only fewer releases are
planned; tests are not repetitive in nature.
2.Technical Skills
To work on automation, some programming knowledge is inevitable, also proficiency with the test
tool. It takes time to familiarize with the tool, standards, and guidelines set. With advanced
applications comes custom (application specific) components which might be difficult to be
identified by the tool. In this case, we may have to write our own mechanisms for component
identification and verification, which means building some logic. However, some testers might not
be from a programming background or out of touch with programming. Therefore the learning
curve is often high. Nevertheless, the key is to be open to learn new areas, and to learn one step at a
... Get more on HelpWriting.net ...
46. Genetic Manipulation
It should remain illegal in most cases for genetic manipulation to be used in choosing a baby s
gender. Many parents have a preference for the sex of their baby. This can be for several
reasons: there could be a genetic disorder passed down through a specific sex that parents want
to avoid; the family might already have children of one sex and want to balance out the family.
However, unless the parents have received prior approval, it is currently illegal to genetically
manipulate an embryo, unless there is a legitimate medical reason. An embryo s sex is determined
by a sperm s chromosome: female sperm have an X chromosome, while male sperm have a Y
chromosome. The most common and easiest method to produce a specific sex is called in vitro...
Show more content on Helpwriting.net ...
This would either mean that paying for the service would be extremely expensive, or it would be
included in healthcare. If the cost was to be directly paid for by the family, there would be a
huge gap created between those who could buy the service and those who couldn t afford it.
Wealthy families would be able to get their choice of their child s gender and be able to ensure
that no genetic disorders would be passed down to their child. This is incredibly unfair to
families which can t afford this; having the risk of illnesses while others don t is extremely
unethical. The easiest way to fix this issue would be to have genetic manipulation of embryos
become included for free in health care. This would mean money would be taken from other,
more important areas that money could be used such as education and other health care areas.
Some areas already struggle with funding, so other additions which take more funding, even a
slight amount, are unwelcome. While in some cases genetic manipulations of embryos can be
useful in a medical sense, most possible scenarios would have negative repercussions. The
legalization of all embryo modifications would have some positive effects, such as minimizing the
possibility of genetic disorders, but the upsides don t make up for all the downsides that would
occur. It is for this reason that this modification should only be allowed in specific, medically
approved
... Get more on HelpWriting.net ...
47. Zelda Sayre Biography
Born in St. Paul, Minnesota in 1896
He attended Princeton University
He married Zelda Sayre, who later died in 1949 from a fire
He died in 1940 at age forty four from a heart attack and believing he was a failure
He is considered one of the most important American writers from the twentieth century
He became friends with Gertrude Stein, Ernest Hemingway, and John Dos Passos
This Side of Paradise published in 1920, takes place after WW1
The Curious Case of Benjamin Buttons short story published in 1922, takes place in the jazz age
The Love of the Last Tycoon a novel that went unfinished and was published in 1941 with other
short stories
The Beautiful and Damned Published in 1922, his second novel takes place in the Jazz age
There is a common
... Get more on HelpWriting.net ...
48. Primordial Soup
In 1924, the Soviet biologist Alexander Oparin proposed a theory of the origin of life, Oparin
believed that during chemical evolution of molecules that have carbon in Primordial Soup. The
theory suggests that life began in a body of water, resulting into the combination of chemicals
from the atmosphere and a form of energy to create amino acids which evolved into all of the
species. Chemist Stanley Miller and physicist Harold Urey conducted an experiment in 1950 to test
Oparin s theory. They mixed gases thought to be present on primitive earthsuch as: Methane,
Ammonia, Water, and Hydrogen. They then sparked the mixture to represent the lightning, and
amino acids were produced; the building blocks of proteins.
Iron Sulfur World Hypothesis ... Show more content on Helpwriting.net ...
It is believed that it may have been a major step in cellular life due to the fact that RNA stores
genetic information like DNA, and catalyzes chemical reactions like an enzyme protein. In 1962
the molecular biologist Alexander Rich, had given the idea in an article he gave to a volume issued
in honor of physiologist, Albert Szent Györgyi. This theory is supported by its ability to store,
transmit, and recreate genetic information, just like DNA.
