This document discusses multiparameter flow cytometry techniques for detecting leukaemia-associated phenotypes (LAPs) and minimal residual disease (MRD) in acute myeloid leukemia (AML). It finds that 64% of AML patients displayed LAPs, which were independent markers for predicting poor response to induction chemotherapy and relapse. The document also describes methods for detecting MRD, including multiparameter flow cytometry and polymerase chain reaction, and how MRD detection could facilitate early detection of relapse and guide risk-adapted therapies.

1. Multiparameter Flow Cytometry TechniquesMultiparameter Flow Cytometry Techniques
for the Detection of Leukaemia Associatedfor the Detection of Leukaemia Associated
Phenotypes and Minimal Residual DiseasePhenotypes and Minimal Residual Disease
Monitoring In Acute Myeloid LeukaemiaMonitoring In Acute Myeloid Leukaemia
Adhra Al-Mawali, PhDAdhra Al-Mawali, PhD
Director/ Centre of Studies and ResearchDirector/ Centre of Studies and Research
Ministry of HealthMinistry of Health
Institute of Medical and Veterinary Science (SA pathology)Institute of Medical and Veterinary Science (SA pathology)
Hanson InstituteHanson Institute
Divisions of Haematology and Human ImmunologyDivisions of Haematology and Human Immunology
University of AdelaideUniversity of Adelaide

2. OutlineOutline
 Leukaemia Associated Phenotypes (LAPs)Leukaemia Associated Phenotypes (LAPs)
 Correlation of LAPs with prognosis in AMLCorrelation of LAPs with prognosis in AML
 Sensitivity & Specificity of Flow Cytometry.Sensitivity & Specificity of Flow Cytometry.
 Minimal Residual Disease (MRD)Minimal Residual Disease (MRD)
 Correlation of MRD presence with prognosis inCorrelation of MRD presence with prognosis in
AML.AML.
 Novel Findings in Stem Cells and their use as aNovel Findings in Stem Cells and their use as a
unique MRD single phenotype.unique MRD single phenotype.

3. BackgroundBackground
Acute myeloid leukaemia (AML):Acute myeloid leukaemia (AML):
 life threatening neoplasmlife threatening neoplasm
 uncontrolled proliferation of myeloblastsuncontrolled proliferation of myeloblasts
 AML comprises about 40% of leukemias in the Western world.AML comprises about 40% of leukemias in the Western world.
Approximately 6500 cases are diagnosed in adults in the USApproximately 6500 cases are diagnosed in adults in the US
annually.annually.
 ~ 25% of all leukaemias in adults and in Oman around (34%) of~ 25% of all leukaemias in adults and in Oman around (34%) of
all leukameias. (Leukaemia research. Vol 24(7) page 589-594.all leukameias. (Leukaemia research. Vol 24(7) page 589-594.
Despite advances in therapy of AML- majority of patientsDespite advances in therapy of AML- majority of patients
relapse and die from disease.relapse and die from disease.
With modern chemotherapyWith modern chemotherapy
 CR achieved in up to 80% of younger adultsCR achieved in up to 80% of younger adults
 but long term survival rates are as low as 30%-40%.but long term survival rates are as low as 30%-40%.
 Management of AML - a therapeutic challenge due to theManagement of AML - a therapeutic challenge due to the
presence of minimal residual disease (MRD)presence of minimal residual disease (MRD)

4. ImmunophenotypingImmunophenotyping
AML - outcome predicted by clinical, morphologicalAML - outcome predicted by clinical, morphological
and molecular markers.and molecular markers.
The immunophenotype of leukaemic cells providesThe immunophenotype of leukaemic cells provides
another parameteranother parameter
Role as a predictor of outcome:Role as a predictor of outcome:
NOT CLEARLY DEFINED.NOT CLEARLY DEFINED.

5. ImmunophenotypingImmunophenotyping
Identification of cells based on the types ofIdentification of cells based on the types of
antigens on the surface of the cell.antigens on the surface of the cell.
Used to diagnose leukaemia by comparingUsed to diagnose leukaemia by comparing
malignant cells to normal cells.malignant cells to normal cells.
Analysis by using flow cytometryAnalysis by using flow cytometry..

6. Flow CytometryFlow Cytometry

7. Flow CytometryFlow Cytometry
TheThe measurementmeasurement (meter)(meter) of aof a cellcell (cyto)(cyto) asas
itit flowsflows past a laser light source.past a laser light source.
The science of antigen/marker investigationThe science of antigen/marker investigation
of individual cells.of individual cells.

8. Detection of antigens on cellDetection of antigens on cell
surfacesurface

9. Leukaemia-associatedLeukaemia-associated
phenotypes (LAPs)phenotypes (LAPs)
Comparison of leukaemic with normal
bone marrow cells has revealed 5
patterns of aberrant expressions:
(1) lineage infidelity
(2) asynchronous antigen expression
(3) antigen over-expression
(4) aberrant light-scatter properties
(5) absence of lineage specific antigens

10. Literature in LAPsLiterature in LAPs
Incidence of aberrant phenotypes in AML varies betweenIncidence of aberrant phenotypes in AML varies between
studies.studies.
Few studies - some LAPs have an association withFew studies - some LAPs have an association with
prognosis / response to treatment.prognosis / response to treatment.
No previous studies have addressed the prognosticNo previous studies have addressed the prognostic
impact of LAPs in relapse.impact of LAPs in relapse.

11. Literature in proportion of LAPsLiterature in proportion of LAPs
Year Study % of LAP
2001 Bahia et al 88%
1993 Reading et al 85%
2003 Voskova et al 85%
1995 Macedo et al 73%
1996 Babusikova et al 42%
2002 Zhu H et al 30%

12. AimsAims
1.1. To determine the frequency of LAPs in AML at RoyalTo determine the frequency of LAPs in AML at Royal
Adelaide Hospital-Australia.Adelaide Hospital-Australia.
2.2. To correlate the presence of LAPS with response toTo correlate the presence of LAPS with response to
induction chemotherapy and relapse.induction chemotherapy and relapse.

13. Methods & MaterialsMethods & Materials
Selection criteria:Selection criteria:
1.1. 84 Fresh Bone marrow samples84 Fresh Bone marrow samples
2.2. ConsecutiveConsecutive
3.3. UnselectedUnselected
4.4. Newly diagnosedNewly diagnosed
5.5. Untreated AML patientsUntreated AML patients
6.6. Obtained at diagnosis.Obtained at diagnosis.
7.7. Diagnosis was based on MCIDiagnosis was based on MCI

14. Statistical analysisStatistical analysis
A log binomial model.A log binomial model.
Outcomes of interest:Outcomes of interest:
– response to treatment vs no response.response to treatment vs no response.
– relapse vs no relapse.relapse vs no relapse.
LAP positive or LAP negative as a predictor.LAP positive or LAP negative as a predictor.
Confounders identified:Confounders identified:
– age at diagnosis, gender, cytogenetics risk group, deage at diagnosis, gender, cytogenetics risk group, de
novo or secondary AML , WBC count.novo or secondary AML , WBC count.
Both unadjusted and adjusted risk ratios.Both unadjusted and adjusted risk ratios.

