This document describes the purification and characterization of riproximin, a type II ribosome inactivating protein, from the fruit kernels of Ximenia americana. The researchers established a purification procedure involving aqueous extraction of the kernels, removal of lipids using chloroform, and chromatographic purification steps on an anion exchange resin and lactosyl-Sepharose. The purified riproximin from fruit kernels was biochemically and biologically similar to riproximin from the original African plant material, but differences were found in electrophoresis patterns and mass spectrometry profiles, suggesting the purified version contains closely related isoforms. The reliable purification process provides a basis for further research on this potential anticancer drug candidate.

1. Purification and characterization of riproximin from Ximenia americana fruit kernels
Helene Bayer a
, Noreen Ey b
, Andreas Wattenberg c
, Cristina Voss b
, Martin R. Berger a,⇑
a
Toxicology and Chemotherapy Unit, German Cancer Research Center, Im Neuenheimer Feld 581, 69120 Heidelberg, Germany
b
Department of Biochemistry, Heidelberg Pharma AG, Schriesheimerstraße 101, 68526 Ladenburg, Germany
c
PROTAGEN AG, Otto-Hahn-Straße 15, 44227 Dortmund, Germany
a r t i c l e i n f o
Article history:
Received 10 October 2011
and in revised form 28 November 2011
Available online 8 December 2011
Keywords:
Riproximin
Plant lectin
Type II RIP
Ximenia americana
Chromatography
Isoforms
a b s t r a c t
Highly pure riproximin was isolated from the fruit kernels of Ximenia americana, a defined, seasonally
available and potentially unlimited herbal source. The newly established purification procedure included
an initial aqueous extraction, removal of lipids with chloroform and subsequent chromatographic puri-
fication steps on a strong anion exchange resin and lactosyl–Sepharose. Consistent purity and stable bio-
logical properties were shown over several purification batches. The purified, kernel-derived riproximin
was characterized in comparison to the African plant material riproximin and revealed highly similar bio-
chemical and biological properties but differences in the electrophoresis pattern and mass spectrometry
peptide profile. Our results suggest that although the purified fruit kernel riproximin consists of a mix-
ture of closely related isoforms, it provides a reliable basis for further research and development of this
type II ribosome inactivating protein (RIP).
Ó 2011 Elsevier Inc. All rights reserved.
Introduction
Riproximin is a plant lectin that was recently identified as the
active component of a powdered plant material used in African tra-
ditional medicine. Molecular phylogenetic analysis identified its
source as the semiparasitic plant Ximenia americana.1
Riproximin
has been shown to exhibit potent anticancer activity in vitro and
in vivo and was classified as a ribosome inactivating protein (RIP)
of type II [1,2].
RIPs of type II are heterodimeric proteins consisting of two pep-
tide chains held together by a disulfide bridge. The binding chain
(B-chain) is a lectin with affinity to various sugar structures that
are specific for each RIP. Following binding to the cell surface, type
II RIPs are transferred into the cell [3,4]. The active chain (A-chain)
is an RNA N-glycosidase, which is able to hydrolyse a specific ade-
nine of the ribosomal large subunit [5]. The mechanism of type II
RIPs’ cellular toxicity has been ascribed to the depurination of
rRNA, which is catalysed by the A-chain and results in an irrevers-
ible arrest of cellular protein synthesis [6,7]. Recently, this hypoth-
esis has been challenged by the finding that riproximin and other
RIPs of type II induce the unfolded protein response [8].
Representatives from RIPs of type II, like ricin or viscumin, are
highly toxic lectins and have been investigated as anticancer drugs.
The recombinant lectin aviscumin, which was produced in Esche-
richia coli, has demonstrated immunomodulatory and cytotoxic
activity. In clinical phases I/II studies, it achieved disease stabiliza-
tion in some cases [9]. In addition, the RIP A-chain has been used to
construct toxic antibody conjugates targeting cancer specific anti-
gens. For example, the immunotoxin Combotox consists of the ri-
cin A-chain coupled to an antibody directed against cell surface
antigens CD19 and CD22 and has been investigated in a phase I
study as a candidate for treatment of children with refractory leu-
kaemia [10].
Due to its highly potent antineoplastic activity, the type II RIP
riproximin has received interest as a potential anticancer drug can-
didate [1]. Riproximin was purified from an undefined African
plant material of limited availability. The purification procedure
established for riproximin from this material consisted of four
steps. First, the plant material was extracted with acetone to de-
plete tannins. An aqueous extract was prepared from the dried,
tannin-free powder. This extract was subsequently purified by an-
ion exchange chromatography. At neutral pH, riproximin bound to
an anion exchange resin and eluted with high-salt buffer. The final
affinity purification step was performed on a matrix containing
free galactose residues, which had been prepared by partial hydro-
lysis of Sepharose.
For further investigations the availability of riproximin had to
be ascertained. X. americana fruit kernel extracts were shown to
be highly cytotoxic [1]; these kernels were considered to provide
a reliable source of riproximin. In the present study, we describe
1046-5928/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved.
doi:10.1016/j.pep.2011.11.018
⇑ Corresponding author. Fax: +49 6221 42 3313.
E-mail address: m.berger@dkfz.de (M.R. Berger).
