This document describes a study that evaluated genetic variation of trypsin inhibitors in cultivated and wild soybean varieties. The study analyzed variations in the Kunitz trypsin inhibitor (KTI) and Bowman-Birk trypsin-chymotrypsin inhibitor (BBI) genes. An endonuclease heteroduplex mismatch cleavage assay was used to detect mutations in the KTI gene. The assay found low levels of genetic variation in KTI and BBI among the varieties. It also identified subtypes of the BBI-A type and determined that the Tib type of KTI is dominant. The endonuclease assay was able to detect the ti-null type of KTI, while digestion with restriction enzymes could not
Identification of genetic regions in the yuk operon of Bacillus subtilis that are differentially required for secretion of YukE, a homolog to the virulence factor, ESXA in Mycobacterium tuberculosis
This document summarizes research presented at the 2nd International Stripe Rust Symposium in Izmir, Turkey from April 28 to May 1, 2014. It describes work on identifying and characterizing effector proteins from the wheat stripe rust pathogen Puccinia striiformis f. sp. tritici. Methods discussed include predicting secreted effectors from cDNA libraries, analyzing gene motifs, cloning genes, studying protein interactions and subcellular localizations, and developing tools for detecting effector triggered immunity in wheat. The research aims to further understand the molecular mechanisms of rust pathogenicity and resistance.
Identification of defense proteins in pearl millet seeds effective against Ma...ICRISAT
Pearl millet leaf blast is caused by Magnaporthe grisea (Anamorph, Pyricularia grisea) has been recently emerged as devastating disease with economic significance in India. It is well-known that host plant resistance is the most economical strategy to effectively manage this disease; hence, identification of resistance sources for blast disease is important to incorporate resistance genes into elite breeding lines. On the other hand, fungal cell wall is a multi-layered, in which chitin and glucan are the major polysaccharide constituents (Figure 1). In this view, chitinases and glucanases gain significant attention as antifungal enzymes. These were produced as pathogenesis related (PR) hydrolses in plants with constitutive expression in seeds, leaves, flowers, tubers and induced upon pathogen invasion. They exert their defensive role by decomposing the fungal cell wall polysaccharides chitin and glucan into respective monomers as N-Acetyl D-glucosamine and D-glucose residues (Prasannath, 2017). Whereas, protease inhibitors (PIs) are known to participate in defensive role by inhibiting the extracellular protease activity secretes from actively growing fungal mycelia as well as cysteine proteases involved in the chitin synthase activity (Joshi et al., 1998). Hence, the present study is focused on the screening of chitinases, glucanases and cysteine protease inhibitors in ten pearl millet seed proteins with differential disease resistance and evaluation of their anti fungal efficacy against growth of P. grisea (Pg 45), prevalent isolate in Hyderabad, Telangana region.
Genetic Diversity of Sorghum (Sorghum bicolor L. Moench) from East and West H...Premier Publishers
Genetic diversity within local landraces is important input for crop breeding programs and in the preservation of their genetic potential. The objective of this study was to assess the genetic diversity and analyze population structure of sorghum landraces grown in East and west Hararghe Zones of Oromia Regional state, Ethiopia based on SSR markers. A total of 10 accessions of sorghum landraces were estimated using 10 SSR markers. For all the loci analyzed, 70 polymorphic alleles were detected with the number of alleles per locus range from 2 to 18 with an average of seven alleles. Polymorphism information content of each marker was variable and showed a significant correlation with total number of alleles (r = 0.75). The higher the number of alleles per marker, the greater is PIC value. Dendrogram obtained according to UPGMA hierarchical classification model using DICE coefficient of similarity allowed the classification of sorghum accessions into four main groups. It was recommended that a further research on genetic diversity of sorghum should integrate botanical races, agro-morphological traits in addition to molecular markers for a better preservation of the genetic resources of sorghum landraces in Eastern Ethiopia.
Allele mining in orphan underutilized cropsCCS HAU, HISAR
This document discusses allele mining as a research field aimed at identifying allelic variation in genetic resources collections that can be used for crop improvement. It defines key terms like alleles, orphan crops, and describes two major approaches for allele mining - TILLING and sequencing-based methods. Case studies on allele mining in cassava and sorghum are presented, outlining methodology used and results obtained, including the identification of superior alleles. The prospects of allele mining in molecular plant breeding are discussed, and the need for standardizing bioinformatics tools and developing advanced strategies to efficiently identify novel alleles from genetic resources.
Identification of QTLs and underlying candidate genes controlling grain Fe an...ICRISAT
Micronutrient malnutrition or ‘hidden hunger’ due to consumption of diets poor in iron (Fe) and zinc (Zn) affect over
>3 billion people worldwide, mostly women and children in developing countries. Biofortification, increasing grain
Fe and Zn by genetic means is one of the sustainable options for combating micronutrient-malnutrition. To identify
genomic regions associated with grain Fe and Zn in sorghum, a RIL population (342 individuals) derived from cross-
296B × PVK801 was phenotyped for two years at three locations and genotyped with Simple Sequence Repeats (SSRs)
and Diversity Arrays Technology (DArTs). Highly significant genotype × environment interactions were observed for both
micronutrients; grain Fe showed greater variation than Zn.
This document describes a study where researchers isolated a gain-of-function mutant of Bruton's tyrosine kinase (BTK) called BTK* through random mutagenesis. BTK* results from a single point mutation in the pleckstrin homology (PH) domain that replaces a glutamate with a lysine at residue 41. BTK* shows increased phosphorylation, increased membrane targeting, and can drive cell growth in soft agar. The transforming activity requires kinase activity and an intact PH domain. Expression of BTK* can also relieve interleukin-5 dependence in a B cell line. The results demonstrate that the PH domain critically regulates BTK transformation and activation.
Identification of genetic regions in the yuk operon of Bacillus subtilis that are differentially required for secretion of YukE, a homolog to the virulence factor, ESXA in Mycobacterium tuberculosis
This document summarizes research presented at the 2nd International Stripe Rust Symposium in Izmir, Turkey from April 28 to May 1, 2014. It describes work on identifying and characterizing effector proteins from the wheat stripe rust pathogen Puccinia striiformis f. sp. tritici. Methods discussed include predicting secreted effectors from cDNA libraries, analyzing gene motifs, cloning genes, studying protein interactions and subcellular localizations, and developing tools for detecting effector triggered immunity in wheat. The research aims to further understand the molecular mechanisms of rust pathogenicity and resistance.
Identification of defense proteins in pearl millet seeds effective against Ma...ICRISAT
Pearl millet leaf blast is caused by Magnaporthe grisea (Anamorph, Pyricularia grisea) has been recently emerged as devastating disease with economic significance in India. It is well-known that host plant resistance is the most economical strategy to effectively manage this disease; hence, identification of resistance sources for blast disease is important to incorporate resistance genes into elite breeding lines. On the other hand, fungal cell wall is a multi-layered, in which chitin and glucan are the major polysaccharide constituents (Figure 1). In this view, chitinases and glucanases gain significant attention as antifungal enzymes. These were produced as pathogenesis related (PR) hydrolses in plants with constitutive expression in seeds, leaves, flowers, tubers and induced upon pathogen invasion. They exert their defensive role by decomposing the fungal cell wall polysaccharides chitin and glucan into respective monomers as N-Acetyl D-glucosamine and D-glucose residues (Prasannath, 2017). Whereas, protease inhibitors (PIs) are known to participate in defensive role by inhibiting the extracellular protease activity secretes from actively growing fungal mycelia as well as cysteine proteases involved in the chitin synthase activity (Joshi et al., 1998). Hence, the present study is focused on the screening of chitinases, glucanases and cysteine protease inhibitors in ten pearl millet seed proteins with differential disease resistance and evaluation of their anti fungal efficacy against growth of P. grisea (Pg 45), prevalent isolate in Hyderabad, Telangana region.
Genetic Diversity of Sorghum (Sorghum bicolor L. Moench) from East and West H...Premier Publishers
Genetic diversity within local landraces is important input for crop breeding programs and in the preservation of their genetic potential. The objective of this study was to assess the genetic diversity and analyze population structure of sorghum landraces grown in East and west Hararghe Zones of Oromia Regional state, Ethiopia based on SSR markers. A total of 10 accessions of sorghum landraces were estimated using 10 SSR markers. For all the loci analyzed, 70 polymorphic alleles were detected with the number of alleles per locus range from 2 to 18 with an average of seven alleles. Polymorphism information content of each marker was variable and showed a significant correlation with total number of alleles (r = 0.75). The higher the number of alleles per marker, the greater is PIC value. Dendrogram obtained according to UPGMA hierarchical classification model using DICE coefficient of similarity allowed the classification of sorghum accessions into four main groups. It was recommended that a further research on genetic diversity of sorghum should integrate botanical races, agro-morphological traits in addition to molecular markers for a better preservation of the genetic resources of sorghum landraces in Eastern Ethiopia.
Allele mining in orphan underutilized cropsCCS HAU, HISAR
This document discusses allele mining as a research field aimed at identifying allelic variation in genetic resources collections that can be used for crop improvement. It defines key terms like alleles, orphan crops, and describes two major approaches for allele mining - TILLING and sequencing-based methods. Case studies on allele mining in cassava and sorghum are presented, outlining methodology used and results obtained, including the identification of superior alleles. The prospects of allele mining in molecular plant breeding are discussed, and the need for standardizing bioinformatics tools and developing advanced strategies to efficiently identify novel alleles from genetic resources.
Identification of QTLs and underlying candidate genes controlling grain Fe an...ICRISAT
Micronutrient malnutrition or ‘hidden hunger’ due to consumption of diets poor in iron (Fe) and zinc (Zn) affect over
>3 billion people worldwide, mostly women and children in developing countries. Biofortification, increasing grain
Fe and Zn by genetic means is one of the sustainable options for combating micronutrient-malnutrition. To identify
genomic regions associated with grain Fe and Zn in sorghum, a RIL population (342 individuals) derived from cross-
296B × PVK801 was phenotyped for two years at three locations and genotyped with Simple Sequence Repeats (SSRs)
and Diversity Arrays Technology (DArTs). Highly significant genotype × environment interactions were observed for both
micronutrients; grain Fe showed greater variation than Zn.
This document describes a study where researchers isolated a gain-of-function mutant of Bruton's tyrosine kinase (BTK) called BTK* through random mutagenesis. BTK* results from a single point mutation in the pleckstrin homology (PH) domain that replaces a glutamate with a lysine at residue 41. BTK* shows increased phosphorylation, increased membrane targeting, and can drive cell growth in soft agar. The transforming activity requires kinase activity and an intact PH domain. Expression of BTK* can also relieve interleukin-5 dependence in a B cell line. The results demonstrate that the PH domain critically regulates BTK transformation and activation.
This document summarizes research on peptides and aging conducted by Prof. Vladimir Khavinson and his colleagues. It describes several key findings:
1. Certain peptides have been found to increase lifespan and healthspan in animal studies by regulating gene expression and protein synthesis. These peptides show tissue-specific effects and are considered safe.
2. Peptide preparations developed from various tissues (thymus, pineal gland, etc.) have been used to treat over 15 million patients to prevent and treat age-related diseases.
3. Studies demonstrate that peptides can modulate immune function, suppress cancer growth, reduce induced carcinogenesis, protect against DNA damage, and increase stress resistance.
4. Research further suggests peptides may
This document references 4 sources related to the pharmacological properties of kaempferol, a natural flavonoid compound:
1) A 2010 study that isolated kaempferol-3-rutinoside from the leaves of Sideroxylon foetidissimum.
2) A 2010 study that investigated interleukin-6 as a potential marker for reduced adenoma recurrence from dietary flavonols like kaempferol.
3) A 2011 study that showed kaempferol acts through mitogen-activated protein kinases and kinase pathways in a neuroinflammation model.