15. ResultsResults

16. 64% were LAP+ (95% CI, 0.53- 0.74)64% were LAP+ (95% CI, 0.53- 0.74)

17. Aberrant phenotype No. of cases (%)
Lineage infidelity
CD7 14 (26)
CD10 2 (4)
CD2* 1 (2)
CD4* 1 (2)
CD19 1 (2)
Total 19 (36)
Asynchronous antigen expression
CD117+/CD15+ 7 (13)
CD34+/CD56+ 11 (21)
CD34+/CD15+ 7 (13)
CD34+/CD117+/CD15+ 4 (8)
Total 29 (55)
Lack of lineage specific antigen
CD33+/CD13- 9 (17)
CD13+/CD33- 10 (19)
Total 19 (36)

18. Dual parameter contour plot histogramsDual parameter contour plot histograms
of an AML patient with asynchronousof an AML patient with asynchronous
antigen expression and lineageantigen expression and lineage
infidelityinfidelity
Al-Mawali A,. The presence of leukaemia-associated phenotypes is an independent predictor of induction
failure in acute myeloid leukaemia. International Journal of Laboratory Hematology. 2009 Feb; 31(1):61-8.

19. Correlation of LAPs and response toCorrelation of LAPs and response to
induction chemotherapyinduction chemotherapy
Total no. of Patients = 84
Receive induction
chemotherapy = 59
Did not receive induction
chemotherapy = 25
LAP positive = 37 LAP negative = 21
Achieved CR=18
Did not achieve CR=19
Achieved CR=17
Did not achieve CR=4
P= 0.01

20. The presence of LAP is associatedThe presence of LAP is associated
with a poor response to inductionwith a poor response to induction
therapytherapy
The absence of LAPs strongly predictiveThe absence of LAPs strongly predictive
for achievement of CR (P = 0.01)for achievement of CR (P = 0.01)
Presence of LAPs predicted for anPresence of LAPs predicted for an
adverse outcome (P = 0.04) afteradverse outcome (P = 0.04) after
adjusting for confoundersadjusting for confounders

21. Correlation of LAPs and relapseCorrelation of LAPs and relapse
Patients evaluated
for relapse = 29
LAP positive = 17 LAP negative =12
Relapsed = 8 Remained in CR= 9 Relapsed = 1 Remained in CR= 11
P= 0.04

22. LAPs predict relapse of AMLLAPs predict relapse of AML
Absence of LAPs strongly predictive forAbsence of LAPs strongly predictive for
remaining in CR.remaining in CR.
Only 1 patient LAP negative - had relapsedOnly 1 patient LAP negative - had relapsed
LAP + were at higher risk of relapse with 47%LAP + were at higher risk of relapse with 47%
having relapsed and 53% remaining in CR.having relapsed and 53% remaining in CR.
Non of the confounders were statisticallyNon of the confounders were statistically
significant.significant.
The median follow-up for patients was 36The median follow-up for patients was 36
months (range: 2.5-45)months (range: 2.5-45)

23. LAPs predict relapse of AMLLAPs predict relapse of AML
Relapse Free Survival
Complete remission duration (days)
140
0
120
0
100
0
8006004002000
CumulativeSurviival
1.0
.5
.0
LAP + (n=17)
LAP - (n=12)
P = 0.03
Al-Mawali A,. The presence of leukaemia-associated phenotypes is an independent predictor of induction
failure in acute myeloid leukaemia. International Journal of Laboratory Hematology. 2009 Feb; 31(1):61-8.

24. 64% of AML patients displayed LAPs.64% of AML patients displayed LAPs.
LAPs are independent markers for predictingLAPs are independent markers for predicting
response to induction chemotherapy.response to induction chemotherapy.
LAPs are independent markers for predictingLAPs are independent markers for predicting
relapse.relapse.
ConclusionsConclusions

25. SignificanceSignificance
LAPs may reflect inherent biologicalLAPs may reflect inherent biological
characteristics of the malignancy.characteristics of the malignancy.
LAPs may reflect an underlying dysplasticLAPs may reflect an underlying dysplastic
process predisposing to the malignancy.process predisposing to the malignancy.

26. What is Minimal Residual Disease?What is Minimal Residual Disease?
MRD describes the lowest level of disease detectableMRD describes the lowest level of disease detectable
using available methods after chemotherapy.using available methods after chemotherapy.
MRD is a term used when there is evidenceMRD is a term used when there is evidence (either(either
immunophenotypic, molecular or cytogenetic)immunophenotypic, molecular or cytogenetic) thatthat
leukaemic cells remain in the BM, but there areleukaemic cells remain in the BM, but there are
insufficient cells to be detected by routine examinationinsufficient cells to be detected by routine examination
under the microscope.under the microscope.

27. Minimal Residual Disease (MRD)Minimal Residual Disease (MRD)

28. Usefulness of MRD studiesUsefulness of MRD studies
1.1. Facilitate the early detection of impendingFacilitate the early detection of impending
relapse.relapse.
2.2. May result in risk-adapted therapies.May result in risk-adapted therapies.
3.3. May offer a short-term endpoint to assess theMay offer a short-term endpoint to assess the
effectiveness of new, targeted therapies.effectiveness of new, targeted therapies.

29. If the leukemic cell at diagnosis carries an
antigenic or molecular marker that distinguishes it
from its normal counterpart,
This marker can be used after chemotherapy to
detect residual malignant cells in BM.

30. MRD detection in AMLMRD detection in AML
MRD detection and quantification in childhood
ALL- established & incorporated in paediatric
ALL trials.
(Vidriales et al, Blood 2003, Coustan-Smith E et al, Blood 2000, van Dogen JJ et al, Lancet 1998)
Few studies reported on the clinical value of
MRD detection in AML.
The information provided is still limited. (San Miguel JF,
Blood 2001, Venditti A et al Blood 2000, Feller N et al leukaemia 2004)

31. Ideal approach for MRDIdeal approach for MRD
detectiondetection
1.1. Applicable in most cases.Applicable in most cases.
2.2. Sensitive.Sensitive.
3.3. Specific for neoplastic cell type.Specific for neoplastic cell type.
4.4. Allow quantitation of tumour burden forAllow quantitation of tumour burden for
prognostic purposes.prognostic purposes.
(Provan and Gribben 2005)(Provan and Gribben 2005)
Molecular HematologyMolecular Hematology