1
Abbreviations used: DEAE, diethylaminoethyl; FPLC, fast protein liquid chroma-
tography; LS, lactosyl–Sepharose; MALDI, matrix-assisted laser desorption/ ioniza-
tion; MW, molecular weight; MWCO, molecular weight cut off; MS, mass
spectrometry; RCA, Ricinus communis agglutinin; RIP, ribosome inactivating protein;
Rpx, riproximin; SA, specific activity; SDS-PAGE, sodium dodecyl sulfate–polyacryl-
amide gel electrophoresis; TOF, time of flight; X.a., Ximenia americana.
Protein Expression and Purification 82 (2012) 97–105
Contents lists available at SciVerse ScienceDirect
Protein Expression and Purification
journal homepage: www.elsevier.com/locate/yprep

2. the isolation procedure of riproximin from this source. In addition,
we detail our results regarding separation and characterization of
X. americana riproximin isoforms.
Materials and methods
Aqueous extraction
Fruit kernels from X. americana originating from Florida, USA,
were cracked and 10 mg of the inner soft kernel was homogenized
in 50 ml 20 mM Tris–HCl-buffer, pH 7.0. The resulting viscous sus-
pension was transferred into a 50 ml tube and centrifuged (4000g,
4 °C, 10 min). After separation from the upper fat layer, the lower
aqueous supernatant was filtrated through a glass frit, resulting
in a turbid aqueous extract.
Removal of lipids
Two extraction procedures and different organic solvents, such
as chloroform, acetic ester and n-heptane, were compared to opti-
mize the removal of lipids either from the turbid aqueous extract
or the initial kernel material. For removing the fats prior to the
aqueous extraction of the proteins, 10 g kernel material were
homogenized directly in 50 ml of each organic solvent and centri-
fuged (4000g, 4 °C, 10 min). This pre-extraction step was repeated
twice. The fat-free kernel material was resuspended in 100% ace-
tone, filtrated through a glass frit and vacuum-dried. The dried
material was resuspended in 50 ml 20 mM Tris–HCl-buffer, pH
7.0 to obtain the final, clear aqueous extract.
Alternatively, the turbid aqueous extract prepared from the ker-
nels as described above was clarified from remaining lipids by
extraction with an equal volume of solvent. The extraction step
was repeated 2–3 times. To remove traces of the solvent, which
interfered with the chromatographic separation, the extracted
aqueous solution was vacuum–freeze–dried. Prior to anion ex-
change chromatography, the lyophilisate was redissolved in dou-
ble distilled water (ddH2O) to the initial volume.
Pre-purification on CaptoQ
The pre-purification step was performed on the strong anion
exchange resin, CaptoQ (GE Healthcare, Uppsala, Sweden). The
aqueous extract was loaded onto pre-equilibrated resin and the
column was washed with 20 mM Tris–HCl-buffer, pH 7.0. Riproxi-
min containing fractions were eluted by increasing the salt concen-
tration up to 500 mM NaCl. Collected fractions were analyzed by
SDS–PAGE. Protein concentrations were determined colorimetri-
cally with the Bradford assay (Roti-Nanoquant, Carl Roth,
Karlsruhe, Germany).
Affinity purification on galactose resins
The affinity purification step was performed on a Beckman
Coulter PP2000 FPLC (Beckmann Coulter GmbH, Krefeld, Germany).
The affinity purification of riproximin from fruit kernels on par-
tially hydrolyzed Sepharose 4B (GE Healthcare, Uppsala, Sweden)
followed the procedure described for riproximin from plant mate-
rial [2]. Alternatively, lactosyl–Sepharose (Lactosyl Sepharose 4
Fast Flow, GE Healthcare, Uppsala, Sweden), a prototype affinity re-
sin providing lactose for binding of the lectins, was used. Lactosyl–
Sepharose was equilibrated with 20 mM Tris–HCl-buffer, pH 7.0
containing up to 500 mM NaCl. The riproximin-containing anion
exchanger eluate from the pre-purification step was loaded and
the column was washed with equilibration buffer. Riproximin
was eluted with 20 mM Tris–HCl-buffer, pH 7.0 containing up to
500 mM NaCl and 100 mM galactose.
The collected riproximin samples were pooled and concen-
trated by ultrafiltration on 10,000 MWCO membrane filters,
exchanging the elution buffer to a storage buffer containing
20 mM Tris–HCl-buffer, pH 7.0 and 50 mM galactose. The purified
proteins were analyzed by SDS–PAGE and their cytotoxic activity
was assessed in HeLa cell proliferation assays (see below).
Purified and lyophilized riproximin was used to determine its
extinction coefficient at 280 nm. Riproximin concentrations in the
fractions were subsequently calculated from absorption at 280 nm.
Separation of the riproximin isoforms
A weak anionic resin, Toyopearl-DEAE-650S (Tosoh Bioscience,
Stuttgart, Germany), was used for the separation of riproximin iso-
forms. Riproximin protein mixture was loaded on the column
equilibrated with 20 mM piperazine-buffer, pH 5.7 and 50 mM gal-
actose. After washing with the same buffer, elution was performed
by increasing the NaCl concentration to 80 mM. The separated
riproximin isoforms were further analyzed by SDS–PAGE, gel filtra-
tion, deglycosylation and their cytotoxic activity was assessed in
HeLa cells.