4) A 2008 study that demonstrated kaempferol and related flavonoids can inhibit the fatty acid amide
Role of autophagy in tumor necrosis factor-α- induced apoptosis of osteoblast...KarlFrank99
This study investigated the role of tumor necrosis factor-α (TNF-α) in inducing autophagy and apoptosis in mouse osteoblast MC3T3-E1 cells. The study found that TNF-α inhibited cell viability in a dose- and time-dependent manner and induced both autophagy and apoptosis. Modulating autophagy levels with inducers and inhibitors affected the degree of TNF-α-induced apoptosis, indicating autophagy protects cells by reducing apoptosis. Studying the interaction between TNF-α, autophagy and apoptosis may provide insights into bone disease pathogenesis and new therapeutic targets.
This study characterized osteoclast precursors in the mouse periosteum. Mice expressing a form of Cbl that abrogates its interaction with PI3K (YF mice) were compared to wild-type mice. The YF mice showed a 2.7-fold increase in mononuclear TRAP+ cells in the periosteum compared to wild-type mice. There was also an increasing trend in the number of EGFP+ cells in the trabecular bone and periosteum of YF mice. Further work is needed to determine if the EGFP+ cells are osteoclast precursors by staining with markers for monocyte/macrophage lineage cells and fluorescent TRAP staining.
The document discusses how breeding has impacted genetic diversity in maize genomes over time. It examines changes in ancestry across the maize genome and how the genome has responded to selection for increasing hybrid yield. Specifically, it finds that changing ancestry, not selection sweeps, has driven diversity loss across heterotic groups. The diversity of ancestral lines making up modern inbreds has decreased as germplasm pools have become smaller and more homogeneous. Within a single breeding program, genetic drift in small breeding populations also reduced diversity despite selection for yield.
Knockout mice are genetically engineered mice that have had one or more of their genes made defective or inactivated through genetic manipulation. This allows researchers to study the effects of removing or altering the function of a gene. Some examples of knockout mice used in disease modeling include models of cancer, heart disease, and diabetes. Specifically, mice with knocked out insulin receptors in muscles, fat, and liver tissues show defects that mimic diabetes in humans. Knockout mice are a valuable tool for disease research and drug testing due to similarities between mouse and human genes.
Progression of glioblastoma cells and mechanical-epigenetic behaviorsBenjamin Yang
This document presents research on quantifying mechanical forces between cancer cells and their microenvironment. It describes three methods: 1) 3D Traction Force Microscopy to determine cell-ECM forces, 2) 3D Intracellular Force Microscopy to determine cell-cell and intracellular forces, and 3) FRET biosensors to monitor epigenetic modifications. The research found glioblastoma cells responded differently to chemotherapy when on soft vs hard substrates, with more malignant cells exhibiting lower stresses, and epigenetic modifications correlated with intracellular stress. Future work will directly quantify 3D intracellular forces and explore different drugs' effects on cancer cells.
IOSRPHR(www.iosrphr.org) IOSR Journal of Pharmacyiosrphr_editor
This document summarizes research on developing polyclonal antibodies to identify isoflavones in different legume species. Key points:
- Researchers produced polyclonal antibodies in rabbits to detect isoflavones. ELISA tests using these antibodies could quickly screen plants for isoflavone content.
- Seed samples from 8 legume species were tested for isoflavones using the ELISA. All species showed higher isoflavone levels than soybean (the typical isoflavone source), indicating other legumes may be alternative isoflavone sources.
- Extraction methods including hydrothermal treatment at 50°C increased levels of active aglycone isoflavone forms compared to no treatment.
- The research aims to characterize legume
This study investigated the development of bovine oocytes after microinjection with mitochondria from other species. Bovine oocytes were injected with either water buffalo or mouse mitochondria and then activated to undergo parthenogenesis. Oocytes injected with water buffalo mitochondria showed lower cleavage rates but some developed to the blastocyst stage, similar to uninjected oocytes. Oocytes injected with mouse mitochondria showed development comparable to controls. Analysis found the bovine mitochondrial DNA copy number fluctuated during development while the injected mitochondrial DNA remained stable. This demonstrates that interspecies mitochondrial injection permits bovine oocyte development and does not selectively eliminate or enhance the injected mitochondrial DNA.
Inferring microbial gene function from evolution of synonymous codon usage bi...Fran Supek
Introduction: Thousands of microbial genomes are available, yet even for the model organisms, a sizable portion of the genes have unknown function. Phyletic profiling is a technique that can predict their function by comparing the presence/absence profiles of their homologs across genomes. In addition, prokaryotic genomes contain an evolutionary signature of gene expression levels in the codon usage biases, where highly expressed genes prefer the codons better adapted to the cellular tRNA pools.
Objectives: We aimed to augment the existing phyletic profiling approaches by incorporating more detailed knowledge of gene evolutionary history, and create a very large database of predicted gene functions direcly usable for microbiologists.
Materials & methods: We used the OMA groups of orthologs and the paralogy relationships inferred through OMA's „witness of non-orthology“ rule. Genes were assigned to Gene Ontology categories and the phyletic profiles compared using the CLUS classifier that performs a hierarchical multilabel classification using decision trees. We quantified significant codon biases using a Random Forest randomization test that compares against the composition of intergenic DNA. Codon biases in COG gene families were contrasted between microbes inhabiting different enviroments, while controlling for phylogenetic inertia.
Results: The genomic co-occurence patterns of both the orthologs and the paralogs (the homologs separated by a speciation and by a duplication event, respectively) were informative and synergistic in a phylogenetic profiling setup, even though paralogy relationships are thought to conserve function less well. The resulting ~400,000 gene function predictions for 998 prokaryotes (at FDR<10%)> method to systematically link codon adaptation within COG gene families to microbial phenotypes and environments (thus functionally characterizing the COGs) and experimentally validated the predictions for novel E. coli genes relevant for surviving oxidative, thermal or osmotic stress.
Conclusion: Our work towards ehnancing phylogenetic profiling, as well as developing complementary genomic context approaches, will contribute to prioritizing experimental investigation of microbial gene function, cutting time and cost needed for discovery.
Cow´s milk allergy is a common food allergy especially among infants and young children. The major allergen in cow´s milk is beta-lactoglobulin (BLG) and BLG-specific antibodies are needed for diagnostic, therapeutic, food processing and quality verification applications. At VTT we have established a IgE antibody library from a milk allergic person and identified high-affinity antibodies against native and heat denaturated BLG. As an alternative production system, we have used barley as a production host. Proof-of-concept was gained with expressing the BLG-specific antibody in barley cell culture. Best production levels in barley grains were obtained with glutelin-specific promoter combined to ER targeting and retention signals. The barley-produced BLG-specific antibody was successfully purifed with affinity-based chromatography and the functionality of barley-produced BLG-specific antibody was verified by ELISA and immunoprecipitation assays. The developed barley-based expression system clearly demonstrated its potential for application in the processing of dairy milk products as well as in detecting allergens from foods possibly contaminated by cow´s milk.
Flow Cytometric Analysis for Ploidy and DNA Content of Banana Variants Induce...paperpublications3
Abstract: Nuclear DNA content of mutated banana plants was determined by using flow cytometric techniques. It is a powerful tool for large scale screening of ploidy levels. Nuclei were isolated from young leaves from (banana mutants & Glycine plants) supplemented with Propidium- iodide (PI) and RNAse. "Glycine max" used as internal reference standard for identifying the nuclear DNA content by FCM. For ploidy estimation DAPI was used. The results showed differences in DNA content between variants indicating the effect of gamma-irradiation on the genotype of these plants. Variants of short plant stature or stunted growth showed great differences in DNA content compared to control (non-irradiated). The phenotypic variations observed at high doses were likely due to changes in the DNA sequences at the chromosomal level. Nuclear DNA contents decreased with an increase of gamma-dose from 20 Gy to 60 Gy. However, there were no significant differences between DNA content at 20 Gy and 30 Gy and also between 40 Gy and 60 Gy, while they were differed significantly from the control. The results showed no significant differences in ploidy level between all samples used (3n); while all selected mutants (variants) showed differences in DNA content.
This document summarizes a study on detecting genetically modified soybeans and foods in Hong Kong. Two methods were used: an enzyme-linked immunosorbent assay (ELISA) to detect GM proteins, and polymerase chain reaction (PCR) to detect GM DNA. ELISA did not find any GM ingredients, possibly due to low protein levels or denaturing during processing. PCR found that soybeans from the USA and Canada as well as one tofu contained a Roundup Ready gene, while another tofu did not. The study aimed to identify GM soybeans and foods in Hong Kong markets.
This document summarizes a study on detecting genetically modified soybeans and foods in Hong Kong. Two methods were used: an enzyme-linked immunosorbent assay (ELISA) to detect GM proteins, and polymerase chain reaction (PCR) to detect GM DNA sequences. ELISA did not find any GM ingredients, but PCR found that soybeans from the USA and Canada as well as one tofu contained a Roundup Ready gene, while another tofu did not. The study aimed to identify GM soybeans and foods in Hong Kong markets.
1) Betacellulin (BTC) transgenic mice were studied to examine the effects of constitutive BTC overexpression on the urinary bladder.
2) BTC was detected in microvascular structures and umbrella cells of the uroepithelium lining. ERBB1 and ERBB4 receptors were also present in the uroepithelium.
3) BTC transgenic mice and mice that were double transgenic for BTC and a dominant kinase-dead EGFR mutant developed hyperplasia of the uroepithelium at 5 months of age, suggesting BTC signaling was not solely dependent on ERBB1/EGFR.
Abzymes are antibodies that possess catalytic activity in addition to their ligand binding ability. They can be produced through reactive immunization techniques involving haptens that mimic transition state analogs of chemical reactions, eliciting antibodies that can catalyze those reactions. One application of abzymes is in antibody-directed enzyme prodrug therapy (ADEPT), where an abzyme like 38C2 is used to activate anti-cancer prodrugs like doxorubicin selectively near tumor cells.
Nuhu et al_Poster NAPA2016 correction and observationNuhu Tanko
The study determined the prevalence and genetic profiles of ESBL-producing uropathogens among members of the Enterobacteriaceae family at Specialist Hospital Sokoto, Nigeria. A total of 64 Gram-negative uropathogens were isolated from 365 urine samples, with E. coli and Salmonella arizonae being most prevalent. The isolates showed high resistance to cotrimoxazole, nalidixic acid, ciprofloxacin and norfloxacin. 64.1% of isolates were multidrug resistant. ESBL production was detected in 23.4% of isolates. PCR analysis showed 73.3% of ESBL producers contained the blaCTX-M gene and 26.7
Multiplex Ligation- Dependent Probe Amplification (50 kadar farklı genomik DNA veya RNA dizisindeki normal olmayan kopya sayısının tespitini sağlayan bir multipleks PCR yöntemi)
Nucleic Acid Quantification Methods - DNA / RNA Quantificationajithnandanam
Nucleic acids are quantified to check the concentration and purity of DNA/RNA present in the solution mixture.it is important to know the concentration and purity of the nucleic acid for the use in further applications like PCR, restriction digestion etc. Spectrophotometric analysis is the most commonly used method of quantifying DNA, agarose gel electrophoresis can also be used to analyse the DNA sample for purity.
MLPA (Multiplex Ligation-dependent Probe Amplification) is a technique that allows for the relative quantification of up to 45 genomic DNA sequences in one reaction using PCR. It requires only a small amount of DNA and can detect changes in copy number that differ by a single nucleotide. The MLPA technique involves denaturation of DNA samples, hybridization of probes, ligation of probes, amplification by PCR, and analysis via capillary electrophoresis. MLPA kits are available for detection of aneuploidies, deletions/duplications associated with genetic disorders, and gene expression changes in cancer.