32. MRD detection MethodsMRD detection Methods
1.1. Cell culture assaysCell culture assays
2.2. Cytogenetic analysisCytogenetic analysis
3.3. Fluorescence in situ hybridization techniques (FISH).Fluorescence in situ hybridization techniques (FISH).
4.4. Multiparameter Flow Cytometry (MFC)Multiparameter Flow Cytometry (MFC)
5.5. Polymerase Chain Reaction (PCR)Polymerase Chain Reaction (PCR)

33. MRD detection MethodsMRD detection Methods
MRD could be detected with high sensitivity:MRD could be detected with high sensitivity:
1.1. Multiparameter Flow Cytometry (MFC)Multiparameter Flow Cytometry (MFC)
 is based on the premise that leukaemic cells display aberrant phenotypicis based on the premise that leukaemic cells display aberrant phenotypic
features that allow their distinction from normal cells at diagnosis.features that allow their distinction from normal cells at diagnosis.
 The so called “Leukaemia associated phenotypes” (LAPs).The so called “Leukaemia associated phenotypes” (LAPs).
 sensitive 10sensitive 10-4-4
-10-10-5-5
 quantitativequantitative
 relatively cheaprelatively cheap
 Applicable to 75-90% of patients with AML.Applicable to 75-90% of patients with AML.
 Less specific than PCRLess specific than PCR
2.2. Polymerase Chain Reaction (PCR)Polymerase Chain Reaction (PCR)
 sensitive 10sensitive 10-4-4
-10-10-6-6
 applicable only for patients who have molecular abnormalities ~ 30-40%.applicable only for patients who have molecular abnormalities ~ 30-40%.

34. MRD detection by MFCMRD detection by MFC
LAPs are present on all leukemic cells or on a subset of
them, but they are absent or very infrequent on normal BM
cells.
Comparison of leukaemic with normal bone marrow cells
has revealed 5 patterns of aberrant expressions:
(1) lineage infidelity or cross-lineage antigen expression
(2) asynchronous antigen expression
(3) antigen over-expression
(4) aberrant light-scatter properties
(5) absence of lineage specific antigens

35. AimsAims
To assess the advantage of using 5-colour MFC to detectTo assess the advantage of using 5-colour MFC to detect
LAPs in AML at diagnosis.LAPs in AML at diagnosis.
To determine its utility in MRD detection.To determine its utility in MRD detection.
To achieve this we:To achieve this we:
1)1) Analysed the sensitivity of MFCAnalysed the sensitivity of MFC
2)2) Assessed specificity by determining the immunophenotypic profiles ofAssessed specificity by determining the immunophenotypic profiles of
LAPs of AML versus regenerating and normal BMsLAPs of AML versus regenerating and normal BMs
3)3) Determined the incidence of these LAPs in aDetermined the incidence of these LAPs in a
series ofseries of 5454 consecutive, newly diagnosed AML patients.consecutive, newly diagnosed AML patients.

36. MethodsMethods
Five-colour MFCFive-colour MFC
2 panels:2 panels:
– Screening panelScreening panel:: to identify AML from ALL patientsto identify AML from ALL patients
– Secondary panelSecondary panel:: to identify the aberrant phenotypes andto identify the aberrant phenotypes and
track them for MRD studies.track them for MRD studies.

37. Screening PanelScreening Panel
FITC PE PC-5
CD7 CD13 CD45
CD15 CD117 CD45
CD19 CD10 CD45
CD34 CD33 CD45
CD14 CD56 CD45
HLA-DR CD45
MPO CD45
TdT CD45
S NEG CD45

38. FITC PE ECD PC-5 PC-7
Control FITC Control PE CD45 Control PC-5 Control PC-7
CD2 CD56 CD45 CD34 CD117
CD7 CD33 CD45 CD34 CD117
CD14 CD11b CD45 CD34 CD117
CD15 CD33 CD45 CD34 CD117
CD65 CD33 CD45 CD34 CD117
CD33 CD13 CD45 CD34 CD117
CD64 CD33 CD45 CD34 CD117
CD19 CD10 CD45 CD34 CD117
CD38 CD123 CD45 CD34 CD117
Secondary PanelSecondary Panel

39. Establishment of a LAPEstablishment of a LAP
1. Defining of AML blasts in the WBC compartment
No gate: WBC compartment is gated based on
CD45 expression and FSC (R1).
Gated on R1, Cell fragments and/or dead cells
can be further excluded in SSC/FSC plot (R2) &
to ensure homogeneity of blast populations.
2. Backgating steps of cells showing CD34+
CD117+
CD45dim
Backgating on CD34+
cells Part of the AML blasts show CD34 expression
(R4). These CD34+
cells show a dim CD45
expression.
Backgating on CD117+
cells Part of the AML blasts show CD117
expression (R10). These CD117+
cells show a
dim CD45 expression.

40. Backgating on CD7+
cells Gated on R2+
, showing CD7+
cells position on
CD45+
cells, some of these cells are T-
Lymphocytes and some are in the blasts
population, Gate R6 including only cells in the
blast population
3. LAP expression on AML Blasts
Gated on R6, showing cells coexpressing
CD34
+
CD7
+
, The CD34
+
cells which show
CD45 dim expression show CD7
expression, which defines the LAP
Gated on R6, showing cells co-
expressing CD117
+
CD7
+
, The CD117
+
cells which show CD45dim expression show
CD7 expression, which defines the LAP

41. 1) “1) “In VitroIn Vitro” Sensitivity of” Sensitivity of
MFCMFC
To determine the level of sensitivity of MFC for the
detection of leukaemic cells when present at very
low frequencies - 8 serial dilutional experiments
were performed.
The dilutions covered a range from 50% to
0.001%.
At least one aberrant leukaemic cell among 104
and 105
normal haemopoietic cells could be
detected.

42. Sensitivity of MFCSensitivity of MFC
A) 1:1 dilution 24%
leukaemic cells
(CD34+
CD56+
)
B) 1:10 dilution
3.4x10-1
leukaemic
cells (CD34+
CD56+
)
C) 1:100 dilution
4.8x10-2
leukaemic
cells (CD34+
CD56+
)
D) 1:1000 dilution
5.1x10-3
leukaemic cells
(CD34+
CD56+
)
E) 1:10000
dilution 7.1x10-4
leukaemic cells
(CD34+
CD56+
)
F) No dilution Normal
BM 3.8x 10-5
(CD34+
CD56+
)

43. Assessment Of Linearity and reproducibility Of
Sensitivity Experiments
1) Linearity 2) Reproducibility
Al-Mawali A, Incidence, Sensitivity and Specificity of Leukaemia Associated Phenotypes in Acute Myeloid Leukaemia Patients using
Specific Five-Colour Multiparameter Flow Cytometry. American Journal of Clinical Pathology, 2008; 129(6): 934-45.