Community Clay Hypothesis
In this hypothesis a scientist by the name of Dan Luo believes that clay hydrogels provide a way
for chemicals to come together and form complex biomolecules. Hydrogel is made up of groups
of polymer chains that suck up large amounts of water. The trapped chemicals react and form
biochemicals like proteins and DNA. We propose that in early geological history clay hydrogel
provided a confinement function for biomolecules and biochemical reactions, said Luo.
Panspermia
... Get more on HelpWriting.net ...
49. Examples Of Stoicism In The Aeneid
In the Aeneid by Vergil, the Roman values of Stoicism, dutifulness, and patriotism are reflected
through the main characters actions and beliefs, such as Aeneas s abandonment of Dido and his
speech of encouragement to his soldiers. In Roman philosophy, Stoicism was valued because it
emphasized following duty over giving into emotion. Vergil portrays this belief consistently
throughout the Aeneidthrough the characters actions. The first instance of Stoicism is when Aeneas
and his crew are shipwrecked in Carthage. Aeneas states, Now call back your courage, and have
done with fear and sorrow. Some day, perhaps, remembering even this will be a pleasure (1.275
278). Although Aeneas feels defeated and hopeless, he puts aside his emotions to encourage his
crew and foster hope... Show more content on Helpwriting.net ...
The Romans established a Republic as their form of government because they believed that all
citizens should actively participate in the political aspect of society as a duty to their country. Vergil
highlights the Roman value of dutifulness throughout his entire epic. For example, Aeneas s quest
is based upon his duty to the Trojan people and his descendants, who are destined to become
formidable leaders. Aeneas leaves Troy to construct a new empire that will continue to build upon
the Trojan legacy. He endures numerous calamities and misfortunes throughout his journey but
always honors his duty to the gods and his people. Vergil further enhances his portrayal of the
Roman value of duty through King Latinus. Although his daughter, Lavinia, has many suitors
around his kingdom, a prophecy from the Oracle of Faunus reveals to him that she is destined to
marry a foreigner. At first, Latinus is dutiful and honors the gods wishes, but his lack of fortitude in
standing up to his wife and other suitors leads to him neglecting his duty. This results in a major
war and his country s ultimate
... Get more on HelpWriting.net ...
50. Analysis Of The Montara Wellhead Platform Drill Rig Owned...
At 5:30am WA time on the 21st of August 2009 the Montara wellhead platform drill rig owned
by PTTEP Australasia suffered a well head accident, resulting in the uncontrolled discharge of
oil and gas. This discharge was stopped 2 months later on the 3rd November 2009 (Government,
2013). The devastation that this oil caused in 2 months was outrages, resulting in the destruction
of ecosystems and surrounding villages to perish overtime. The following will analysis the
perspectives of three major stake holders, the Australian government, PTT Exploration and
Production (PTTEP) Australasia and the people of West Timor, and explain how the common
good is of relevance to this issue. The principle off the common good is littered throughout
history. One prominent description of the common good is the social conditions that permit
people to be able to reach their full potential as well as realizing their human dignity (William J.
Byron, 1998). Another describes the common good as the moral formula for the greatest good
for all (Kelly Jones, 1996). Pope Paul VI described the common good slightly differently as
where every social group must take account of the needs and appropriate aspirations of other
groups, and even of the over all welfare of the entire human family (Pope Paul VI, 1965). The
issue of the Montara oil spill is of great relevance to the common good because various
stakeholders were involved and negatively affected. To reach a solution that results in the greatest
... Get more on HelpWriting.net ...
52. Email Security Improving An Email Address
Email security improving
An email address is currently what a mailbox was in 1940. Individuals send letters, reminders
and business agendas via email every day. Each year, more persons are becoming acclimated to
the Internet and, as the number of people who need email rises, so do the number of email service
providers. Dissimilar providers offer different features like storage, folder creation, and spam filters
so people should choose one that meets their desires.