This document summarizes research on peptides and aging conducted by Prof. Vladimir Khavinson and his colleagues. It describes several key findings:
1. Certain peptides have been found to increase lifespan and healthspan in animal studies by regulating gene expression and protein synthesis. These peptides show tissue-specific effects and are considered safe.
2. Peptide preparations developed from various tissues (thymus, pineal gland, etc.) have been used to treat over 15 million patients to prevent and treat age-related diseases.
3. Studies demonstrate that peptides can modulate immune function, suppress cancer growth, reduce induced carcinogenesis, protect against DNA damage, and increase stress resistance.
4. Research further suggests peptides may
This document references 4 sources related to the pharmacological properties of kaempferol, a natural flavonoid compound:
1) A 2010 study that isolated kaempferol-3-rutinoside from the leaves of Sideroxylon foetidissimum.
2) A 2010 study that investigated interleukin-6 as a potential marker for reduced adenoma recurrence from dietary flavonols like kaempferol.
3) A 2011 study that showed kaempferol acts through mitogen-activated protein kinases and kinase pathways in a neuroinflammation model.
4) A 2008 study that demonstrated kaempferol and related flavonoids can inhibit the fatty acid amide
Role of autophagy in tumor necrosis factor-α- induced apoptosis of osteoblast...KarlFrank99
This study investigated the role of tumor necrosis factor-α (TNF-α) in inducing autophagy and apoptosis in mouse osteoblast MC3T3-E1 cells. The study found that TNF-α inhibited cell viability in a dose- and time-dependent manner and induced both autophagy and apoptosis. Modulating autophagy levels with inducers and inhibitors affected the degree of TNF-α-induced apoptosis, indicating autophagy protects cells by reducing apoptosis. Studying the interaction between TNF-α, autophagy and apoptosis may provide insights into bone disease pathogenesis and new therapeutic targets.
This study characterized osteoclast precursors in the mouse periosteum. Mice expressing a form of Cbl that abrogates its interaction with PI3K (YF mice) were compared to wild-type mice. The YF mice showed a 2.7-fold increase in mononuclear TRAP+ cells in the periosteum compared to wild-type mice. There was also an increasing trend in the number of EGFP+ cells in the trabecular bone and periosteum of YF mice. Further work is needed to determine if the EGFP+ cells are osteoclast precursors by staining with markers for monocyte/macrophage lineage cells and fluorescent TRAP staining.
The document discusses how breeding has impacted genetic diversity in maize genomes over time. It examines changes in ancestry across the maize genome and how the genome has responded to selection for increasing hybrid yield. Specifically, it finds that changing ancestry, not selection sweeps, has driven diversity loss across heterotic groups. The diversity of ancestral lines making up modern inbreds has decreased as germplasm pools have become smaller and more homogeneous. Within a single breeding program, genetic drift in small breeding populations also reduced diversity despite selection for yield.
Knockout mice are genetically engineered mice that have had one or more of their genes made defective or inactivated through genetic manipulation. This allows researchers to study the effects of removing or altering the function of a gene. Some examples of knockout mice used in disease modeling include models of cancer, heart disease, and diabetes. Specifically, mice with knocked out insulin receptors in muscles, fat, and liver tissues show defects that mimic diabetes in humans. Knockout mice are a valuable tool for disease research and drug testing due to similarities between mouse and human genes.
Progression of glioblastoma cells and mechanical-epigenetic behaviorsBenjamin Yang
This document presents research on quantifying mechanical forces between cancer cells and their microenvironment. It describes three methods: 1) 3D Traction Force Microscopy to determine cell-ECM forces, 2) 3D Intracellular Force Microscopy to determine cell-cell and intracellular forces, and 3) FRET biosensors to monitor epigenetic modifications. The research found glioblastoma cells responded differently to chemotherapy when on soft vs hard substrates, with more malignant cells exhibiting lower stresses, and epigenetic modifications correlated with intracellular stress. Future work will directly quantify 3D intracellular forces and explore different drugs' effects on cancer cells.
IOSRPHR(www.iosrphr.org) IOSR Journal of Pharmacyiosrphr_editor
This document summarizes research on developing polyclonal antibodies to identify isoflavones in different legume species. Key points:
- Researchers produced polyclonal antibodies in rabbits to detect isoflavones. ELISA tests using these antibodies could quickly screen plants for isoflavone content.
- Seed samples from 8 legume species were tested for isoflavones using the ELISA. All species showed higher isoflavone levels than soybean (the typical isoflavone source), indicating other legumes may be alternative isoflavone sources.
- Extraction methods including hydrothermal treatment at 50°C increased levels of active aglycone isoflavone forms compared to no treatment.
- The research aims to characterize legume
This study investigated the development of bovine oocytes after microinjection with mitochondria from other species. Bovine oocytes were injected with either water buffalo or mouse mitochondria and then activated to undergo parthenogenesis. Oocytes injected with water buffalo mitochondria showed lower cleavage rates but some developed to the blastocyst stage, similar to uninjected oocytes. Oocytes injected with mouse mitochondria showed development comparable to controls. Analysis found the bovine mitochondrial DNA copy number fluctuated during development while the injected mitochondrial DNA remained stable. This demonstrates that interspecies mitochondrial injection permits bovine oocyte development and does not selectively eliminate or enhance the injected mitochondrial DNA.
Inferring microbial gene function from evolution of synonymous codon usage bi...Fran Supek
Introduction: Thousands of microbial genomes are available, yet even for the model organisms, a sizable portion of the genes have unknown function. Phyletic profiling is a technique that can predict their function by comparing the presence/absence profiles of their homologs across genomes. In addition, prokaryotic genomes contain an evolutionary signature of gene expression levels in the codon usage biases, where highly expressed genes prefer the codons better adapted to the cellular tRNA pools.
Objectives: We aimed to augment the existing phyletic profiling approaches by incorporating more detailed knowledge of gene evolutionary history, and create a very large database of predicted gene functions direcly usable for microbiologists.
Materials & methods: We used the OMA groups of orthologs and the paralogy relationships inferred through OMA's „witness of non-orthology“ rule. Genes were assigned to Gene Ontology categories and the phyletic profiles compared using the CLUS classifier that performs a hierarchical multilabel classification using decision trees. We quantified significant codon biases using a Random Forest randomization test that compares against the composition of intergenic DNA. Codon biases in COG gene families were contrasted between microbes inhabiting different enviroments, while controlling for phylogenetic inertia.
Results: The genomic co-occurence patterns of both the orthologs and the paralogs (the homologs separated by a speciation and by a duplication event, respectively) were informative and synergistic in a phylogenetic profiling setup, even though paralogy relationships are thought to conserve function less well. The resulting ~400,000 gene function predictions for 998 prokaryotes (at FDR<10%)> method to systematically link codon adaptation within COG gene families to microbial phenotypes and environments (thus functionally characterizing the COGs) and experimentally validated the predictions for novel E. coli genes relevant for surviving oxidative, thermal or osmotic stress.
Conclusion: Our work towards ehnancing phylogenetic profiling, as well as developing complementary genomic context approaches, will contribute to prioritizing experimental investigation of microbial gene function, cutting time and cost needed for discovery.
Cow´s milk allergy is a common food allergy especially among infants and young children. The major allergen in cow´s milk is beta-lactoglobulin (BLG) and BLG-specific antibodies are needed for diagnostic, therapeutic, food processing and quality verification applications. At VTT we have established a IgE antibody library from a milk allergic person and identified high-affinity antibodies against native and heat denaturated BLG. As an alternative production system, we have used barley as a production host. Proof-of-concept was gained with expressing the BLG-specific antibody in barley cell culture. Best production levels in barley grains were obtained with glutelin-specific promoter combined to ER targeting and retention signals. The barley-produced BLG-specific antibody was successfully purifed with affinity-based chromatography and the functionality of barley-produced BLG-specific antibody was verified by ELISA and immunoprecipitation assays. The developed barley-based expression system clearly demonstrated its potential for application in the processing of dairy milk products as well as in detecting allergens from foods possibly contaminated by cow´s milk.
Flow Cytometric Analysis for Ploidy and DNA Content of Banana Variants Induce...paperpublications3
Abstract: Nuclear DNA content of mutated banana plants was determined by using flow cytometric techniques. It is a powerful tool for large scale screening of ploidy levels. Nuclei were isolated from young leaves from (banana mutants & Glycine plants) supplemented with Propidium- iodide (PI) and RNAse. "Glycine max" used as internal reference standard for identifying the nuclear DNA content by FCM. For ploidy estimation DAPI was used. The results showed differences in DNA content between variants indicating the effect of gamma-irradiation on the genotype of these plants. Variants of short plant stature or stunted growth showed great differences in DNA content compared to control (non-irradiated). The phenotypic variations observed at high doses were likely due to changes in the DNA sequences at the chromosomal level. Nuclear DNA contents decreased with an increase of gamma-dose from 20 Gy to 60 Gy. However, there were no significant differences between DNA content at 20 Gy and 30 Gy and also between 40 Gy and 60 Gy, while they were differed significantly from the control. The results showed no significant differences in ploidy level between all samples used (3n); while all selected mutants (variants) showed differences in DNA content.
This document summarizes a study on detecting genetically modified soybeans and foods in Hong Kong. Two methods were used: an enzyme-linked immunosorbent assay (ELISA) to detect GM proteins, and polymerase chain reaction (PCR) to detect GM DNA. ELISA did not find any GM ingredients, possibly due to low protein levels or denaturing during processing. PCR found that soybeans from the USA and Canada as well as one tofu contained a Roundup Ready gene, while another tofu did not. The study aimed to identify GM soybeans and foods in Hong Kong markets.
This document summarizes a study on detecting genetically modified soybeans and foods in Hong Kong. Two methods were used: an enzyme-linked immunosorbent assay (ELISA) to detect GM proteins, and polymerase chain reaction (PCR) to detect GM DNA sequences. ELISA did not find any GM ingredients, but PCR found that soybeans from the USA and Canada as well as one tofu contained a Roundup Ready gene, while another tofu did not. The study aimed to identify GM soybeans and foods in Hong Kong markets.
1) Betacellulin (BTC) transgenic mice were studied to examine the effects of constitutive BTC overexpression on the urinary bladder.
2) BTC was detected in microvascular structures and umbrella cells of the uroepithelium lining. ERBB1 and ERBB4 receptors were also present in the uroepithelium.
3) BTC transgenic mice and mice that were double transgenic for BTC and a dominant kinase-dead EGFR mutant developed hyperplasia of the uroepithelium at 5 months of age, suggesting BTC signaling was not solely dependent on ERBB1/EGFR.
Abzymes are antibodies that possess catalytic activity in addition to their ligand binding ability. They can be produced through reactive immunization techniques involving haptens that mimic transition state analogs of chemical reactions, eliciting antibodies that can catalyze those reactions. One application of abzymes is in antibody-directed enzyme prodrug therapy (ADEPT), where an abzyme like 38C2 is used to activate anti-cancer prodrugs like doxorubicin selectively near tumor cells.
Nuhu et al_Poster NAPA2016 correction and observationNuhu Tanko
The study determined the prevalence and genetic profiles of ESBL-producing uropathogens among members of the Enterobacteriaceae family at Specialist Hospital Sokoto, Nigeria. A total of 64 Gram-negative uropathogens were isolated from 365 urine samples, with E. coli and Salmonella arizonae being most prevalent. The isolates showed high resistance to cotrimoxazole, nalidixic acid, ciprofloxacin and norfloxacin. 64.1% of isolates were multidrug resistant. ESBL production was detected in 23.4% of isolates. PCR analysis showed 73.3% of ESBL producers contained the blaCTX-M gene and 26.7
Multiplex Ligation- Dependent Probe Amplification (50 kadar farklı genomik DNA veya RNA dizisindeki normal olmayan kopya sayısının tespitini sağlayan bir multipleks PCR yöntemi)
Nucleic Acid Quantification Methods - DNA / RNA Quantificationajithnandanam
Nucleic acids are quantified to check the concentration and purity of DNA/RNA present in the solution mixture.it is important to know the concentration and purity of the nucleic acid for the use in further applications like PCR, restriction digestion etc. Spectrophotometric analysis is the most commonly used method of quantifying DNA, agarose gel electrophoresis can also be used to analyse the DNA sample for purity.