44. 2) Specificity: LAPs expression in normal and regenerating
bone marrow cells
LAPs are extremely rare in normal and regenerating BMs
• MFC analysis showed no differences in expression of these LAP
characteristic cells in normal and regenerating BM (p = 0.2).

45. 0.000
0.020
0.040
0.060
0.080
0.100
0.120
CD56+CD2+ CD34+CD11b+ CD34+CD15+ CD34+CD56+ CD34+CD64+ CD34+CD65+ CD117+CD11b+ CD117+CD15+
Lymphoid associated antigens
Total%ofLAPS
Normal BM Regenerating BM

46. 0.000
0.020
0.040
0.060
0.080
0.100
0.120
C
D
56+C
D2+C
D
34+C
D11b+
C
D
34+C
D15+
C
D
34+C
D56+
C
D
34+C
D64+
C
D
34+C
D65+C
D
117+C
D
11b+C
D
117+C
D
15+C
D
117+C
D
56+C
D
117+C
D
64+C
D
117+C
D
65+
Asynchronous Antigen expression
Total%ofLAPs
Normal BM Regenerating BM
Al-Mawali A, Incidence, Sensitivity and Specificity of Leukaemia Associated Phenotypes in Acute Myeloid Leukaemia Patients using
Specific Five-Colour Multiparameter Flow Cytometry. American Journal of Clinical Pathology, 2008; 129(6): 934-45.

47. Patient characteristicsPatient characteristics
Patient characteristics Total
No. patients 54
Male/ female 37/17
Age at diagnosis, mean, (range) 58(18-85)
WBC count at diagnosis × 109
/L, median (range) 5.6(0.26-179)
Haemoglobin at diagnosis g/L, median (range) 94(52-143)
Platelets at diagnosis × 109
/L, median (range) 61(11-241)
BM blasts % by morphology, median (range) 42(19-96)
BM blasts % by MFC, median (range) 36(7-86)
AML de novo/secondary n (%) 42(78) / 12(22)
FAB classification, n (%)
Mo 0 (0)
M1 9 (17)
M2 11 (21)
M3 2 (4)
M4 9 (17)
M5 5 (9)
M6 1 (2)
M7 1 (2)
Not classified 16 (30)
Cytogenetic risk group 22
, n (%)
Favourable 9 (17)
Intermediate 25 (46)
Poor 17 (31)
No metaphases 3 (6)

48. 3) Incidence of LAPs in AML patients3) Incidence of LAPs in AML patients
0
2
4
6
8
10
12
14
One Two Three Four Five Six Seven Eight Nine Ten
Number of aberrant immunophenotypes
Numberofcases
Overall, 94% (n=51) of the AML patients displayed LAPs at diagnosis.
• Analysing the data using the standard panel used at our institution by three-
colour staining, LAPs were only observed in 79.6 % ( p<0.05)

49. Frequencies of LAPs in AML patients (n = 51)Frequencies of LAPs in AML patients (n = 51)
LAPs (LAPs=243) No. of
cases
% Positive cells in
AML BM (range)
Lineage infidelity (n=40)
CD34
+
CD2
+
5 26-92
CD34
+
CD7
+
12 11-88
CD34
+
CD10
+
1 22
CD34
+
CD19
+
2 24-65
CD117
+
CD2
+
5 13-91
CD117
+
CD7
+
11 18-90
CD117
+
CD10
+
1 17
CD117
+
CD19
+
2 15-53
CD34
+
GlycoA
+
0 0
CD117
+
GlycoA
+
1 30
Asynchronous Antigen expression (n=146)
CD34
+
CD11b
+
11 11-80
CD34
+
CD14
+
0 0
CD34
+
CD15
+
20 10-36
CD34
+
CD56
+
5 29-84
CD34
+
CD64
+
6 10-49
CD34
+
CD65
+
15 11-63
CD117
+
CD11B
+
10 12-62
CD117
+
CD14
+
0 0
CD117+
CD15+
25 10-55
CD117+
CD56+
6 11-80
CD117
+
CD64
+
9 11-70
CD117+
CD65+
22 10-62
CD33
+
CD15
+
2 80-94
CD33
+
CD64
+
5 18-97
CD33+
CD65+
5 10-99
CD33
+
CD11b
+
3 20-26
CD33
+
CD56
+
2 10-78
Antigen overexpression (n=43)
HLA-DR
++
11 95-100
CD34
++
10 95-99
CD117++
3 96-99
CD13
++
9 96-99
CD33
++
10 96-99
Lack of lineage specific antigen (n=14)
CD33
++
CD13
-
5 93-99
CD33
-
CD13
++
9 25-98
Application of the extensive panel of monoclonal antibodies resulted inApplication of the extensive panel of monoclonal antibodies resulted in
the identification of 243 LAPs within the 51 LAP positive patients.the identification of 243 LAPs within the 51 LAP positive patients.

50. % LAPs in AML
% positive cells
in normal BM (n=10)
Log difference
% positive cells in
regenerating BM (n=5)
Log difference
LAPs No. of cases
min max median min max median min max
CD34+
CD2+
5 26 92 0.001 4.41 4.96 0.004 3.81 4.36
CD34+
CD7+
12 11 88 0.002 3.74 4.64 0.004 3.49 4.39
CD34+
CD10+
1 22 22 0.012 3.26 3.26 0.035 2.79 2.79
CD34+
CD19+
2 24 65 0.002 4.08 4.51 0.003 3.96 4.39
CD117+
CD2 5 13 91 0.003 3.64 4.48 0.003 3.70 4.54
CD117+
CD7+
11 18 90 0.003 3.78 4.48 0.006 3.48 4.18
CD117+
CD10+
1 17 17 0.001 4.23 4.23 0.003 3.75 3.75
CD117+
CD19+
2 15 53 0.002 3.88 4.42 0.004 3.63 4.18
CD34+
GlycoA+
0 0 0 0.000 NC§
NC§
0.053 NC§
NC§
CD117+
GlycoA+
1 30 30 0.001 4.48 4.48 0.015 3.31 3.31
CD34+
CD11b+
11 11 80 0.002 3.74 4.60 0.002 3.74 4.60
CD34+
CD14+
0 0 0 0.000 NC§
NC§
0.002 NC§
NC§
CD34+
CD15+
20 10 36 0.004 3.40 3.95 0.012 2.92 3.48
CD34+
CD56+
5 29 84 0.001 4.46 4.92 0.001 4.35 4.81
CD34+
CD64+
6 10 49 0.051 2.29 2.98 0.086 2.06 2.75
CD34+
CD65+
15 11 63 0.013 2.93 3.69 0.057 2.29 3.05
CD117+
CD11B+
10 12 62 0.002 3.78 4.49 0.001 4.08 4.79
CD117+
CD14+
0 0 0 0.000 NC§
NC§
0.001 NC§
NC§
CD117+
CD15+
25 10 55 0.010 3.00 3.74 0.017 2.76 3.50
CD117+
CD56+
6 11 80 0.003 3.56 4.43 0.002 3.74 4.60
CD117+
CD64+
9 11 70 0.067 2.22 3.02 0.040 2.44 3.24
CD117+
CD65+
22 10 62 0.007 3.15 3.95 0.028 2.55 3.34
Median 11 62 0.002 3.74 4.43 0.004 3.48 4.18
Min 0 0 0 2.22 2.98 0.001 2.06 2.75
Max 30 92 0.067 4.48 4.96 0.086 4.35 4.81
These markers represent a reasonable percentage of ourThese markers represent a reasonable percentage of our
cohort: CD2 (9%) , CD56 (17%), CD7(28%), CD11b (14%)cohort: CD2 (9%) , CD56 (17%), CD7(28%), CD11b (14%)
and CD19 (4%)and CD19 (4%)
24 (44%) of the cases express at least one of the most24 (44%) of the cases express at least one of the most
sensitive LAPs: CD2, CD56,CD7, CD11b and CD7.sensitive LAPs: CD2, CD56,CD7, CD11b and CD7.
Our data shows that CD2, CD56, CD7, CD19 and CD11b are theOur data shows that CD2, CD56, CD7, CD19 and CD11b are the
most useful markers for detection of MRDmost useful markers for detection of MRD
Most useful sensitive markers forMost useful sensitive markers for
MRDMRD