Biological activity
The cytotoxic activities of riproximin or riproximin isoforms
were characterized using the WST-1 viability assay (Roche Diag-
nostics, Mannheim, Germany). Cells were propagated in humid
atmosphere containing 5% CO2 at 37 °C. The media was supple-
mented with 10% FCS, 2 mM L-glutamine, 100 IU/ml penicillin
and 100 lg/ml streptomycin. For viability assays, the cells were
seeded into 96-well-plates (2500 cells/well in 100 ll) and allowed
to settle down overnight. Riproximin containing fractions or puri-
fied riproximin samples (100 ll) were then added to the cells and
the plates were incubated for 72 h. The cell growth was deter-
mined by adding WST-1 and subsequent colorimetric detection.
The cytotoxic activity of each riproximin sample/batch was charac-
terized by its IC50 value in HeLa cells. For quantifying the fraction
or batch purity, the specific activity (SA), defined as 1/IC50, was
used. One unit (1 U) was defined as the amount of the active com-
pound (lg) in 1 ml that inhibits 50% of control cell proliferation.
Riproximin deglycosylation
For enzymatic deglycosylation of riproximin, the glycoprotein
was first incubated for 5 min at 99 °C in a denaturing and reducing
buffer (50 mM sodium phosphate, pH 5.0, 0.1% SDS and 0.05 mM b-
mercaptoethanol). Afterwards 1 ll N-glycosidase F (1 U; Roche
Diagnostics, Mannheim, Germany) was added and the mixture
was incubated for 3 h at 37 °C. The deglycosylated proteins were
analyzed by SDS–PAGE.
Chemical deglycosylation was performed with the Glyco Pro-
fileTM
IV Chemical Deglycosylation Kit (Sigma Aldrich, Steinheim,
Germany) according to the instructions of the manufacturer.
Briefly, desalted and lyophilized riproximin material was dissolved
in a trifluoromethanesulfonic acid-anisole mixture, incubated for
4 h at À20 °C and neutralized by the addition of pre-cooled 60%
pyridine-solution. The deglycosylated proteins were dialyzed
against 20 mM Tris–HCl-buffer, pH 7.5 and analyzed by SDS–PAGE
and HeLa cell proliferation assay.
Mass spectrometric analysis
Both native and enzymatic deglycosylated riproximin isoforms
were analyzed by MALDI mass spectrometry. A reducing
98 H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105

3. 20 Â 30 cm SDS–PAGE was used for separation [11]. The gel was
cast with 12.5% acrylamide. After Coomassie staining, the sepa-
rated bands were cut out, washed and digested in gel with trypsin
(Promega, Madison WI, USA). Subsequently, the peptides were ex-
tracted from the gel using 0.1% trifluoroacetic acid. The peptide
pools were prepared onto a MALDI target using alpha-cyano-4-hy-
droxy-cinnamic acid (Bruker Daltonik, Bremen, Germany) and ana-
lyzed by an Ultraflex III TOF/TOF (Bruker Daltonik, Bremen,
Germany). The data sets were imported into a relational database
(ProteinScape, Bruker Daltonik, Bremen, Germany) and searched
against the NCBInr protein database using the Mascot algorithm
(Matrix Science, London, UK). A 50 ppm mass tolerance was used
for MS data, 0.2 Da mass tolerance for the parent mass in the
MS/MS data and 1 Da tolerance for the fragment data. MS/MS spec-
tra were obtained from selected peaks using the same instrument
and analyzed by manual de novo sequencing.
The clustering of the normalized MALDI data was performed
using the Clustal algorithm with hierarchical clustering, complete
linkage and uncentered correlation [12].
Gene amplification
For RNA isolation, small pieces from the inner part of X. ameri-
cana fruit kernels were powdered after freezing in liquid nitrogen.
The powdered fruit kernel material was homogenized in 0.5 ml of
pre-cooled Concert Plant RNA Reagent (Invitrogen, Darmstadt,
Germany). Further isolation followed the instructions of this man-
ufacturer. For gene amplification, RNA was transcribed into cDNA
and the riproximin gene was amplified by PCR using the riproximin
specific primers, Rpx1-frw (CATGCCGACTACTACCAAACCG) and
Rpx1-rev (GCATGTCAGACAACCACCATCC), which were designed
to match within the non-translated region of the published riprox-
imin cDNA sequence (Accession Number AM114537). The PCR
product was sequenced by GATC company (Konstanz, Germany)
using internal riproximin specific primers.
Results
Starting from the published procedure for riproximin from
African plant material, the extraction as well as the chromato-
graphic separation steps had to be modified and optimized for
riproximin from the fruit kernels of X. americana. Furthermore,
the purified fruit kernel riproximin was characterized with respect
to its chain and isoform composition, as well as glycosylation
patterns using biochemical methods and mass spectrometry.
Aqueous extraction and removal of lipids by solvent extraction
The extraction step had to be modified to deal with the high fat
content of the fruit kernels. This characteristic differed from the
African plant material, from which contaminating tannins had to
be removed. The optimal extraction ratio was 200 mg kernel mate-
rial per 1 ml aqueous buffer. After centrifugation of the raw aque-
ous extract, a thick lipid layer covered the supernatant and could
not be mechanically removed. The subsequent filtration of the dec-
anted supernatant yielded a cytotoxic turbid extract that could not
be cleared by additional centrifugation (Fig. 1A). Direct binding/
elution experiments of the extract on partially hydrolyzed Sephar-
ose 4B showed that no proteins were retained by the affinity ma-
trix, most probably because of the fats interfering with binding.