MLPA (Multiplex Ligation-dependent Probe Amplification) is a technique that allows for the relative quantification of up to 45 genomic DNA sequences in one reaction using PCR. It requires only a small amount of DNA and can detect changes in copy number that differ by a single nucleotide. The MLPA technique involves denaturation of DNA samples, hybridization of probes, ligation of probes, amplification by PCR, and analysis via capillary electrophoresis. MLPA kits are available for detection of aneuploidies, deletions/duplications associated with genetic disorders, and gene expression changes in cancer.
The document discusses different methods for primer design: Gene Runner, Oligo 6, Primer 3, and manual design. It outlines the manual primer design process, which involves using a reference sequence from NCBI, aligning sequences with Mega 4, selecting a target sequence region, running a BLAST search on NCBI, analyzing melting temperatures and secondary structures with software tools, and checking for potential false priming. The document also mentions using Gene Runner for sequence insertion and analyzing oligo length, position number, and potential non-specific bands when manually designing primers for the HCV genome.
Microarrays allow researchers to analyze gene expression across thousands of genes simultaneously. DNA probes are arrayed on a small glass or nylon slide, and labeled mRNA from samples is hybridized to the probes. Fluorescent scanning detects which genes are expressed. Data analysis includes normalization, distance metrics, clustering, and visualization to group genes with similar expression profiles and identify patterns of co-regulated genes. Microarrays enable functional genomics studies of development, disease, response to drugs or environmental factors, and more.
The document discusses the Hardy-Weinberg principle of population genetics. It states that the frequency of alleles in a population will remain constant over generations if the population is large, randomly mating, and not subject to mutations, gene flow, or selection pressures. It provides an example using cat coat color alleles to demonstrate calculating genotype frequencies based on observed phenotypes and applying the Hardy-Weinberg equations. Factors that can disrupt Hardy-Weinberg equilibrium and cause allele frequencies to change are also noted, including mutation, migration, natural selection, and genetic drift.
Hardy-Weinberg equilibrium allows prediction of allele and genotype frequencies in a population over generations if the population is large, mates randomly, and is unaffected by mutations, migration or selection. It states that the allele frequencies will remain constant and can be used to determine the expected proportions of genotypes such as AA, Aa, and aa based on the allele frequencies p and q where p + q = 1.
This document discusses Hardy-Weinberg equilibrium, which describes the expected genotype and allele frequencies in a population that is not evolving. It will be in equilibrium if 5 assumptions are met: large population size, no migration, negligible mutations, random mating, no natural selection. The model consists of two equations to calculate expected allele and genotype frequencies. Observed frequencies in a sample California population at the EST locus match the expected frequencies, indicating the population is in equilibrium at this locus and not evolving. However, the assumptions are often violated in real populations.
1. Many molecular methods have evolved for detecting mutations, moving from older techniques like Southern blotting to more rapid high-throughput methods.
2. These include amplification refractory mutation system (ARMS) PCR, single-strand conformational polymorphism (SSCP) analysis, denaturating gradient gel electrophoresis (DGGE), denaturating high performance liquid chromatography (DHPLC), real-time PCR, DNA microarrays, and sequencing.
3. The optimal method depends on the genetic disease, mutation type, and specific laboratory; techniques generally involve amplification, digestion, separation of DNA, labeling, and hybridization.
Microarray technology allows researchers to analyze the expression levels of thousands of genes simultaneously using DNA probes attached to a solid surface. There are two main types of microarrays: glass cDNA microarrays which involve spotting pre-fabricated cDNA fragments on glass slides; and high-density oligonucleotide arrays which involve the in situ synthesis of oligonucleotides on a chip. The key steps in a microarray experiment are sample preparation and labeling, hybridization of labeled cDNA to the probes, washing, and image analysis to quantify gene expression levels. Microarrays have numerous applications including gene expression profiling, comparative genomics, disease diagnosis, drug discovery, and toxicology research.
The document summarizes DNA sequencing methods. It discusses the DNA double helix structure and how the four nitrogenous bases form complementary pairs between strands. It then describes the two main historical DNA sequencing methods: the Maxam-Gilbert method which uses chemical degradation, and the Sanger method which is based on chain termination using dideoxynucleotides. The Sanger method is now the most common approach and involves sequencing in four separate reactions with one of the four ddNTPs added to each.
DNA sequencing determines the order of nucleotide bases in a DNA molecule. The first methods were developed in the 1970s by Maxam and Gilbert (chemical method) and Sanger (chain termination/dideoxy method). Sanger's method is now most commonly used and involves DNA synthesis with chain termination by dideoxynucleotides to generate fragments of different lengths that can be separated and read to determine the DNA sequence. DNA sequencing has revolutionized biological sciences by enabling diagnosis of genetic diseases, identification of disease-causing mutations, and mapping of genomes. It provides benefits for medicine, forensics, and agriculture.
Here are the key points about why each step is important in DNA extraction:
- Blending breaks open the cell walls and membranes to release the DNA inside. This physically separates the DNA from other cell contents.
- Salt helps strip away proteins that are attached to the DNA. The positive and negative charges on salt ions disrupt the electrostatic interactions between DNA and proteins.
- Detergent works similarly to salt by disrupting membranes and "poking holes" in them. This allows the contents of the cell to be released. Detergents have molecules with both water-loving and water-fearing parts, allowing them to penetrate and disrupt membranes.
- Enzymes (like meat tenderizer) further break
1. DNA extraction involves breaking open cells to expose the DNA, removing proteins and other contaminants, and precipitating the purified DNA.
2. Common extraction methods include organic extraction using phenol-chloroform to separate DNA from other cell components, and non-organic methods using detergents and protease enzymes.
3. Effective DNA extraction maximizes DNA yield while removing substances that could inhibit downstream applications like PCR. It recovers the minimum amount of high-quality DNA needed for intended uses.
This document discusses several types of PCR techniques and their applications. It begins by explaining standard PCR and its development. It then describes several specialized PCR techniques including allele-specific PCR, asymmetric PCR, assembly PCR, hot-start PCR, helicase-dependent amplification, in situ PCR, inverse PCR, ligation-mediated PCR, and multiplex ligation-dependent probe amplification. Each technique is explained and examples of its uses and applications are provided.
THEME – 4 Genomic diversity of domestication in soybeanICARDA
This document summarizes research on the genomic diversity of soybeans during domestication. It finds:
1) Wild soybeans (G. soja) show more genetic diversity than cultivated soybeans (G. max) due to bottlenecks during domestication and breeding.
2) Analysis of 7 G. soja genomes reveals a pan-genome structure with a large dispensable/variable gene set involved in environmental responses.
3) Comparison of G. soja and G. max genomes identified several million SNPs, indels, and presence/absence variants affecting genes related to domestication traits.
This document provides an overview of advances in cereal genomics and its applications for crop improvement. It discusses the history and development of genomics, including important milestones in genome sequencing. Laboratories conducting cereal genomic research in India are described. Genomics-based approaches like next generation sequencing, genomic assisted breeding, and clone-by-clone and shotgun sequencing are summarized. Achievements in identifying genes for traits like yield and protein content in cereals are highlighted. A case study demonstrates the use of marker-assisted selection to pyramid rust resistance genes in wheat. Challenges in applying genomics for breeding are also noted. In conclusion, genomics is producing vast amounts of sequence data and integrating with other -omics fields and phenotyping to
This document discusses advances in cereal genomics and its applications in crop improvement. It provides a history of genomic research, describing early DNA markers and sequencing technologies. It also summarizes genomic research on major cereal crops like rice, wheat and barley. Genomics approaches like marker-assisted selection and next generation sequencing are enabling the identification of genes for traits like yield, disease resistance and nutritional quality. Challenges remain in linking genomics to phenotypes. Overall, genomic technologies are producing DNA data that can be combined with phenotypic data to accelerate cereal breeding.
Evaluation of seed storage proteins in common bean by some biplot analysisINNS PUBNET
In order to study of seed storage proteins, proteins samples of common bean genotypes were prepared by 0.2 M
NaCl of extracting soluble. Genotypes were located in two groups by cluster analysis using Wilks’ lambda
statistic. Two groups were different for yield components (number of pods per plant, number of seeds per plant
and seed weight). Factor analysis showed that two factors described 61% of total proteins variation. Correlated
bands with yield components characters had the highest coefficients for the first factor. This factor was named
“yield components proteins”. Protein bands via RM 58 and 64 had relationship with days to flowering.
Therefore, the second factor was named “phenologic proteins”. Genotypes were located in four groups by these
factors. Length, angle and presence of protein bands were important characteristics to explain graphical
information in GGE biplot compared to factor analysis. Get the full articles at: http://www.innspub.net/volume-3-number-5-may-2013/
Detection of genetically modified soya, maize, and rice in vegetarian and hea...Gordana Zdjelar
The document analyzes 100 samples of non-labeled vegetarian and healthy food products from Serbia for the presence of genetically modified soy, maize, and rice. Screening using PCR detected CaMV35S promoter in 8 samples, indicating the presence of GMOs. Further analysis found these 8 samples contained Roundup Ready soy, but all were below the 0.9% labeling threshold. No samples contained GM maize or rice. This suggests controls on GMOs in imported foods to Serbia are working as the majority came from EU countries where GMO regulations are similarly enforced.
This document provides an overview of the field of proteomics. It lists the names and student IDs of 10 students in Group #3 who will study proteomics. It then outlines the topics to be covered, including an introduction defining proteomics and the proteome, a brief history of the field, techniques used in proteomics like mass spectrometry and gel electrophoresis, advantages and disadvantages, and applications in fields like oncology and agriculture.
Crop genetic improvement and utilization in china. xinhai liExternalEvents
This document summarizes a case study on crop genetic resources in China. It discusses 1) the collection and conservation of crop germplasm resources in China through various national actions, 2) genomic characterization of crops like rice, wheat, millet, cotton through genome sequencing efforts that have identified genes for traits like yield, quality and stress resistance, and 3) advances in crop molecular breeding in China using techniques like marker-assisted selection, double haploid breeding, and transgenic breeding to develop new crop varieties with desired traits. The document concludes with perspectives on further improving germplasm through basic research and using novel techniques.
Omics related approaches for higher productivity and improved quality.pptxAnirudhTV
The document discusses using omics approaches to improve crop productivity and quality. It covers various omics fields including genomics, epigenomics, transcriptomics, proteomics, metabolomics, and phenomics. Examples are provided on applying these approaches in crops like rice, tomato, groundnut, and brassica to traits such as drought tolerance, nutrient enrichment, and reduced anti-nutrients. A case study on analyzing protein abundance changes in wheat cultivars under drought stress using proteomics is also mentioned.
This study investigated the protective effects of Salacia oblanga and quercetin on cyclophosphamide-induced chromosome aberrations in rat bone marrow cells. Rats were treated with Salacia oblanga or quercetin for 15 days, then given cyclophosphamide on days 14 and 15. Cyclophosphamide is known to induce chromosome aberrations and oxidative stress. The study found that quercetin completely prevented cyclophosphamide-induced chromosome aberrations, while Salacia oblanga partially prevented them. Both treatments decreased oxidative stress caused by cyclophosphamide. The results suggest that Salacia oblanga and quercetin can protect against the genotoxic and oxidative effects of cyclophosph
Deployment of broad spectrum resistance against rice blast which includes gene pyramiding, deployment, transgenic approaches, marker assisted back cross breeding, pedigree by using major R genes and QTLs and phytoalexin genes.