51. ConclusionsConclusions
 LAPs can be detected in virtually all patientsLAPs can be detected in virtually all patients
at diagnosis.at diagnosis.
CD2, CD56 , CD11b, CD7 and CD19 are theCD2, CD56 , CD11b, CD7 and CD19 are the
most sensitive immunophenotypes whenmost sensitive immunophenotypes when
present in AML blasts.present in AML blasts.
Sensitivity level of immunophenotypingSensitivity level of immunophenotyping
ranges between 10ranges between 10-4-4
and 10and 10-5-5
..
The approach is highly reproducible.The approach is highly reproducible.

53. Detection Of MRD In AML Identifies Patients WithDetection Of MRD In AML Identifies Patients With
High Risk Of RelapseHigh Risk Of Relapse
Hypothesis:Hypothesis:
Presence of MRD post chemotherapyPresence of MRD post chemotherapy
predicts worse prognosispredicts worse prognosis

54. AimsAims
To determine the impact of MRD on clinicalTo determine the impact of MRD on clinical
outcome.outcome.
To determine the optimal threshold valueTo determine the optimal threshold value
(capable to split patients into 2 groups in terms of(capable to split patients into 2 groups in terms of
residual leukaemic cells and relapse status).residual leukaemic cells and relapse status).
To establish what time point is better to predictTo establish what time point is better to predict
outcome, (i.e. post induction or post consolidationoutcome, (i.e. post induction or post consolidation
chemotherapy).chemotherapy).

55. Samples analysed by flow cytometry
at diagnosis, n = 54 patients
Patients received chemotherapy,
n = 31
Patients did not receive chemotherapy,
n = 23
Old, n = 8
Old & secondary AML,
n = 7
Patients died before
chemotherapy, n = 3
Went back to their
home state, n = 2
Secondary, n = 2
Patient refused
chemotherapy , n = 1
Refractory to chemotherapy
n = 4
Patients achieving CR
n = 27 ( 87%)
Patients evaluable for MRD post
induction, n = 25
Patient died after induction,
n = 1
LAP negative, n = 2
Patients didn’t receive consolidation,
n = 2
Patients evaluable for MRD post
consolidation I,II, III, IV & V, n = 22
AML samples analysed by MFC at diagnosisAML samples analysed by MFC at diagnosis

56. Pt. 1
MRD detection of a relapsing patient and of a patient still in
remission
A) B)
C)
D)
A) B)
C)
D)
0.78% 0.42% 0.64%
0.12% 0.15% 0.13%
24%
0.09%
52%
32%
BM: AML at diagnosis after Induction after consolidation I after consolidation II Follow-up
Pt. 2
Al-Mawali A, Gillis D, Lewis ID. The use of Receiver Operating Characteristic analysis for detection of Minimal Residual Disease
using Five-colour Multiparameter Flow Cytometry in Acute Myeloid Leukaemia Identifies Patients with High Risk of Relapse. Clinical
Cytometry (Part B), 2009 Mar;76(2):91-101.

57. Establishing the optimal threshold value for MRDEstablishing the optimal threshold value for MRD++
vsvs
MRDMRD--
100%-Specificity% Sensitivity%
0.000 11.111
0.000 22.222
0.000 33.333
9.090 44.444
9.090 55.555
18.181 55.555
18.181 66.666
18.181 77.777
27.272 88.888
36.363 88.888
45.454 88.888
54.545 88.888
63.636 88.888
72.727 100.000
81.818 100.000
90.909 100.000
Cutoff Sensitivity% Specificity% Likelihood
ratio
>0.0650 44.440 90.910 4.89
>0.0750 55.560 90.910 6.11
>0.0850 55.560 81.820 3.06
>0.0950 66.670 81.820 3.67
>0.1150 77.780 81.820 4.28
>0.1450 88.890 72.730 3.26
>0.2600 88.890 63.640 2.44
>0.3750 88.890 54.550 1.96
>0.4000 88.890 45.450 1.63
>0.4200 88.890 36.360 1.40
>0.4550 100.000 27.270 1.38
>0.5000 100.000 18.180 1.22
>0.5400 100.000 9.091 1.10
Sensitivity
Al-Mawali A, Gillis D, Lewis ID. The use of Receiver Operating Characteristic analysis for detection of Minimal Residual Disease
using Five-colour Multiparameter Flow Cytometry in Acute Myeloid Leukaemia Identifies Patients with High Risk of Relapse. Clinical
Cytometry (Part B), 2009 Mar;76(2):91-101.