These days, email is a needed part of communication. If individuals are not hooked up to email,
they may never hear from anyone they know. Email is a little more complicated than sending a
letter in the mail, nevertheless it is the same idea. Persons will be on their way to sending letters
by using their computer in no time. It is a cheap and easy way to send a message to anyone. All in
all, it is significant for email user to get the knowledge and understand how secure their E mail is
and how become more secure.
How secure is your E mail?
When individuals send emails from one place to another, the most significant thing they can do is
secure their email. A secure email has a much smaller chance of being pilfered or used for
information than one that is not secure. The most significant thing persons can do is make sure that
they are being smart about their Internet connections.
Common email providers tend to allow (or require) a secure HTTPS connection between the
browser or email client and their servers.
... Get more on HelpWriting.net ...
53. DVD v. VCR Essay
DVD v. VCR
Ever since the first motion picture was introduced, the world has grown a humongous appetite for
more movies. Through technology, humans have made incredible advancements in the motion
picture field. Today, there are only two standards when it comes to recording and replaying a
motion picture for the common person: Digital Video Disc (DVD) and Video Cassette Recorder
(VCR). Each allows for easy access to both movies as well as the necessary players. The two types
of media have both subtle and obvious differences, ranging from picture quality to ease of use. The
differences and similarities can bewilder a person with little knowledge of the two medias. Though
it may not be number one for recording and can be more ... Show more content on Helpwriting.net
...
The only problem with DVD players is that most of them are just that; DVD players which
cannot record. There are a few home audio recorders but they are all over the range of the
common user, usually exceeding 1000 dollars. There are DVD recorders for the computer which
cost, at minimum, 500 dollars for the cheapest model. Along with this is cost of a empty DVD
on which to record the movie. These are equal, if not more, to the price of a movie on DVD
bought in the store. This means recording a movie onto a blank DVD (for archival purposes
only, of course) is not cost effective. On the VCR, it can be quite cost effective. Blank cassettes
are only a couple of dollars and can be found anywhere. As well, every VCR bought can usually
record.
What puts the DVD over the top in quality is the picture and the sound. The picture of a DVD
produces 720 lines of resolution versus a VCR producing only 220. The DVDs picture is almost
four times better than a VCR. This is made possible because the picture is read in digital format
from a DVD and in analog format from a VCR. This also makes the Dolby Digital sound possible
on a DVD. Dolby Digital is one step above the previous Dolby Surround, adding one more
independent channel to the home theatre. Of course, both of these are only available with capable
sound systems to match the video.
Maintenance, care, and storage are always important
... Get more on HelpWriting.net ...
54. The Crimes And Impacts Of Bonnie And Clyde
Bonnie and Clyde, an infamous phrase that linked two criminals, has been commonly known by
many people around the country. In the early1930 s the crimes Bonnie Parker and Clyde Barrow
committed, propelled shock waves through a depressed nation. The couple s series of negligible
thefts morphed into bank robberies and escalated to murders. Amid the economic turbulence, their
string of robberies and murders proved that crimes spiked in times of strife and demonstrated the
use of media to distract the public. The Great Depressionwas the first severe economic tribulation
that the United States had witnessed. Beginning in 1929, when the stock market collapsed in late
October, unemployment fell, and millions of Americans became jobless. Poverty... Show more
content on Helpwriting.net ...
Clyde Barrow was one of them. Barrow felt no remorse in stealing from banks, armories, and other
government owned establishments. Considering, what seemed to be the lack of actions from
President Hoover, whose optimism remained even when the economic state lingered in a perpetual
downfall, citizens committed abrasive crimes. Herbert Hoover s numerous attempts to aid the
economy failed to find its way to small, private towns or businesses. He relied on the idea of
volunteerism, or the goodwill of people, to keep businesses and families afloat (Digital History).
Still, small town businesses were forced to lay off employees and many went bankrupt. Owners
watched their careers fall apart. There was little state banks could do to help businesses, and with no
other outlet for their frustration they blamed the federal government. President Hoover consistently
refused to use federal funds to support the economy; though the general population was desperate
for any relief, he believed in the long run depleting federal funds would damage the economy even
more (Digital History). American citizens quickly became frustrated at the absence of governmental
... Get more on HelpWriting.net ...