To remove the lipids from the aqueous extract, chloroform, ace-
tic ester and n-heptane were used in two different extraction pro-
cedures: pre-extraction of lipids from the kernels prior to aqueous
extraction of the proteins vs. a solvent extraction of the turbid ex-
tract. The extraction and clean up efficacies were measured,
respectively, by comparing the extracts’ cytotoxic activity as well
as binding onto hydrolyzed Sepharose.
While the cytotoxic activity did not differ between the various
extracts (Fig. 1B), the galactose binding of riproximin varied con-
siderably with the solvent and/or extraction procedure. Best bind-
ing to hydrolyzed Sepharose was achieved with the aqueous
extract cleared by chloroform extraction, for which only a small
proportion of the riproximin proteins was lost in the flow through
and wash fractions (Fig. 1C). To completely remove chloroform
traces, the clarified extracts were vacuum–freeze–dried and redis-
solved in ddH2O.
Pre-purification on a strong anion exchange resin
As for the pre-purification of the African plant material aqueous
extract, a strong anion exchange resin was used for the first coarse
chromatographic purification step. This resin was chosen, because
the previously used DEAE cellulose was not adequate for FPLC.
SDS–PAGE analysis of the flow through revealed that several
irrelevant proteins were removed from the extract, while the entire
cytotoxic activity remained bound to the column (Fig. 2). Riproxi-
min started to elute with buffer containing around 200 mM NaCl.
Elution was complete at 500 mM NaCl. The yield of this step de-
pended on the NaCl concentration used for elution and increased
at higher salt concentrations. When 200 mM NaCl were used for
elution, an average of 76% of the loaded biological activity was
recovered (Table 1).
Affinity purification on galactose containing resins
Purification of riproximin proteins was first performed on
hydrolyzed Sepharose 4B as described for the purification of
riproximin from African plant material. However, the binding
capacity of hydrolyzed Sepharose proved to be too low for the high
riproximin content of the fruit kernel aqueous extract. A prototype
lactosyl–Sepharose was tested as alternative affinity resin.
First, purification runs on lactosyl–Sepharose, performed as
with the hydrolyzed Sepharose 4B (binding and washing buffer:
20 mM Tris–HCl, pH 7.0, elution buffer: 20 mM Tris–HCl, pH 7.0
and 100 mM galactose), resulted in riproximin binding but no elu-
tion. To assess whether this effect was due to ionic interactions,
binding and elution of riproximin to/from lactosyl–Sepharose were
subsequently analyzed in a batch approach. Riproximin obtained
from hydrolyzed Sepharose purification was supplemented with
increasing NaCl concentrations (100–1000 mM) and applied onto
lactosyl–Sepharose. For elution, 100 mM galactose was used in
combination with the respective NaCl concentration. SDS–PAGE
analysis of the binding and elution supernatants showed that
riproximin in the sample without NaCl bound completely to lacto-
syl–Sepharose, but failed to dissociate in the presence of 100 mM
galactose alone. With increasing NaCl concentrations, the binding
of riproximin decreased only slightly (Fig. 3A, binding). Elution of
riproximin was observed for buffers containing P100 mM NaCl
as well as 100 mM galactose (Fig. 3A, elution). A NaCl concentra-
tion of 100 mM was therefore chosen for starting the gradient col-
umn runs.
For further optimization, complete affinity purification runs
were performed at NaCl concentrations of 200, 300 and 400 mM
in both loading and elution buffers. With 200 mM NaCl a very pure
riproximin was eluted from the column. However, the regeneration
steps with 1 M and 5 M NaCl indicated an incomplete elution, since
a small amount of riproximin was also detectable in these frac-
tions. Higher concentrations of NaCl (300 and 400 mM) resulted
in a higher yield of riproximin, but the eluted riproximin was
detectably contaminated with other proteins (Fig. 3B). As expected
from the SDS–PAGE pattern, when analyzed for concentration and
H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105 99

4. biologic activity, the eluate from the 200 mM NaCl run showed the
highest specific activity, but contained less total protein than the
other fractions (Table 2).
Using the optimized procedure, several purification runs were
performed in the presence of 200 mM NaCl. The purification was
very good reproducible, yielding on average 81% of the loaded
Fig. 1. Protein extraction, cytotoxicity and binding behavior: Proteins extracted from Ximenia americana by aqueous and/or organic solvents were characterized by their
binding to hydrolyzed Sepharose 4B. (A) SDS–PAGE analysis followed by silver staining showing proteins from aqueous extracts from American X.a. fruit kernels in
comparison to an extract from African plant material. Lane 1: aqueous extract from X.a. fruit kernels; lane 2: chloroform clarified, aqueous extract from X.a. fruit kernels; lane
3: lyophilized, chloroform clarified, aqueous extract from X.a. fruit kernels; lane 4: molecular weight marker; lane 5: acetone pre-extracted, aqueous extract from X.a. African
plant material. The bands indicating riproximin proteins are framed. (B) The cytotoxic activity of solvent treated, aqueous extracts (Extracts 1–3) from X.a. fruit kernels was
compared by a WST-1 assay on HeLa cell proliferation at 72 h with that of the solvent untreated, aqueous extract (Control). Extract 1: chloroform extraction followed by
aqueous extraction; Extract 2: acetic ester extraction followed by aqueous extraction; Extract 3: aqueous extraction followed by chloroform; Control: aqueous extraction
only. For all extracts, a starting dilution of 1:100,000 was chosen. (C) Comparison of riproximin purification yield depending on the extraction procedure. Three extraction
procedures are compared by the yield of riproximin after binding to hydrolyzed Sepharose 4B: (a) aqueous extraction only, (b) aqueous extraction followed by chloroform
extraction, (c) chloroform extraction followed by aqueous extraction. Extract (500 ll, respectively) was loaded onto hydrolyzed Sepharose 4B. Flow throughs (Ft), wash
fractions (W) and eluates with 100 mM galactose (E) were separated and visualized by SDS–PAGE and silver staining.