58. Establishing the optimal threshold that can split patients into 2Establishing the optimal threshold that can split patients into 2
groups with residual leukaemic cells in terms of relapse statusgroups with residual leukaemic cells in terms of relapse status

60. Patients evaluable for Induction therapy,
n=25
MRD-
≤ 0.15% MRD+
> 0.15%
18 patients (72%) 7 patients (28%)
Deceased = 2 (29%)
Relapsed = 5 (71%)
Median = 12.9 months (range 1.4-18.2)
Deceased = 1 (6%)
Relapsed = 8 (44%)
Median = 24.7 months (range 9.5-51.1)
Remained in CR = 9 (50%)
Median = 18.5 months (range 1.8-25.1)
Remained in CR = 0 (0%)
-
Detection of MRD in bone marrow post inductionDetection of MRD in bone marrow post induction
P = 0.048

61. Relapse free survival and Overall survival for patients with MRDRelapse free survival and Overall survival for patients with MRD
post induction chemotherapypost induction chemotherapy
MRDMRD++
patients post induction chemotherapy hadpatients post induction chemotherapy had
significantly shorter duration of RFS and OSsignificantly shorter duration of RFS and OS

62. Detection of MRD in bone marrow post consolidationDetection of MRD in bone marrow post consolidation
Patients evaluable post consolidation therapy, n =
22
MRD-
≤0.15% MRD+
>0.15%
13 patients (59%) 9 patients (41%)
Relapsed= 8 (89%)
Median = 15.5 months (range 5.7-51.1)
Deceased = 2 (15%)
Relapsed = 3 (23%)
Median = 24.5 months (range 18.2-31.8)
Remained in CR= 8 (62%)
Median = 13.6 months (range 1.8-25.1)
Remained in CR = 1 (11%)
P = 0.009
Al-Mawali A, Gillis D, Lewis ID. The use of Receiver Operating Characteristic analysis for detection of Minimal Residual Disease
using Five-colour Multiparameter Flow Cytometry in Acute Myeloid Leukaemia Identifies Patients with High Risk of Relapse. Clinical
Cytometry (Part B), 2009 Mar;76(2):91-101.

63. Relapse free survival and Overall survival for patientsRelapse free survival and Overall survival for patients
with MRD post consolidation chemotherapywith MRD post consolidation chemotherapy
MRDMRD++
patients post consolidation chemotherapy hadpatients post consolidation chemotherapy had
shorter duration of RFS but not OSshorter duration of RFS but not OS

64. Prognostic determinants in multivariatePrognostic determinants in multivariate
analysisanalysis
Post-Ind MRDPost-Ind MRD++
status was found to be an independentstatus was found to be an independent
variable significantly associated with:variable significantly associated with:
a higher frequency of relapse (a higher frequency of relapse (PP = 0.048)= 0.048)
a shorter duration of RFS (a shorter duration of RFS (PP = 0.04) with an estimated= 0.04) with an estimated
hazard ratio of 4.7 (95% CI, 1.1-20.5).hazard ratio of 4.7 (95% CI, 1.1-20.5).
a shorter duration of OS (a shorter duration of OS (PP = 0.03) with an estimated= 0.03) with an estimated
hazard ratio of 5.2 (95% CI, 1.2- 22.2).hazard ratio of 5.2 (95% CI, 1.2- 22.2).

65. ConclusionsConclusions
 Implementation of five-colour flow cytometry significantly improves the
MFC-based MRD quantification.
 The threshold of MRD level of 0.15% is valid in discriminating risk
categories in adult AML.
 Patients in morphological CR who have detectable MRD remaining
after induction chemotherapy have a worse prognosis.
 Post induction MRD assessment is critical to predict disease outcome.
 AML patients in whom MRD is not detectable after induction treatment
and who remain MRD negative at the end of post-consolidation
chemotherapy have superior RFS and OS.

66. Future applications of MRDFuture applications of MRD
studiesstudies
MRD may in future provide the biological basis forMRD may in future provide the biological basis for
therapeutic decision making.therapeutic decision making.
MRD detection may allow specific treatment to beMRD detection may allow specific treatment to be
tailored to the needs of the individual patient.tailored to the needs of the individual patient.
These data need to be confirmed in prospective trialsThese data need to be confirmed in prospective trials
involving large numbers of patients, uniformly treatedinvolving large numbers of patients, uniformly treated
and monitored within well-defined protocols.and monitored within well-defined protocols.

67. Questions remainedQuestions remained
unanswered?unanswered?
1) Can MRD assessment identify high-risk patients within both
the standard-risk and good-risk groups, who require additional
or more intensive therapy regimens?
2) Can MRD assessment identify those at very low risk of
relapse, who might be candidates for reduction of treatment?
3) Can we establish a single standard marker for MRD and at a
stem cell level?

69. Immunoprofiling Of AMLImmunoprofiling Of AML
Stem Cells With CD123 (IL-3Stem Cells With CD123 (IL-3
αα Receptor) Marks FLT3/ITDReceptor) Marks FLT3/ITD
Positive ClonesPositive Clones

73. Leukaemic Stem Cells andLeukaemic Stem Cells and
MRDMRD
AML is generally regarded as a stem cell disease.
In CD34-positive AML, the stem cell has been recognized
as CD38-negative [Bonnet D, Dick JE, NAT Med 1997].
LSCs survive chemotherapy and grow out to cause the
presence of MRD, which leads to relapse of the disease.
If so, stem cell characteristics at diagnosis should show a
correlation with MRD frequency after chemotherapy, which
indeed was found for the frequency of the CD34+CD38–
population at diagnosis (van Rhenen A et al , Clin Cancer research 2005)
In order for any AML therapy to be curative, it needs to beIn order for any AML therapy to be curative, it needs to be
effectiveeffective against the cells that propagate and sustainagainst the cells that propagate and sustain
the diseasethe disease, the so called Leukaemic stem cells (LSCs)., the so called Leukaemic stem cells (LSCs).

74. Leukaemic stem cells and MRDLeukaemic stem cells and MRD
The identification of immunophenotypical characteristics
specific for the malignant CD34+CD38– cells at diagnosis
would offer opportunities to study the stem cell compartment
after chemotherapy.
This information would enable not only identification of patients
at risk of relapse, but also could then help to identify new
targets for therapy.
CD123 is one of the possible markers.
CD123 is expressed on most AML blasts and on the leukemic
CD34+CD38– subpopulation at diagnosis.
Many LAPs were found to be prominently present on the AML
stem cell compartment but not on the steady state and
regenerating normal BM CD34+CD38– counterpart. [van Rhenen
A, ASH abstract 2006].

75. Leukaemic stem cellsLeukaemic stem cells
Internal tandem duplication (ITD) mutations of theInternal tandem duplication (ITD) mutations of the FLT3FLT3
gene are the most frequent molecular abnormality ingene are the most frequent molecular abnormality in
AML.AML.
While the normal FLT3 receptor is expressed in earlyWhile the normal FLT3 receptor is expressed in early
haemopoietic progenitor cells, it hashaemopoietic progenitor cells, it has not beennot been
determined whether FLT3/ITD mutations are present atdetermined whether FLT3/ITD mutations are present at
the LSC level.the LSC level.

76. HypothesisHypothesis
FLT3/ITD mutation is present at leukaemicFLT3/ITD mutation is present at leukaemic
stem cell level and not secondary event instem cell level and not secondary event in
leukaemogenesis & it is confined toleukaemogenesis & it is confined to
CD34+CD38- fraction that possess IL-3 αCD34+CD38- fraction that possess IL-3 α
receptor (CD123) in AML.receptor (CD123) in AML.