The use of biotechnology in the propagation of plantain and
banana (Musa sp.) of great importance to induce, tolerant to plant genotypes for
diseases and high yield potentials. However, auxins and cytokinins should be used,
which are expensive and can sometimes cause changes in the regenerants obtained.
Both traditional growth regulators (auxins and cytokinins) and non-traditional growth
regulators (brassinosteroid analogues and mixtures oligogalacturonide) are used in
the in vitro propagation of crops, but mush progress has been hindering due to the
sufficient knowledge and impact of different phases prevailing in the
micropropagation of banana hybrid 'FHIA-18' (AAAB) is present hitherto. This work
was performed in order to evaluate the biological activity of an analogue of
brassinosteroids (Biobras-6) *ABr+ and a mixture of oligogalacturonide with the degree
of polymerization between 9 and 16 (Pectimorf) *mOLG+. The effect of ABr and mOLG
are determined as a substitute or complement of auxin (IBA or IAA) and cytokinin (6-
BAP) for the establishment of in vitro multiplication and rooting of plantlets and in the
acclimatization phase. Non-traditional regulators phenolization decrease the explant
growth in the establishment phase of in vitro propagation; but increased the number
of shoots per explants (above 3.5) and improved survival of vitro plant during the
acclimatization phase.
1. The document discusses metagenomics research on the human gut microbiome using a gene-centric approach.
2. It involves sequencing microbial DNA from gut samples to identify genes and characterize functional profiles of the microbiome.
3. Analysis of Japanese gut microbiome samples identified over 600,000 genes, including many novel to the gut microbiome, providing insight into microbiome composition and functions.
This document summarizes Sudhir Navathe's presentation on genome analysis of fungal pathogens of cereal crops. It provides an overview of fungal genome resources and sequencing workflows. It then discusses key findings from comparative genomic analyses of several major fungal pathogens, including the identification of effector genes and accessory chromosomes. The document also presents a case study on the discovery of the ToxA virulence gene in the wheat pathogen Bipolaris sorokiniana through research from multiple countries.
IOSRPHR(www.iosrphr.org) IOSR Journal of Pharmacyiosrphr_editor
This document summarizes a study that developed polyclonal antibodies to identify isoflavones in different legume species using an enzyme immunoassay method. The antibodies were produced in rabbits and showed high sensitivity and specificity for isoflavones. Seed samples from 8 legume species were tested using the antibody-based ELISA method. The results indicate the antibodies can be used to efficiently screen plant materials for isoflavone content, providing a fast way to identify new potential sources of these compounds beyond soybeans.
The document summarizes research on cassava conducted by RIKEN in collaboration with organizations in Japan, Southeast Asia, Africa and South America. Key points include:
1. Development of an integrated genomics platform for cassava including collection of over 27,000 full-length cDNAs, development of cassava databases and microarrays, and transcriptome analysis.
2. Marker breeding of cassava in Thailand using hybrids between high- and low-yielding varieties to identify genes associated with yield, starch content and disease resistance.
3. Heavy ion beam mutagenesis and characterization of mutant cassava lines in Vietnam with variations in traits like leaf shape and starch content.
The document discusses allele mining, which aims to identify allelic variations in genetic resources collections that are relevant for traits of interest. It describes how allele mining works to unlock hidden genetic variation by identifying single nucleotide polymorphisms and new haplotypes. The document then provides details on a case study of allele mining focused on three genes - calmodulin, LEA3, and SalT - important for abiotic stress tolerance in rice and related species. Primers were developed to amplify regions of these three genes from 64 accessions representing rice and other grasses.
Rufus seminar 2017_mechanisms of biological control of plant diseases edite...Plant Disease Control Hub
The document summarizes mechanisms of action of nematode-killing bacteria. It discusses how parasitic bacteria directly infect and kill nematodes through parasitism. Non-parasitic bacteria produce toxins or enzymes that damage nematode cuticles and intestines. Examples include Pasteuria penetrans, an obligate parasite that forms spores inside nematodes, and Bacillus thuringiensis, which produces Cry toxins that form pores in the nematode gut. Another bacterium, Bacillus firmus, secretes a serine protein that degrades the nematode cuticle. The document outlines various experiments investigating these mechanisms.
Similar to Endonuclease heteroduplex mismatch cleavage for detecting mutation genetic variation of trypsin inhibitors in soybean (20)
This document summarizes a study that evaluated the effects of seed treatments with different pesticides on germination and seedling growth in three maize inbred lines. The seed treatments included a fungicide (Maxim XL 035-FS) alone and in combination with two neonicotinoid insecticides (Gaucho 600-FS and Cruiser 350-FS). The results showed that one inbred line had highly vigorous seed that was not affected by the treatments. However, for another inbred line, treatments with Maxim XL 035-FS+Gaucho 600-FS and Maxim XL 035-FS+Cruiser 350-FS decreased germination and reduced root length and dry root weight. Most treatments
COMPARATIVE STUDY OF DROUGHT AND SALT STRESS EFFECTS ON GERMINATION AND SEEDL...Gordana Zdjelar
This document summarizes a study comparing the effects of drought and salt stress on pea seed germination and seedling growth. The study found that pea seeds were more tolerant to salt stress than water stress during germination and early growth. Both stresses negatively impacted seed germination rates and seedling development, with greater effects seen on growth parameters than germination. For equivalent osmotic potentials, PEG solutions creating water stress had a stronger inhibitory effect than NaCl solutions creating salt stress. While germination was only slightly reduced by salt stress, seedling growth was more impaired. The cultivars showed some ability to adapt to stresses over time.
First Report of Cucumber mosaic virus causing chlorotic mottle on Pot Marigo...Gordana Zdjelar
Cucumber mosaic virus was found for the first time infecting pot marigold (Calendula officinalis) plants in Serbia, causing chlorotic mottling and leaf deformation symptoms. Samples collected from infected plants tested positive for Cucumber mosaic virus but not Impatiens necrotic spot virus using ELISA. Mechanical inoculation and RT-PCR further confirmed the presence of Cucumber mosaic virus. Sequence analysis showed the Serbian isolate shared 100% nucleotide identity with isolates from Poland, Italy and Serbia. This represents the first report of natural Cucumber mosaic virus infection in pot marigold in Serbia.
Viability of oilseed rape (Brassica napus L.) seeds under salt stress.PDFGordana Zdjelar
This study examined the seed viability of four oilseed rape cultivars under salt stress conditions. Two tests were used to evaluate germination and growth - a standard laboratory test and an accelerated aging test. In both tests, increasing salt concentrations significantly reduced germination percentages and growth traits like shoot and root length in all cultivars. The most tolerant cultivar was Banacanka, which had the highest germination rates and growth across salt treatments. Results from the accelerated aging test, which simulates stress conditions, showed lower germination and growth than the standard laboratory test. This highlights the importance of vigor tests for assessing seed quality under stressful conditions like salinity.
Effect of Seed Treatments with Neonicotinoids on Maize Inbred Lines Seed QualityGordana Zdjelar
The study evaluated the effects of seed treatments containing various fungicides and insecticides on germination energy and seed germination of four maize inbred lines. The most tolerant inbred line, L-1, showed no significant differences with any treatment. The most sensitive line, L-4, showed significantly reduced germination energy and seed germination when treated with certain combinations of fungicide and insecticides. The effects of treatments varied depending on the genetic composition of the maize lines. The results indicate it is important to choose pesticide combinations suited to specific genotypes to ensure crop protection and high yields.
DETECTION AND MOLECULAR CHARACTERIZATION OF Pepper mild mottle virus IN SERBIAGordana Zdjelar
This document reports on a study detecting and characterizing Pepper mild mottle virus (PMMoV) in Serbia. During 2009-2010, 239 pepper samples from 26 localities were tested for PMMoV and other viruses using ELISA. PMMoV was detected in a small percentage of samples. Three PMMoV-positive samples were mechanically transmitted to test plants and their infectious nature was confirmed. RT-PCR and sequencing using primers for the RdRp and CP genes confirmed the presence of PMMoV and identified the isolates as belonging to pathotypes P1,2, which do not break resistance conferred by the L3 gene. Phylogenetic analysis showed the Serbian isolates clustered with other P1,2
MORPHO-CHEMICAL CHARACTERIZATION OF DRY AND SNAP BEAN (PHASEOLUS VULGARIS L.)...Gordana Zdjelar
This document summarizes research on the morphological and chemical characterization of dry and snap bean landraces collected from Fruška Gora Mountain in Serbia. Thirty-four accessions of dry and snap beans were analyzed for seed color, shape, 1000-seed mass, and phaseolin type. Seeds were predominantly white and cylindrical in shape. 1000-seed mass ranged from 104.90 to 634.96 grams. The T phaseolin type dominated, while the S type was present in some accessions. The research aims to characterize these landraces for their genetic diversity and potential value for future breeding programs.
Genetically Modified Crops – A Potential Risk for Sustainable Agriculture.PDFGordana Zdjelar
This document discusses genetically modified crops and their potential risks and impact on sustainable agriculture. It notes that GM crops were developed to expedite crop improvement for food quality and solve problems in commercial agriculture like disease and weed management. However, their introduction has raised debates about environmental and food safety issues. The most common GM crop is herbicide-tolerant soybean, which occupies 50% of the global biotech area. A major problem is the outbreak of glyphosate-resistant weeds caused by overuse of herbicides on GM soybean crops.
ENVIRONMENTAL AND AGRONOMIC IMPACT OF THE HERBICIDE TOLERANT GM RAPESEED.PDFGordana Zdjelar
This document provides a review of the environmental and agronomic impacts of genetically modified (GM) herbicide-tolerant rapeseed. It discusses how rapeseed pollen and seeds can spread transgenes from GM crops to non-GM crops and wild relatives through cross-pollination and seed dispersal. Vertical gene flow from GM to non-GM rapeseed is of particular concern due to contamination of seed above regulatory thresholds. The development of herbicide-resistant weeds is also discussed as an issue if herbicide tolerance spreads from GM crops. Overall, the document concludes that GM rapeseed poses risks of increased herbicide use and resistance as well as seed contamination requiring monitoring to ensure purity standards are met.
Detection of Genetically Modified Soybean in Crude Soybean Oil.PDFGordana Zdjelar
This document describes a study that aimed to detect and quantify the presence of Roundup Ready genetically modified soybean in crude soybean oil extracted from soybean seed with varying percentages of GM content. Two DNA extraction methods were compared: CTAB and a commercial DNeasy Plant Mini Kit. Real-time PCR was used to amplify DNA targets from the extracted samples to detect and quantify the GM content. The results showed that the commercial kit was superior to CTAB extraction for recovering DNA from crude oil samples. Both qualitative and quantitative PCR analysis demonstrated it is possible to monitor the GM content in crude oil derived from soybean seed with varying GM percentages.
Detection of genetically modified crops in animal feed in Serbia.PDFGordana Zdjelar
This study analyzed 100 non-labeled animal feed samples from countries with different GMO regulations, to detect the presence of genetically modified crops. Roundup Ready soybean was found in 26 samples, with 9 samples exceeding the 0.9% GM content limit. One sample tested positive for MON810 GM maize. No samples contained GM rapeseed. The results show that imported soybean and maize animal feeds on the Serbian market contain unauthorized GMOs. Monitoring is needed to control distribution of non-labeled GMO feeds in Serbia.
Detection of genetically modified crops in animal feed in Serbia.PDF
Endonuclease heteroduplex mismatch cleavage for detecting mutation genetic variation of trypsin inhibitors in soybean
1. 102 G. Petrović et al.