Fig. 2. Optimization of the NaCl concentration for pre-purification on CaptoQ: Chloroform clarified, aqueous extract was loaded onto a column filled with the strong anion
exchange resin, CaptoQ. The elution was performed with a NaCl gradient (0–500 mM). (A) Chromatogram of the optimization run with flow through (Ft) of the chloroform
clarified, aqueous extract and elution peaks of the NaCl gradient (EP1-EP4), as indicated by the arrows. (B) SDS–PAGE analysis followed by silver staining of flow through and
elution fractions with lane 1: molecular weight marker, lane 2: flow through of the chloroform clarified, aqueous extract, lane 3–4: eluted proteins from peak 1, lane 5–6:
eluted proteins from peak 2, lane 7–8: eluted proteins from peak 3, lane 9–11: eluted proteins from peak 4. The bands indicating riproximin proteins are framed.
Table 1
Representative run of the pre-purification of an aqueous extract on CaptoQa
.
Volume (ml) Concentration (lg/ml) IC50
b,c
(lg/ml) Specific activityd
(U/lg) Total activity (U) % of total activity
Loaded extracte
20 9900 8.1 Â 10À4
1200 238 Â 106
–
Flow through 12 255 4.1 Â 10À4
24 0.07 Â 106
0.03
Elutionf
48 1019 2.7 Â 10À4
3700 181 Â 106
76.1
5 M NaCl 12 1041 5.0 Â 10À4
200 2.5 Â 106
1.1
a
Three different pre-purification runs yielded on average 75.8% (mean; SD = 0.67; n = 3) of the respective biological activity.
b
IC50 is the concentration inhibiting 50% of control cell proliferation.
c
IC50 was determined by WST-1 assay on HeLa cell proliferation at 72 h.
d
Specific activity SA (U/lg) was defined as 1/IC50 (lg/ml). One unit (1 U) was defined as the amount of the active compound (lg) in 1 ml that inhibits 50% of control cell
proliferation.
e
Aqueous extract pre-cleared with chloroform.
f
Four elution fractions were pooled.
100 H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105

5. biological activity (Table 3). SDS–PAGE analysis revealed that
riproximin was eluted in a highly pure form (Fig. 4A, B).
Optimized purification protocol
The optimized purification protocol for riproximin from X.
americana kernels consisted of the following steps: (1) aqueous
extraction of riproximin proteins from homogenized fruit kernel
material; (2) lipid extraction by chloroform with subsequent vac-
uum–freeze–drying; (3) coarse chromatographic purification of
the redissolved extract on the strong anion exchange resin with
200 mM NaCl elution and (4) affinity binding of the anion exchan-
ger eluate to lactosyl–Sepharose followed by elution of pure
riproximin with buffer containing 200 mM NaCl and 100 mM
galactose.
Purified riproximin eluates obtained from 10 to 20 g kernel
material were pooled to a batch. Riproximin samples were stored
in a buffer containing 50 mM galactose at À20 °C. Table 4 gives
Fig. 3. Optimization of the salt concentration used for affinity purification of riproximin: The NaCl concentration used for final purification of riproximin on lactosyl–
Sepharose (LS) was selected from a series of NaCl concentrations that were tested for their influence on binding to and elution from the resin. All samples from batch and
chromatographic approaches were analyzed by SDS–PAGE and subsequent silver staining. (A) Investigation of binding and elution of riproximin in the presence of different
NaCl concentrations in a batch approach. Chloroform clarified, aqueous extract (100 ll; Load) was applied on 200 ll of LS resin. Binding of the extract to LS was investigated
in the presence of 0–1000 mM NaCl. For elution of the riproximin proteins, 100 mM galactose was added to the various NaCl concentrations (0–1000 mM). (B) Purification of
riproximin on a LS column with various NaCl concentrations. The CaptoQ eluate containing riproximin was affinity purified in three independent runs in the presence of 200,
300 and 400 mM NaCl. For regeneration the column was washed with 1 M NaCl. Only elution and regeneration fractions are shown.
Table 2
Comparison of the elution fractions of independent runs with varying NaCl
concentrations.
NaCl concentration (mM) Eluates with 100 mM galactose
Total protein (lg) IC50
a
(lg/ml)
Specific activityb
(U/lg)
200 204 3.8 Â 10À5
26,300
300 312 5.0 Â 10À5
20,000
400 528 7.0 Â 10À5
14,300
a
IC50 was determined by WST-1 assay on HeLa cell proliferation at 72 h.
b
Specific activity SA (U/lg) was defined as 1/IC50 (lg/ml).
Table 3
Purification runs on lactosyl–Sepharosea
.