77. AimsAims
To investigate whether or not FLT3/ITD are present atTo investigate whether or not FLT3/ITD are present at
LSC level.LSC level.
To demonstrate whether or not FLT3/ITD mutation isTo demonstrate whether or not FLT3/ITD mutation is
confined to the population of LSC as defined byconfined to the population of LSC as defined by
CD34CD34++
/CD38/CD38--
/CD123/CD123++
and not CD34and not CD34++
/CD38/CD38--
/CD123/CD123--
cells.cells.

78. ResultsResults
Expression of IL-3 α receptor (CD123) in AML blast cellsExpression of IL-3 α receptor (CD123) in AML blast cells
CD123 expression was found in the majority of AML patientsCD123 expression was found in the majority of AML patients
32/34 (94%) , median expression = 86%, (range, 20-99%)32/34 (94%) , median expression = 86%, (range, 20-99%)
Expression of IL-3 α receptor in leukaemic stem cellsExpression of IL-3 α receptor in leukaemic stem cells
CD123 was strongly expressed in the CD34+
CD38-
cells (98 ±
3% positive) from 28 (87.5%) of 32 primary specimens.
Expression of IL-3 α receptor in normal bone marrow
CD34+
CD38-
fraction
Five normal BMs were tested for the expression of CD123 on
CD34+CD38- cells and they were all CD123 negative

79. Patient characteristics Total (%)
No. patients 34
Male/female 24/10
Age at diagnosis, y, mean (range) 63 (23-86)
% blasts at diagnosis (morphology) 41.5 (20-96)
% blasts at diagnosis (Flow) 42.5 (9-86)
WBC count at diagnosis, 109
/L, median (range) 4.5 (0.71-179)
De novo/Secondary AML 27 (79) / 7 (21)
FAB classification, n (%)
M0 0 (0)
M1 8 (24)
M2 10 (29)
M3 1 (3)
M4 2 (6)
M5 4 (12)
M6 1 (3)
M7 0 (0)
Not classified 8 (24)
Cytogenetic risk group, n (%)
Favourable 2 (6)
Intermediate 19 (56)
Poor 12 (35)
No metaphases 1 (3)
FLT3/ITD, n (%)
Present 10 (29)
Absent 15 (44)
Not analysed 9 (26)
CD123
Present 32 (94%)
Absent 2 (6%)

81. Gating strategy used to identify CD34+CD38-CD123+ cellsGating strategy used to identify CD34+CD38-CD123+ cells
Gated on CD34+ cells: to
identify a population
homogenous for CD34+
cells
Ungated: to identify
CD34+ cells and so the
blast population on
CD45/SSC log density
plot
Gated on CD34+ cells to
identify the blast
population based on
CD45 dim and low SS
1) Identification of the blast population

82. Density plot: Gated
on CD34+
homogenous cells
Density plot: Gated on
CD34+CD38- cells to
identify a population
homogenous for the scatter
Gated on CD34+CD38-
homogenous cells to identify a
population homogenous
Density plot: Gated
on CD34+CD38-
homogenous cells
2) Further Analysis

83. Sorting AML stem cellsSorting AML stem cells
To determine expression of FLT3/ITD in AML stem cells, highly purifiedTo determine expression of FLT3/ITD in AML stem cells, highly purified
(purity >95%) CD34(purity >95%) CD34++
/CD38/CD38--
/CD123/CD123++
and CD34and CD34++
/CD38/CD38--
/CD123/CD123--
cells werecells were
examined for FLT3/ITD mutation inexamined for FLT3/ITD mutation in 7 patients with FLT3/ITD positive AML7 patients with FLT3/ITD positive AML
Sample
No.
Total
Unsorted
cells
CD34%
Unsorted
cells
%CD123
Unsorted
cells
Total CD34
+
/CD38
-
/CD123
+
cells from the sorter
Total CD34
+
/CD38
-
/CD123
-
cells from the sorter
Sequencing
FLT3/ITD
1 10X106
96 86 150 1606 ND
2 18X106
89 99 76000 418 ND
3 12X106
91 86 12674 148396 78 bp
4 27X106
73Ж
93 1839 16 33 bp
5 30X106
10 64 559 164 ND
6 17X106
15 99 300,000 69 ND
7 40X106
79 68 640 3602 ND

84. Detection of Flt3/ITD in the purifiedDetection of Flt3/ITD in the purified
AML stem cellsAML stem cells
Genomic DNA from unsorted and sorted cells wasGenomic DNA from unsorted and sorted cells was
isolated and PCR was performed using primersisolated and PCR was performed using primers
flanking exons 14 and 15 of theflanking exons 14 and 15 of the FLT3FLT3 gene.gene.
In theIn the 7 positive FLT3/ITD7 positive FLT3/ITD samples analysed, thesamples analysed, the
mutation was clearly present in the LSC-enrichedmutation was clearly present in the LSC-enriched
fraction CD34fraction CD34++
/CD38/CD38--
/CD123/CD123++
confirming thatconfirming that
FLT3/ITD mutation arises at the stem cell level.FLT3/ITD mutation arises at the stem cell level.
Interestingly, CD34Interestingly, CD34++
/CD38/CD38--
/CD123/CD123--
cells in 6cells in 6
patients were FLT3/ITD negative.patients were FLT3/ITD negative.

85. FLT3/ITD
FLT3/WT
(A)
M 1 2 3 1 2 3 1 2 3 1 2 3 - No DNA + M
Patients 1 Patient 2 Patient 3 Patient 4
+ - -
+ - +
-
+ Positive control
(B)
Patient 3: (33bp): catcccccc gatttcagagaatatgaatatgat
Patient 4: (78bp): gtacaggtgaccggctcctcagataatgagtacttctacgttgatttcagagaatatgaatatgatctcaaatgggag
M 1 2 3 1 2 3 1 2 3 + - No DNA M
Patients 5 Patients 6 Patients 7
M Molecular marker Puc19
1 CD34+
/CD38-
/CD123-
2 CD34+
/CD38-
/CD123+
3 Unsorted sample at diagnosis
- Negative control
+ Positive control
(B)
Patient 3: (33bp): catcccccc gatttcagagaatatgaatatgat
Patient 4: (78bp): gtacaggtgaccggctcctcagataatgagta cttctacgttgatttcagagaatatgaatatgatctcaaatgggag
Detection of FLT3/ITD in the sortedDetection of FLT3/ITD in the sorted
AML stem cellsAML stem cells
Conclusions:Conclusions:
1. We demonstrate FLT3/ITD mutations are found in a
fraction of cells defined as CD34+CD38-CD123+.
2. There was evidence to suggest that the FLT3/ITD
mutations were present within purified enriched LSC
defined by CD123 and absent within stem cells without
CD123.
The FLT3/ITD mutations in the CD34+/CD38-/CD123+ cells
were sequenced in 2 patients (patient 3 and 4) to confirm
that they represented the identical mutations present in the
sorted and unsorted original samples.
FLT3/ITD
FLT3/WT