Pesq. agropec. bras., Brasília, v.49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
Endonuclease heteroduplex mismatch cleavage for detecting
mutation genetic variation of trypsin inhibitors in soybean
Gordana Petrović(1)
, Zorica Nikolić(1)
, Vuk Đorđević(1)
, Vesna Župunski(1)
,
Dušica Jovičić(1)
, Maja Ignjatov(1)
and Dragana Milošević(1)
(1)
Institute of Field and Vegetable Crops, Maksima Gorkog 30, Novi Sad, Serbia. E‑mail: gordana.zdjelar@nsseme.com,
zorica.nikolic@nsseme.com, vuk.djordjevic@nsseme.com, dusicajovicic@hotmail.com, maja.ignjatov@nsseme.com, dragana.petrovic@nsseme.com
Abstract – The objective of this work was to evaluate the genetic variation of trypsin inhibitor in cultivated
(Glycine max L.) and wild (Glycine soja Siebold & Zucc.) soybean varieties. Genetic variations of the Kunitz
trypsin inhibitor, represented by a 21‑kD protein (KTI), and of the Bowman‑Birk trypsin–chymotrypsin inhibitor
(BBI) were evaluated in cultivated (G. max) and wild (G. soja) soybean varieties. Endonuclease heteroduplex
mismatch cleavage assays were performed to detect mutations in the KTI gene, with a single‑stranded specific
nuclease obtained from celery extracts (CEL I). The investigated soybean varieties showed low level of genetic
variation in KTI and BBI. PCR‑RFLP analysis divided the BBI‑A type into subtypes A1 and A2, and showed
that Tib type of KTI is the dominant type. Digestion with restriction enzymes was not able to detect differences
between ti‑null and other types of Ti alleles, while the endonuclease heteroduplex mismatch cleavage assay
with CEL I could detect ti‑null type. The digestion method with CEL I provides a simple and useful genetic tool
for SNP analysis. The presented method can be used as a tool for fast and useful screening of desired genotypes
in future breeding programs of soybean.
Index terms: Glycine max, Glycine soja, antinutritional factors, protease inhibitors, SNP.
Endonuclease com incompatibilidade heteroduplex para detectar
mutação e variações genéticas de inibidores da tripsina em soja
Resumo – O objetivo deste trabalho foi avaliar a variação genética do inibidor de tripsina em variedades
cultivadas (Glycine max) e silvestres (Glycine soja) de soja. Foram avaliadas as variações genéticas do
inibidor de tripsina Kunitz, representado pela proteína 21‑kDa (KTI), e do inibidor de tripsina‑quimotripsina
Bowman‑Birk (BBI), em variedades de soja cultivadas (G. max) e selvagens (G. soja). Ensaios de clivagem
foram feitos com endonuclease de incompatibilidade heteroduplex, para a detectar mutações no gene de
KTI, com uma única nuclease específica de cadeia simples, obtida a partir de extractos de aipo (CEL I).
As variedades de soja estudadas apresentaram baixo nível de variação genética em KTI e BBI. A análise por
PCR ‑RFLP dividiu o BBI‑A em A1 e A2 e mostrou que o Tib do KTI é o tipo dominante. A digestão com
enzimas de restrição não foi capaz de detectar diferenças entre os tipos de ti‑null e outros alelos Ti, enquanto
o ensaio com endonucleases com incompatibilidade heteroduplex com CEL I pôde detectar o tipo ti‑null.
O método de digestão com CEL I fornece uma ferramenta genética simples e útil para a análise de SNP.
O método apresentado pode ser utilizado como ferramenta para a triagem rápida e útil de genótipos desejáveis
em futuros programas de melhoramento de soja.
Termos para indexação: Glycine max, Glycine soja, factores antinutritionais, inibidores de protease, SNP.
Introduction
In general, most commercial soybean cultivars
contain about 40% protein and represent an important
source of this nutrient (Song et al., 2013). Soybean
proteins have traditionally been used for animal
feed; however, their use for human consumption are
increasing (Livingstone et al., 2007). Nevertheless,
raw soybean cannot be used for animal feeding
because of the presence of some antinutritional factors
that decrease its nutritional value. Protease inhibitors,
which represent about 6% of the total seed protein
content, are among the main antinutritional factors
in soybean seeds (Wang et al., 2004). There are two
major classes of protease inhibitors: the Kunitz trypsin
inhibitor (KTI), represented by a 21‑kD protein, and
the Bowman‑Birk trypsin–chymotrypsin inhibitor
(BBI), which consists of several related 8‑kD proteins
2. Endonuclease heteroduplex mismatch cleavage for detecting 103
Pesq. agropec. bras., Brasília, 49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
(Kim et al., 2010). Approximately 80% of the trypsin
inhibition activity is caused by KTI (Barros et al.,
2008).
The biological roles of protease inhibitors are not
clear. A number of functions has been proposed for
BBIs, including the regulation of protease activity
during seed germination and the protection of plants
from insects and microorganisms. Moreover, BBIs may
also function as storage of sulfur amino acids (Barros
et al., 2012; Cruz et al., 2013). Recent investigations
have focused on its medicinal utility for suppressing
both initiation and promotion stages of carcinogenesis
(Rakashanda & Amin, 2013). BBI protease inhibitors
are double‑headed serine protease inhibitors that bind
both enzymes at two independent reactive sites with a
network of highly conserved disulfide bridges (Barros
et al., 2012).
Genes encoding BBI in Glycine max and Glycine
soja are a multigene family, with at least five members:
BBI‑A, BBI‑B, BBI‑CII, BBI‑DII and BBI‑EI. BBI‑B
is supposed to be encoded by a gene which is closely
related to BBI‑A, designated as BBI‑A2, and both are
very similar. Post‑translational proteolysis indicates
that BBI‑EI is originated from BBI‑DII. Thus, BBIs
are grouped in three types with distinct characteristics:
BBI‑A, BBI‑C, and BBI‑D (Deshimaru et al., 2004;
Wang et al., 2008; Barros et al., 2012).
Based on electrophoretograms, 12 forms of KTI
have been found: Tia and Tib (Wang et al., 2008, 2010),
Tic (Hymowitz, 1973), Tid (Zhao & Wang, 1992), Tie
(Wang et al., 2008), Tif (Wang et al., 2004), Tibi5
(Wang
et al., 2008), Tiaa1
, Tiaa2
, Tiab1
, Tig (Wang et al., 2008)
and ti‑null type (Orf & Hymowitz,1979). Of these,
Tia and Tib, which differ by nine amino acids, are the
predominant types (Lee et al., 2012). These several
polymorphic soybean KTI types are controlled by
codominant multiple alleles at a single locus (Wang
et al., 2008). There are at least ten distinct DNA
sequences in soybean genome for the Kunitz trypsin
inhibitor, some of which occur in tandem pairs (Jofuku
& Goldberg, 1989). At least three of these have been
confirmed to represent functional genes, referred to
as KTI1, KTI2 and KTI3. The major Kunitz trypsin
inhibitor gene in soybean seeds is KTI3 (Jofuku &
Goldberg 1989). The null phenotype of KTI, which has
reduced amounts of Kunitz trypsin inhibitor and lacks
detectable Kunitz trypsin inhibitor activity, is inherited
as a recessive allele ti (Orf & Hymowitz, 1979). This
null line has three mutations: two deletions and one
G → T transversion occurred within the KTI3 gene
(Jofuku et al., 1989). These mutations cause a
translational frameshift that results in four stop codons
to be inserted into the KTI3 mRNA reading frame and
premature termination of KTI3 mRNA translation,
and leads to a 100‑fold reduction of KTI3 mRNA in
soybean embryos (Jofuku et al., 1989).
There are some correlations between a single
nucleotide polymorphism (SNP) and many of the
key characters of crops. Even the phenotype of some
characters can be indicated by SNPs. Therefore,
detecting SNPs for important functional genes and
identifying their relationship with desired phenotypes
are important tools in plant breeding program.
According to the demand, it may be necessary to
develop soybean cultivars with a high content of
inhibitors for resistance to insects, or to develop
cultivars with a reduced content of inhibitors for a
better nutritive value. One of the methods for SNP
detection is a heteroduplex mismatch cleavage assay
using the endonuclease CEL I from celery in plants
(Zolala et al., 2009), animals (Kuroyanagi et al.,
2013), and humans (Till et al., 2006). CEL I is a
mannosyl glycoprotein which cuts the 3’ side of the
loops formed in double‑stranded heteroduplex DNA
molecules, at sites of base substitutions, and small
insertion or deletions (indels) (Yang et al., 2004). CEL
I endonuclease assay has proved to be useful for SNP
detection in tomato (Yang et al., 2004), wheat (Chen
et al., 2011), common bean (Galeano et al., 2009), and
sunflower (Fusari et al., 2011).
The objective of this work was to evaluate the genetic
variation of trypsin inhibitor in cultivated (Glycine
max), and wild (Glycine soja) soybean varieties.
Materials and Methods
Ten soybean varieties were selected, five of them
from USDA (Altona, Wilkin, Amsoy 71, Panther,
and Kunitz); two from the Institute of Field and
Vegetable Crops, Soybean Breeding Program from
Novi Sad, Serbia ('Vojvodjanka' and 'Fortuna'); and
three were wild soybean varieties (G. Soja) provided
by N.I. Vavilov Research Institute collection, from
St. Petersburg, Russia (37‑2, Primorye district, Russia;
42‑2, Khabarovsk district, Russia; and 7‑18, Amur
region, Russia. A DNeasy plant mini kit (Qiagen,
Germany) for genomic DNA extraction, according
to the manufacturer’s manual, was used. Quality and
3. 104 G. Petrović et al.
Pesq. agropec. bras., Brasília, v.49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
quantity of the extracted DNA was checked with a
UV/VIS spectrophotometer (Genesys 10S, Thermo
Scientific, USA). The A260/A280 of extracted DNA
ranged from 1.7‑2.0.
Isoinhibitor‑specific oligonucleotide primers used
for PCR amplification of BBI‑A, BBI‑C, and BBI‑D
are reported in Table 1, as well as the oligonucleotide
primers for KTI3 gene. Endogenous gene lectin was
used as quality control for DNA and PCR efficiency.
PCR was carried out using premix of 2x PCR
Master Mix (Fermentas, Vilnius, Lithuania), with final
concentration of 2 mmol L‑1
MgCl2, 0.2 mmol L‑1
dNTP,
and 1.25 units Taq DNA Polymerase (recombinant).
PCR was performed in a final volume of 25 µL with
0.2 pmol µL‑1
primers and approxmately 50 ng DNA.
Amplifications were carried out in a Mastercycler
ep gradient S thermal cycler (Eppendorf, Hamburg,
Germany) under the following touchdown program:
initial denaturation at 94°C for 3 min, followed by
a touchdown program for 7 cycles, with successive
annealing temperature decrements of 1°C in every
cycle.Forthesefirst7 cycles,thereactionwasdenatured
at 94°C for 50 s, followed by annealing at 62°C →
56°C for 50 s, and polymerization at 72°C for 1 min
and 30 s. The 30 subsequent cycles for amplification
were similar, except for annealing temperature, which
was 56°C for 50 s.
Amplified fragments for BBI‑A were further
subjected to digestion by HindIII restriction enzyme
(Fermentas, Vilnius, Lithuania) (Deshimaru et al.,
2004), while amplified fragments for KTI3 were
digested with Mse I (Tru1 I) restriction enzyme
(Fermentas, Vilnius, Lithuania) (Wang et al., 2008).
Amplification and restriction fragments were
determined using electrophoresis on 2% agarose
gel containing ethidium bromide (0.5 g mL‑1
). The
expected size of the amplified fragments was estimated
by comparison with O’RangeRuler 50 bp DNA Ladder
and FastRuler DNA Ladder, Low Range (Fermentas,
Vilnius, Lithuania).