CaptoQ
eluate
IC50
b
(lg/ml)
Specific
activity
(U/lg)
Total
activity
(U)
Yieldc
(%)
12 Â 10À4
833 34 Â 106
–
Run 1 1.1 Â 10À4
9100 26 Â 106
76
Run 2 0.7 Â 10À4
14300 29 Â 106
85
Run 3 1.0 Â 10À4
10000 25 Â 106
74
Run 4 0.6 Â 10À4
16700 32 Â 106
94
Run 5 0.4 Â 10À4
25000 12 Â 106
80
a
CaptoQ eluate (40 ml) was purified in five runs (run 1–4: 9 ml each; run 5: 4 ml)
on 9 ml lactosyl–Sepharose.
b
The IC50 of purified riproximin was determined by WST-1 assay on HeLa cell
proliferation at 72 h.
c
The purification of riproximin on lactosyl–Sepharose yielded on average 81%
Fig. 4. Final purification of riproximin on lactosyl–Sepharose: Typical riproximin purification run on lactosyl–Sepharose using the optimized protocol, loading of riproximin
in the presence of 200 mM NaCl and elution of riproximin by adding 100 mM galactose to 200 mM NaCl, is shown. (A) Chromatogram of a representative purification run with
flow through (Ft), elution and NaCl regeneration peaks, as indicated by the arrows. (B) Proteins from the pooled flow through and wash fractions as well as the three single
elution fractions were visualized by SDS–PAGE and silver staining. Lane 1: pre-purification eluate (Ld, starting material), lane 2: flow through (Ft), lane 3: molecular weight
marker, lane 4: pooled wash fraction (W), lanes 5–7: elution fractions, lane 8: regeneration fraction.
H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105 101

6. an overview on three batches for their protein content, biological
activity (IC50, SA) and total yield of riproximin. On average, 2–
3 mg of purified riproximin were obtained from 1 g fruit kernel
material. This amount was >500-fold higher than the respective
amount that could be purified from 1 g African plant material. Nev-
ertheless, the biological activity of the fruit kernel riproximin was
similar to that from the African plant material, as shown by an IC50
of 0.14 ng/ml in HeLa cells.
Fruit kernel riproximin showed six different bands (Fig. 5A,
bands A1–A3 and B1–B3) following separation by reducing SDS–
PAGE. The three lower clearly separated but neighbouring bands
were assumed to be A-chains, with two of them predominating
(Fig. 5A, bands A1–A3). The upper three bands, presumably B-
chains, showed a more diffuse, contiguous band pattern, thus indi-
cating heterogeneous glycosylation (Fig. 5A, bands B1–B3).
Separation of riproximin isoforms
Analogous to the separation of the African plant material
riproximin isoforms, two of the kernel riproximin isoforms could
be partially separated by anion-exchange chromatography. SDS–
PAGE analysis of these fractions revealed that two of the three low-
er protein bands, which were assumed to be the A-chains, could be
separated and assigned to each of two riproximin isoforms: Rpx-I,
represented by the A-chain with medium MW (Fig. 6A, lane 1) and
Rpx-II with higher MW A-chain (Fig. 6B, lane 1). The A-chain with
the lowest MW (Fig. 5A, band A1) was no longer found in the sep-
arated fractions. However, no clear isoform assignment could be
given to the B-chains. Each of the separated riproximin isoforms
contained heterogeneous B-chains, with the larger B-chains being
enriched in the fraction of Rpx-I (Fig. 6A, lane 1) and the lower
B-chains in the fraction of Rpx-II (Fig. 6B, lane 1).
Both isoforms demonstrated similar MWs when analyzed by
non-reducing SDS–PAGE ($56–60 kDa) (Fig. 6C, lane 1–2) and size
exclusion chromatography (Rpx-I: 50 kDa; Rpx-II: 53 kDa), as well
as highly similar biological activity (Fig. 7).
Glycosylation pattern
For analyzing the glycosylation impact, native fruit kernel riprox-
imin as well as its separated isoforms were treated with PNGase F.
After this treatment the diffuse upper native riproximin bands
(Fig. 5A, bands B1–B3), corresponding to B-chains, shifted to lower
MW and appeared in the SDS–PAGE gel as two, better separated
bands (Fig. 5A, bands B1d and B2d). When each isoform was degly-
cosylated and analyzed separately, the presumed isoform B-chains
showed again a decrease in their apparent size, but the intensity of
the resulting bands differed from the pattern observed for the native
riproximin mixture (Fig. 6A, B, bands B1d–B2d). In contrast, the low-
er bands, corresponding to the A-chains, showed no MW shift after
enzymatic deglycosylation, neither for the native riproximin (Fig-
ure 5A, bands A1d–A3d) nor for the separated riproximin isoen-
zymes (Fig. 6A, B, bands A2d-A3d). Treatment of the proteins with
other deglycosylating enzymes, like O-deglycosydase or the endo-
glycosydase, EndoH, caused no additional shift of the bands (data
not shown). Because enzymatic deglycosylation was effective only
under denaturing conditions, the biological activity of enzymatically
deglycosylated riproximin could not be assessed.
Since an incomplete deglycosylation cannot be excluded when
using enzymes, a chemical deglycosylation was additionally per-
formed. After this treatment, the bands of native riproximin shifted
stronger towards lower MW than after enzymatic treatment. The
various upper bands (B-chains) as well as the lower bands (A-
chains) of native riproximin proteins converged into two single
bands at apparent sizes of 28 and 26 kDa, respectively (Fig. 5B).