86. SummarySummary
We presented evidence that FLT3/ITD mutation is present atWe presented evidence that FLT3/ITD mutation is present at
LSC level and may be a primary and not secondary event inLSC level and may be a primary and not secondary event in
leukaemogenesis.leukaemogenesis.
Our findings demonstrated that FLT3/ITD mutation wasOur findings demonstrated that FLT3/ITD mutation was
confined to a population of CD34confined to a population of CD34++
CD38CD38--
CD123CD123++
but notbut not
CD34CD34++
CD38CD38--
CD123CD123--
cells in the 7 AML patients.cells in the 7 AML patients.
We have shown that the oncogenic events of FLT3/ITDWe have shown that the oncogenic events of FLT3/ITD
happen at cell stage possessing the alpha chain of the IL-3happen at cell stage possessing the alpha chain of the IL-3
receptorreceptor
This novel finding provides aThis novel finding provides a
rationale for treatment involvingrationale for treatment involving
CD123-targeting antibodiesCD123-targeting antibodies
combined with intracellular FLT3combined with intracellular FLT3
inhibitors directed against AMLinhibitors directed against AML
stem cellsstem cells

87. Future DirectionFuture Direction
Targeting IL-3 alpha (CD123) receptor may be a novel promisingTargeting IL-3 alpha (CD123) receptor may be a novel promising
treatment approach in patients with CD123treatment approach in patients with CD123++
AML.AML.
This concept is based on the notion that in most patients with AML,This concept is based on the notion that in most patients with AML,
myeloblasts express CD123 as we shown in our study.myeloblasts express CD123 as we shown in our study.
It may be of great importance to detect MRD stem cells after
chemotherapy using CD34+CD38–CD123+, besides detecting MRD
using the whole blast compartment which may further improve the
clinical significance of these studies and may reveal the most
relevant target-cell population for the design of new therapies.
Evidence for this role comes from the observation that AML stem
cell parameters offer prognostic information additional to MRD
frequency assessment.
Ideally, engraftment of these cells in NOD/SCID miceIdeally, engraftment of these cells in NOD/SCID mice
should be the best evidence. This approach was notshould be the best evidence. This approach was not
able to be carried out due to technical reasons.able to be carried out due to technical reasons.

89. What is Next from There?What is Next from There?
Working on a new project!Working on a new project!
TITLE OF PROJECT:TITLE OF PROJECT:
Evaluation of the Role of CD34+CD38-Evaluation of the Role of CD34+CD38-
CD123+ Cells as a Marker of MinimalCD123+ Cells as a Marker of Minimal
Residual Disease in Acute MyeloidResidual Disease in Acute Myeloid
Leukaemia.Leukaemia.

90. HypothesisHypothesis
CD34+CD38-CD123+ can be detected inCD34+CD38-CD123+ can be detected in
the majority of AML patients at diagnosis.the majority of AML patients at diagnosis.
CD34+CD38-CD123+ can be used as aCD34+CD38-CD123+ can be used as a
marker of MRD post chemotherapy andmarker of MRD post chemotherapy and
persistence of CD34+CD38-CD123+ cellspersistence of CD34+CD38-CD123+ cells
will predict relapse of AML.will predict relapse of AML.

91. Aims of ProjectAims of Project
To determine the incidence of CD34+CD38-CD123+To determine the incidence of CD34+CD38-CD123+
cells in newly diagnosed AML.cells in newly diagnosed AML.
To determine the sensitivity and specificity ofTo determine the sensitivity and specificity of
CD34+CD38-CD123+ as a unique marker ofCD34+CD38-CD123+ as a unique marker of
leukaemic cells.leukaemic cells.
To determine whether monitoring of CD34+CD38-To determine whether monitoring of CD34+CD38-
CD123+ cells post chemotherapy can be applied as anCD123+ cells post chemotherapy can be applied as an
MRD strategy.MRD strategy.

92. If successful, the results from this study will haveIf successful, the results from this study will have anan
immediate impact on patient managementimmediate impact on patient management ::
1.1. More patients will be screened using this approach.More patients will be screened using this approach.
2.2. A significant number of patients at risk of relapse will beA significant number of patients at risk of relapse will be
identified & offered alternate therapeutic strategies such asidentified & offered alternate therapeutic strategies such as
haemopoietic stem cell transplantation or novel therapies.haemopoietic stem cell transplantation or novel therapies.
3.3. A much smaller number of monoclonal antibodies, resultingA much smaller number of monoclonal antibodies, resulting
in relatively simple data interpretation and thereforein relatively simple data interpretation and therefore
dropping down the cost of monoclonal antibodies.dropping down the cost of monoclonal antibodies.
4.4. If this proves to be the case then it offers a relatively simpleIf this proves to be the case then it offers a relatively simple
method for determining relapse risk of patients with AMLmethod for determining relapse risk of patients with AML
who then can be offered potential life saving therapeuticwho then can be offered potential life saving therapeutic
strategies.strategies.
5.5. We will aim to include such approaches in future multi-We will aim to include such approaches in future multi-
centre studies evaluating new approaches in AMLcentre studies evaluating new approaches in AML
treatment.treatment.
Significance of ProjectSignificance of Project

95. AcknowledgementsAcknowledgements
AustraliaAustralia
SupervisorsSupervisors
Dr Ian LewisDr Ian Lewis
Dr David GillisDr David Gillis
Division of HaematologyDivision of Haematology
Prof. Dario Campana from USA, St.Jude UniversityProf. Dario Campana from USA, St.Jude University
Prof Bik ToProf Bik To
Dr Marion RobertsDr Marion Roberts
Dr Noemi HorvathDr Noemi Horvath
Dr. Sonia YoungDr. Sonia Young
Kate PilkingtonKate Pilkington
Sandy MacintyreSandy Macintyre
Alan BishopAlan Bishop
Division of ImmunologyDivision of Immunology
Prof. Angel LopezProf. Angel Lopez
Dr. Pravin HissariaDr. Pravin Hissaria
Dr. Jason PowellDr. Jason Powell
Dr. Daniel ThomasDr. Daniel Thomas
Joy MundyJoy Mundy
Ros FosterRos Foster
Anne-Marie KennedyAnne-Marie Kennedy
University of AdelaideUniversity of Adelaide
Helen Foster
Nancy Briggs
OmanOman
MOHMOH:: HE Dr Ahmed Al SaidiHE Dr Ahmed Al Saidi
The Reserch Council –Oman (funding theThe Reserch Council –Oman (funding the
project)project)
All my colleagues in Haematology deptAll my colleagues in Haematology dept

96. QuestionsQuestions
AreAre
WelcomedWelcomed
!!