The agarose gel was visualized using UV
transilluminator, and the images were captured with
DOC II PRINT system (Vilber Lourmat, Marne-la-
Valleé, France).
Plant juice extracts with CELI activity were prepared
as described byTill et al. (2006), for purification of CEL
I. Only the extraction, salting out, and dialysis steps of
the purification protocol were performed. Store‑bought
celery stalks (about 0.7 kg) were juiced at 4°C. Celery
juice was adjusted to reach a final concentration of
0.1 mol L‑1
Tris‑HCl, pH 7.7, 100 µmol L‑1
PMSF
and 0.01% Triton X‑100. The obtained solution was
then centrifuged for 20 min at 10,000 g to pellet
debris. Supernatant was brought to 25% saturation in
(NH4)2SO4, mixed for 1 hour at 4°C, and centrifuged at
10,000 g, at 4°C for 45 min. Resulting supernatant was
adjusted to 80% with (NH4)2SO4, mixed for 1 hour at
4°C, and centrifuged at 10,000 g for 1.5 hour. Pellet was
suspended in buffer with 0.1 mol L‑1
Tris‑HCl pH 7.7,
100 µmol L‑1
PMSF, 0.01% Triton X‑100 (1/10 of
starting plant juice extract volume). Suspension was
dialyzed against the same buffer over night. Extract
aliquots were stored at aproximately 20°C.
To form the heteroduplex, KTI PCR products from
Kunitz variety – lacking active KTI – and from other
soybean varieties were mixed in 1:1 ratio and subjected
to heating and re‑annealing process, running the
following program: 95°C for 2 min; 95°C ramping to
85°C (‑2°C per second); 85°C ramping to 25°C (‑0.3°C
per second); and 4°C hold, to form heteroduplex.
For CEL I digestion, the 10 µL of heteroduplexes
were incubated in 5 µL of buffer D (20 mmol L‑1
Tris–
HCl,pH 7.4,25 mmolL‑1
KCl,10 mmolL‑1
MgCl2)with
5 µLpurified plant extract with CEL I (0.01 µg) at 45°C
for 35 min (Oleykowski et al., 1998). The reaction was
stopped with 5 μL of 0.15 mol L‑1
EDTA. The digested
products were determined using electrophoresis on 2%
agarose gel, as previously described.
Results and Discussion
Soybean KTI has several polymorphic types, which
are controlled by codominant multiple alleles at a
single locus (Wang et al., 2008). Three of the KTI
Table 1. Oligonucleotide primers used for PCR amplification
of lectin, KTI3, BBI‑A, BBI‑C, and BBI‑D genes.
Gene Sequence (5’→3’) Amplicon
(bp)
Reference
Lectin
GACGCTATTGTGACCTCCTC
GAAAGTGTCAAGCTTAACAGCGACG
318
Meyer et al.
(1996)
KTI3
AGTCCCGATTCTCCCAACA
AGTACTCTCACACTTGTGTC
700
Jofuku et al.
(1989)
BBI‑A
ACATGGTGGTGCTAAAGGTGTGTT
CTTGTTCATTAGTAGTTTTCCTTGTCA
350
Wang et al.
(2008)
BBI‑C
GACACTTGACAGGAAAAACAG
GCCAAAAGCAAATTACTGGCC
480
Wang et al.
(2008)
BBI‑D
ACAGCAAAAACAACTAATAAAG
TAAAAATGACCAAATTTGCT
550
Wang et al.
(2008)
4. Endonuclease heteroduplex mismatch cleavage for detecting 105
Pesq. agropec. bras., Brasília, 49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
genes (KTI1, KTI2, and KTI3) have been cloned and
sequenced (Krishnan, 2001). A sequence for KTI was
amplified by PCR (Figure 1) using a set of two primers
designedonthebasisofDNAsequencesofKTI3(= Tia)
(Jofuku et al., 1989). A fragment of aproximately 700
bp was amplified in all analyzed varieties from the
USDA germplasm collection, including the Kunitz
variety – a genotype lacking active trypsin inhibitor.
The null phenotype of KTI is due to a mutation
in the Kunitz trypsin inhibitor structural gene, and
it is inherited as a recessive allele ti. It has reduced
amounts of Kunitz trypsin inhibitor protein and lack
detectable Kunitz trypsin inhibitor activity (Orf &
Hymowitz, 1979). Therefore, one of the methods
for detecting mutation and SNP is a heteroduplex
mismatch cleavage assay using the endonuclease CEL
I from celery (Zolala et al., 2009). The ability of celery
juice extract CEL I to detect a mismatch at one or more
nucleotide positions, without prior knowledge about
this sequence, was shown by Oleykowski et al. (1998).
The laboratory has purified this enzyme according to
Till et al. (2006), which made the mutation detection
assay less expensive. The enzyme is found to be
extremely stable during purification, storage, and
assay. Upon digestion of formed heteroduplexes with
CEL I enzyme, the digested products were visualized
in 2% agarose gels, avoiding the need for labeled
primers, polyacrylamide gels, and DNA sequencers
used in earlier versions of the methods (Galeano et al.,
2009). The method for detecting SNPs in stress‑related
genes in rice, using CEL I and agarose gels, provide
results which perfectly corresponded to the ones
from polyacrylamide‑ and LI‑COR‑based analyses
(Raghavan et al., 2007). Chen et al. (2011) also showed
that agarose gels could be convenient for detecting
SNP in common wheat. Moreover, the PCR reaction
is cheaper because the primers used are not labelled.
Digestion of the heteroduplexes formed for KTI
gene with CEL I enzyme generated bands with 500 bp
and approximately 250 bp, in addition to full‑lenght
uncleaved product of 700 bp (Figure 2). The sum of
the cleaved fragments is theoretically about the length
of the PCR product (Oleykowski et al., 1998). Two
obtained fragments (Figure 2) indicate the presence of
SNP in Kunitz variety KTI gene, confirming that assay
with the CEL I crude extract isolated in laboratory has
the potential to identify SNP mismatches.
Restriction enzyme Mse I (Tru1 I) was used to
determine which KTI type was present. Tia type alleles
had two restriction sites resulting in three fragments.
Tib type had one restriction site resulting in two
fragments (Wang et al., 2008). Tib type was found in
cultivated and in wild soybean varieties (Figure 3).
Electrophoretic forms Tia, Tib, Tic, and Tid have been
reported in cultivated soybeans (Hymowitz, 1973;
Figure 1. Agarose gel electrophoresis of PCR products for
KTI. M1, O’RangeRuler, 50 bp DNA Ladder, 50‑1000 bp;
1. blank, no template control; 2. negative control, maize;
3. positive control, 'Vojvodjanka'; 4. 'Altona'; 5. 'Wilkin';
6. 'Amsoy 71'; 7. 'Panther'; 8. 'Kunitz'; 9. 'Vojvodjanka';
10. 'Fortuna'; 11. Glycine soja 37‑2; 12. Glycine soja
42‑2; 13. Glycine soja 7‑18; M2
, Low Range DNA Ladder,
50‑1500 bp.
Figure 2. Agarose gel electrophoresis of heteroduplex
mismatch cleavage CEL I endonuclease products in KTI
gene. Mutants could be identified as those products that
showed cleaved bands (500 bp and 250 bp), in addition to the
full‑length, uncleaved product (700 bp). M1, O’RangeRuler,
50 bp DNA Ladder, 50‑1000 bp; 1. 'Kunitz' vs. 'Altona';
2. 'Kunitz' vs. 'Wilkin'; 3. 'Kunitz' vs. 'Amsoy' 71; 4. 'Kunitz'
vs. 'Panther'; 5. 'Kunitz' vs. 'Vojvodjanka'; 6. 'Kunitz' vs.
'Fortuna'; 7. 'Kunitz' vs. Glycine soja 37‑2; 8. 'Kunitz' vs.
Glycine soja 42‑2; 9. 'Kunitz' vs. Glycine soja 7‑18; M2
,
Low Range DNA Ladder, 50‑1500 bp.
5. 106 G. Petrović et al.
Pesq. agropec. bras., Brasília, v.49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
Zhao & Wang, 1992). Hymowitz (1973) determined
that 89% of USDA soybean collection contained
the Tia variant. In contrast, Tic was found only in
0.3% of the collection, and it commonly exists in
cultivated soybeans (Wang et al., 2008). Wang et al.
(2010) suggests that both wild and cultivated soybean
usually contain the most commonly occurring Tia and
Tib types, while the Tid form was found in just one
Chinese cultivar. Lee et al. (2012) also found Tia and
Tib as the predominant types. Unlike the digestion
with CEL I, amplification of KTI products, followed
by digestion with restriction enzymes, was not able to
detect differences between ti‑null and other types of Ti
alleles.
Based on their structural features and inhibitory
characteristics, BBIs are grouped in three main types –
BBI‑A, BBI‑C, and BBI‑D – and consist in a multigene
family (Deshimaru et al., 2004). Using cultivated
soybean and wild soybean genomic DNA as templates,
fragments of 350 bp for BBI‑A, 480 bp for BBI‑C, and
550 bp for BBI‑D were amplified (Figure 4). There
were no variations in the amplificon sizes among
cultivated and wild soybean samples, for all three
inhibitors. Based on sequence comparisons, Wang
et al. (2008) suggests that both wild and cultivated
soybean had similar BBI genes. This is probably due
to the close phylogenetic relation between the two
species (Deshimaru et al., 2004).
BBI‑A was further divided into two subtypes –
A1 and A2 – according to small differences in their
nucleotide sequences (Deshimaru et al., 2004).
Amplified fragments for BBI‑A were further subjected
to digestion by HindIII restriction enzyme (Figure 5),
for which only the coding sequence for BBI‑A1
contains a clevage site, resulting in two fragments
(Deshimaru et al., 2004). Between the USA‑origin
soybean, only 'Amsoy 71' showed the presence of
Figure 3. PCR‑RFLP profiles by Mse I (Tru1 I) restriction
digest of the KTI gene. Tib type has one restriction site. M1,
O’RangeRuler, 50 bp DNA Ladder, 50‑1000 bp; 1. 'Altona';
2. 'Wilkin'; 3. 'Amsoy' 71; 4. 'Panther'; 5. 'Kunitz'; 6.
'Vojvodjanka'; 7. 'Fortuna'; 8. Glycine soja 37‑2; 9. Glycine
soja 42‑2; 10. Glycine soja 7‑18; M2
, Low Range DNA
Ladder, 50‑1500 bp.
Figure 4. Agarose gel electrophoresis of PCR products for
BBI‑A. M1, O’RangeRuler, 50 bp DNA Ladder, 50‑1000
bp; 1. blank, no template control; 2. negative control,
maize; 3. 'Altona'; 4. 'Wilkin'; 5. 'Amsoy 71'; 6. 'Panther';
7. 'Kunitz'; 8. 'Vojvodjanka'; 9. 'Fortuna'; 10. Glycine soja
37‑2; 11. Glycine soja 42‑2; 12. Glycine soja 7‑18; M2
, Low
Range DNA Ladder, 50‑1500 bp.
Figure 5. PCR‑RFLP profiles by HindIII restriction digest
of the BBI‑A gene. BBI‑A1 subtype contains a clevage
site. M1, O’RangeRuler, 50 bp DNA Ladder, 50‑1000
bp; 1. 'Altona'; 2. 'Wilkin'; 3. 'Amsoy 71'; 4. 'Panther';
5. 'Kunitz'; 6. 'Vojvodjanka'; 9. 'Fortuna'; 10. Glycine soja
37‑2; 11. Glycine soja 42‑2; 12. Glycine soja 7‑18; M2
, Low
Range DNA Ladder, 50‑1500 bp.