During the neutralization and dialysis steps, a significant amount
of riproximin precipitated. Despite extensive dialysis to renature
the proteins, chemically deglycosylated riproximin showed no
detectable cytotoxic activity.
Mass spectrometry analysis
MALDI MS analysis was performed with tryptic digest of each
SDS–PAGE band from native and enzymatically deglycosylated
riproximin resulting in mass spectra representing the peptide pro-
file of each polypeptide. One prominent peptide mass at 1377 Da
appeared in all of the analyzed polypeptides and was therefore
used for normalization of the quantitation. The occurrence of pep-
tides of a specific mass allowed the analyzed bands to be classified
into three groups. All of the presumed A-chains classified within
the groups 1 and 2, while the B-chains classified within group 3
(Table 5).
The MS spectra of the three lower native bands as well as their
deglycosylated forms (Fig. 5A, bands A1–A3 and A1d–A3d) shared
several peptide masses but were distinguishable by the disappear-
ance of prominent peptides of 1453 and 1577 Da and the simulta-
neous appearance of a 1591 Da peptide. Chains A1, A2, A1d and
A2d were thus classified into group 1, while chains A3 and A3d
constituted a similar but different group 2. No prominent mass
change was observed between the spectra of corresponding native
and deglycosylated bands, i.e. between polypeptide A1 and A1d, A2
and A2d or A3 and A3d (Table 5).
The polypeptides from group 3, into which all B-chains classi-
fied, shared with the A-chains only the one prominent mass that
had been used for normalization. Moreover, the MS spectra of
Table 4
Comparison of riproximin batches.
Kernel
material
(g)
Yield of
riproximin
(mg)
Concentration
(lg/ml)
IC50
a
(lg/ml)
Specific
activityb
(U/lg)
Batch
1
10 28.9 3886 1.5 Â 10À4
6700
Batch
2
10 28.4 7100 1.2 Â 10À4
8300
Batch
3
10 28.4 8700 1.4 Â 10À4
7100
Fig. 5. SDS–PAGE analysis of purified riproximin and its deglycosylated counter-
parts: Native, enzymatically and chemically deglycosylated riproximin proteins
were separated by SDS–PAGE and visualized by Coomassie (A) or silver staining (B).
Enzymatic deglycosylation was performed with PNGase F, chemical deglycosylation
by treatment with trifluoromethanesulfonic acid. (A) High resolution (20 Â 30 cm
gel) reducing SDS–PAGE showing the chain patterns of native (lane 2) and
enzymatically deglycosylated riproximin (lane 3), lane 1: molecular weight marker.
Bands that were analyzed by MALDI-TOF are marked with spots. (B) Reducing SDS–
PAGE showing native riproximin (lane 2) and chemically deglycosylated riproximin
(lane 3), lane 1: molecular weight marker.
102 H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105

7. the three B-chains of native riproximin (Fig. 5A, bands B1–B3)
showed high similarity to the two deglycosylated B-chains
(Fig. 5A, bands B1d–B2d), indicating that these polypeptides are
closely related to each other but explicitly different from the lower
bands (Table 5). Apart from the most prominent peak, the MS sig-
nals of the B-chain peptides were very low so that no additional
peptides could be identified in the profile of the deglycosylated
upper bands. Most likely, the glycosylated peptides were not cov-
ered by the MALDI-MS analysis.
A comparison of MS spectra of the riproximin polypeptides with
database proteins found no correspondence. However, a direct
comparison of peptide sequences obtained after de novo sequenc-
ing of the MS/MS data with the protein sequence of African plant
material riproximin (CAJ38823) showed some sequence homology
though no identity. As an example, two peptides with masses of
1377 and 1577 Da were manually sequenced as YVEQQVLAGTLR
and QSGSYGSVVNNGDHR, respectively. The sequence tags LAGT
within the former as well as NNGD within the latter were identical
to the published riproximin sequence, whereas the rest of the se-
quence of these peptides did not show any homology to the pub-
lished riproximin sequence. The peptide with the mass of
1591 Da (sequence: QSGSYGAEVNPGAPTR), which is a marker of
group 2 peptides, showed close homology to the peptide with
the mass of 1577 Da.
Expression of riproximin at transcriptional level
Following RNA extraction and transcription into cDNA a clear
band was obtained after PCR amplification with riproximin specific
primers. Sequencing of this template with internal riproximin spe-
cific primers revealed identity with the published cDNA sequence
(data not shown).
Discussion
Riproximin was initially isolated as the active antineoplastic
component from African plant material of undefined composition
and limited availability. A reliable source was a prerequisite for
the further development of riproximin as a potential new com-
pound for treating cancer. A milestone in this development was
the identification of the semiparasitic plant X. americana as the ori-
gin of the African plant material. Next, the fruit kernels were
shown to exhibit high cytotoxic activity indicating high riproximin
Fig. 6. SDS–PAGE analysis of riproximin isoforms: Riproximin isoforms, Rpx-I and Rpx-II, were partially separated by anion exchange chromatography. Native and
enzymatically deglycosylated riproximin isoforms were analyzed by reducing (A + B) or non-reducing (C) SDS–PAGE and visualized by silver staining. Enzymatic
deglycosylation was performed with PNGase F, which is visible in silver stain as a light band of $ 32 kDa (E). (A) Reducing SDS–PAGE showing the chain pattern of native (lane
1) and enzymatically deglycosylated (lane 2) riproximin isoform 1 (Rpx-I). (B) Reducing SDS–PAGE showing the chain pattern of native (lane 1) and enzymatically
deglycosylated (lane 2) riproximin isoform 2 (Rpx-II). (C) Non-reducing SDS–PAGE showing both riproximin isoforms, Rpx-I (lane 1) and Rpx-II (lane 2). Lane 3: molecular
weight marker.