6. Endonuclease heteroduplex mismatch cleavage for detecting 107
Pesq. agropec. bras., Brasília, 49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
A2 subtype, while two varieties from the Institute of
Field and Vegetable Crops had this subtype. Out of the
three wild soybean genotypes, just one had A1 subtype
(Figure 5). Deshimaru et al. (2004) suggests that these
two subtypes for BBI‑A occur from distinct genes in
the wild soybean genome, and not from polymorphic
alleles in the genome.
Conclusions
1. There is a low level of genetic variation in 21‑kD
protein (KTI) and Bowman‑Birk trypsin–chymotrypsin
inhibitor (BBI) between the investigated varieties of
cultivated and wild soybean.
2. The digestion of KTI products with restriction
enzymes show that Tib type of KTI is a dominant type
among the analyzed varieties, but it is not able to detect
differences between ti‑null and other types of Ti alleles.
3. The digestion method with celery extracts (CEL I)
described here provide a simple and useful genetic tool
for single nucleotide polymorphism (SNP) analysis.
Acknowledgments
To the Ministry of Education, Science and
Technological Development of the Republic of Serbia,
for support, by the projects TR‑31024 and TR‑31022.
References
BARROS, B. deA.; SILVA, W.G. da; MOREIRA, M.A.; BARROS,
E.G. de. In silico characterization and expression analysis of the
multigene family encoding the Bowman‑Birk protease inhibitor
in soybean. Molecular Biology Reports, v.39, p.327‑334, 2012.
DOI: 10.1007/s11033‑011‑0742‑1.
BARROS, J.G. de A.; MORAES, R.M.A. de; PIOVESAN, N.D.;
BARROS, E.G. de; MOREIRA, M.A. Efeito do inibidor de
protease Kunitz sobre níveis de lipoxigenases em sementes de
soja. Ciência e Agrotecnologia, v.32, p.1126‑1132, 2008. DOI:
10.1590/S1413-70542008000400014.
CHEN, L.; WANG, S.‑Q.; HU, Y.‑G. Detection of SNPs in the
VRN‑A1 gene of common wheat (Triticum aestivum L.) by a
modified Ecotilling method using agarose gel electrophoresis.
Australian Journal of Crop Science, v.5, p.318‑326, 2011.
CRUZ, A.C.B.; MASSENA, F.S.; MIGLIOLO, L.;
MACEDO, L.L.P.; MONTEIRO, N.K.V.; OLIVEIRA, A.S.;
MACEDO, F.P.; UCHOA, A.F.; GROSSI DE SÁ, M.F.;
VASCONCELOS, I.M.; MURAD, A.M.; FRANCO, O.L.;
SANTOS, E.A. Bioinsecticidal activity of a novel Kunitz trypsin
inhibitor from Catanduva (Piptadenia moniliformis) seeds.
Plant Physiology and Biochemistry, v.70, p.61‑68, 2013. DOI:
10.1016/j.plaphy.2013.04.023.
DESHIMARU, M.; YOSHIMI, S.; SHIOI, S.; TERADA, S.
Multigene family for Bowman‑Birk type proteinase inhibitors
of wild soja and soybean: the presence of two BBI‑A genes and
pseudogenes. Bioscience, Biotechnology, and Biochemistry,
v.68, p.1279‑1286, 2004. DOI: 10.1271/bbb.68.1279.
FUSARI,C.M.;LIA,V.V.;NISHINAKAMASU,V.;ZUBRZYCKI,
J.E.; PUEBLA,A.F.; MALIGNE,A.E.; HOPP, H.E.; HEINZ, R.A.;
PANIEGO, N.B. Single nucleotide polymorphism genotyping
by heteroduplex analysis in sunflower (Helianthus annuus L.).
Molecular Breeding, v.28, p.73‑89, 2011. DOI: 10.1007/
s11032‑010‑9462‑9.
GALEANO, C.H.; GOMEZ, M,; RODRIGUEZ, L.M.; BLAIR,
M.W. CEL I nuclease digestion for SNP discovery and marker
development in common bean (Phaseolus vulgaris L.). Crop
Science,v.49,p.381‑394,2009.DOI:10.2135/cropsci2008.07.0413.
HYMOWITZ, T. Electrophoretic analysis of SBTI‑A2 in the USDA
soybean germplasm collection. Crop Science, v.13, p.420‑421,
1973. DOI: 10.2135/cropsci1973.0011183X001300040008x.
JOFUKU, K.D.; GOLDBERG, R.B. Kunitz trypsin inhibitor
genes are differently expressed during soybean life cycle and in
transformed tobacco plants. The Plant Cell, v.1, p.1079‑1093,
1989. DOI: 10.1105/tpc.1.11.1079.
JOFUKU, K.D.; SCHIPPER, R.D.; GOLDBERG, R.B.
A frameshift mutation prevents Kunitz trypsin inhibitor mRNA
accumulation in soybean embryos. The Plant Cell, v.1, p.427‑435,
1989. DOI: 10.2307/3869103.
KIM, D.S.; LEE, K.J.; KIM, J.‑B.; KIM, S.H.; SONG, J.Y.; SEO,
Y.W.; LEE, B.‑M.; KANG S.‑Y. Identification of Kunitz trypsin
inhibitor mutations using SNAP markers in soybean mutant lines.
Theoretical and Applied Genetics, v.121, p.751‑760, 2010. DOI:
10.1007/s00122‑010‑1346‑1.
KRISHNAN, H.B. Characterization of a soybean [Glycine
max (L.) Merr.] mutant with reduced levels of Kunitz trypsin
inhibitor. Plant Science, v.160, p.979‑986, 2001. DOI: 10.1016/
S0168‑9452(01)00346‑6.
KUROYANAGI, M.; KATAYAMA, T.; IMAI, T.; YAMAMOTO,
Y.; CHISADA, S.;, YOSHIURA, Y.; USHIJIMA, T.;
MATSUSHITA, F.; NOZAWA, A.; SUZUKI, Y.; KIKUCHI, K.;
OKAMOTO, H. New approach for fish breeding by chemical
mutagenesis: establishment of TILLING method in fugu (Takifugu
rubripes) with ENU mutagenesis. BMC Genomics, v.14, n.786,
2013. DOI: 10.1186/1471‑2164‑14‑786.
LEE, K.J.; KIM, J.‑B.; HA, B.‑K.; KIM, S.H.; KANG, S.‑Y.;
LEE, B.‑M.; KIM, D.S. Proteomic characterization of Kunitz
trypsin inhibitor variants, Tia and Tib, in soybean [Glycine max
(L.) Merrill]. Amino Acids, v.43, p.379‑388, 2012. DOI: 10.1007/
s00726‑011‑1092‑y.
LIVINGSTONE, D.; VADIM, B.; MARINA, K.; MONICA, A.S.;
ELIO, M.H.; NIELS, C.N. Reduction of protease inhibitor activity
by expression of a mutant Bowman‑Birk gene in soybean seed.
Plant Molecular Biology, v.64, p.397‑408, 2007. DOI: 10.1007/
s11103‑007‑9163‑x.
MEYER, R.; CHARDONNENS, F.; HÜBNER, P.; LÜTHY,
J. Polymerase chain reaction (PCR) in the quality and safety
assurance of food: detection of soya in processed meat products.
7. 108 G. Petrović et al.
Pesq. agropec. bras., Brasília, v.49, n.2, p.102-108, fev. 2014
DOI: 10.1590/S0100-204X2014000200004
Zeitschrift für Lebensmittel‑Untersuchung und‑Forschung A,
v.203, p.339‑344, 1996. DOI: 10.1007/BF01231072.
OLEYKOWSKI, C.A.; MULLIS, C.R.B.; GODWIN, A.K.;
YEUNG,A.T. Mutation detection using a novel plant endonuclease.
Nucleic Acids Research, v.26, p.4597‑4602, 1998. DOI: 10.1093/
nar/26.20.4597.
ORF, J.H.; HYMOWITZ, T. Inheritance of the absence of the
Kunitz trypsin inhibitor in seed protein of soybeans. Crop Science,
v.19, p.107‑109, 1979. DOI: 10.2135/cropsci1979.0011183X0019
00010026x.
RAGHAVAN, C.; NAREDO, M.E.B.; WANG, H.; ATIENZA, G.;
LIU, B.; QIU, F.; McNALLY, K.L.; LEUNG, H. Rapid method for
detecting SNPs on agarose gels and its application in candidate
gene mapping. Molecular Breeding, v.19, p.87‑101, 2007. DOI:
10.1007/s11032‑006‑9046‑x.
RAKASHANDA, S.; AMIN, S. Proteases as targets in anticancer
therapy using their inhibitors. Journal of Life Sciences, v.5,
p.133‑138, 2013.
SONG, J.Y.; PIAO, X.‑M.; CHOI, Y.‑M.; LEE, G.‑A.; CHUNG,
J.‑W.; LEE, J.‑R.; JUNG, Y.; PARK, H.‑J.; LEE, M.C. Evaluation
of genetic diversity and comparison of biochemical traits of
soybean (Glycine max L.) germplasm collections. Plant Breeding
and Biotechnology, v.1, p.374‑384, 2013. DOI: 10.9787/
PBB.2013.1.4.374.
TILL, B.J.; ZERR, T.; BOWERS, E.; GREENE, E.A.; COMAI, L.;
HENIKOFF, S. High‑throughput discovery of rare human
nucleotide polymorphisms by Ecotilling. Nucleic Acids Research,
v.34, p.e99, 2006. DOI: 10.1093/nar/gkl479.
WANG, K.J.; LI, X.H.; TAKAHATA, Y.; YAMASHITA, T. Allelic
diversity and geographical pattern at soybean Kunitz trypsin
inhibitor single locus in Chinese wild soybean (Glycine soja Sieb.
& Zucc.). Plant Breeding, v.129, p.264‑270, 2010. DOI: 10.1111/j.
1439‑0523.2009.01734.x.
WANG, K.J.; TAKAHAKA, Y.; KONO, Y,; KAIZUMA, N. Allelic
differentiation of Kunitz trypsin inhibitor in wild soybean (Glycine
soja). Theoretical and Applied Genetics, v.117, p.565‑573, 2008.
DOI: 10.1007/s00122‑008‑0800‑9.
WANG, K.J.; YAMASHITA, T.; WATANABE, M.; TAKAHATA,
Y. Genetic characterization of a novel Tib‑derived variant of
soybean Kunitz trypsin inhibitor detected in wild soybean (Glycine
soja). Genome, v.47, p.9‑14, 2004. DOI: 10.1139/g03‑087.
WANG, Y.P.; CHEN, X.T.; QIU, L.J. Novel alleles among soybean
Bowman‑Birk proteinase inhibitor gene families. Science in China
Series C ‑ Life Sciences, v.51, p.687‑692, 2008. DOI: 10.1007/
s11427‑008‑0096‑7.
YANG,W.;BAI,X.D.;KABELKA,E.;EATON,C.;KAMOUN,S.;
VAN DER KNAAP, E.; DAVID, F. Discovery of single nucleotide
polymorphisms in Lycopersicon esculentum by computer aided
analysis of expressed sequence tags. Molecular Breeding, v.14,
p.21‑34, 2004. DOI: 10.1023/B:MOLB.0000037992.03731.a5.
ZHAO, S.W.; WANG, H. A new electrophoretic variant of
SBTi‑A2 in soybean seed protein. Soybean Genetics Newsletter,
v.19, p.22‑24, 1992.
ZOLALA, J.; BAHRAMI, A.‑R.; FARSI, M.; MATIN, M.M.;
YASSAEE, V.‑R. Comparison of CEL I gene expression and
mismatch‑cleavage activity in some Apiaceae plants. Molecular
Breeding, v.24, p.17‑24, 2009. DOI: 10.1007/s11032‑009‑9267‑x.
Received on October 2, 2013 and accepted on January 30, 2014