Fig. 7. Biological activity of riproximin isoforms: The cytotoxic activity of the
enriched riproximin isoforms (Rpx-I and Rpx-II) was compared by a WST-1 assay on
HeLa cell proliferation at 72 h with that of the native riproximin (Rpx).
Table 5
Analysis of MALDI-TOF mass lists of riproximin bands.
a
Peptide signals were marked according to their intensity: 0.5–1.0 (dark grey), 0.2–0.5 (light grey), <0.2 (unmarked).
b
The peptide mass at 1377 Da, which was present in all of the analyzed polypeptides, was used for normalization of the quantitation.
c
The clustering of the normalized MALDI data was performed using the Clustal algorithm with hierarchical clustering, complete linkage and uncentred correlation.
H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105 103

8. concentrations [1]. Because of the regenerative nature of the fruit
kernels, a well defined and potentially unlimited source had been
found. The next milestone was to establish a robust, reproducible
and up-scalable purification protocol for riproximin from X. amer-
icana fruit kernels. Furthermore, the polypeptide composition and
biological activity of the fruit kernel riproximin had to be com-
pared to that of riproximin from the African plant material to dem-
onstrate the equivalence of these proteins.
The established purification protocol for riproximin from Afri-
can plant material was not applicable for the fruit kernels. Thus,
a new purification method had to be developed.
While the African plant material was a dry and low-fat but tan-
nin-rich powder, the fresh fruit kernel material contained a high
amount of lipids that interfered with protein binding to the chro-
matography resins. The optimal procedure involved a combination
of aqueous extraction and subsequent clearance of the extract by
chloroform, since it provided the best binding and elution of kernel
riproximin in the subsequent chromatographic step.
Analogous to the pre-purification of the aqueous extract obtained
from the African plant material, for the coarse chromatographic step
the strong anion exchanger, CaptoQ, was chosen as a robust and
FPLC-suitable alternative to DEAE cellulose. For the affinity chroma-
tography a prototype lactosyl–Sepharose was used. It is a classical
Sepharose with immobilized lactose, which additionally contains
cationic charges that lead to anionic interactions, typical for an anion
exchange resin. A NaCl concentration of 200 mM was chosen for elu-
tion from the strong anion exchanger, since this concentration pro-
vided optimal binding to lactosyl–Sepharose as well as the highest
purity of the final riproximin eluates.
Fruit kernel riproximin showed the same cytotoxic activity
(IC50 = 2.3 pM, HeLa) as that from the African plant material
(IC50 = 1.1 pM, HeLa). However, the amount of riproximin obtained
from fruit kernels was considerably higher than that from the iden-
tical net weight of African plant material. X. americana fruit kernels
can thus serve as an abundant and potentially unlimited riproxi-
min source.
Riproximin purified from the X. americana fruit kernels showed
the same physico-chemical and biological properties as the African
plant material riproximin, including solubility, charge, lectin bind-
ing activity, cytotoxicity as well as specific ribosome depurination
[8]. However, its SDS–PAGE band pattern differed considerably
from that of African plant material riproximin. The latter had
shown four distinct protein bands under reducing conditions,
which had been assigned to the respective A- and B-chains of
two riproximin isoforms [2]. In contrast, riproximin from fruit ker-
nels showed three overlapping bands in the range of 30–35 kDa,
that were assumed to be B-chains and three bands in the range
of 25–29 kDa, presumably corresponding to the A-chains.
This chain assignment is in agreement with the typical type II
RIP structure, consisting of two chains, A- and B-, which are con-
nected by a disulfide bond [13]. Moreover, the typical A- and B-
chain pattern of fruit kernel riproximin was corroborated by MS
analysis.
The typical RIP B-chain is a lectin with specific sugar affinity.
Characterized by a MW of approximately 35 kDa it is slightly larger
than the corresponding A-chain [4,14]. The B-chain of type II RIPs
contains highly conserved asparagines [15], which are heavily gly-
cosylated. Both potential glycosylation sites were shown to be
present in the published riproximin B-chain sequence, too [2].
A size of 30–35 kDa as well as a diffuse appearance that is typ-
ical for glycosylation also characterized the upper three bands in
the SDS–PAGE pattern of fruit kernel riproximin, which therefore
were considered as B-chains. As expected, enzymatic deglycosyla-
tion lowered their MW and led to a decreased overall complexity of
the B-chain band pattern, indicating that heterogeneous oligosac-
charides present on the native polypeptidic backbones had been
removed. Moreover, in the MS analysis the native riproximin’s B-
chains as well as their deglycosylated counterparts were recog-
nized as a distinct group of very similar polypeptides clearly distin-
guishable from the A-chains. The MS observations therefore not
only support the classification of theses bands as B-chains, but also
provide clues about their isoenzyme nature, when considered to-
gether with the results of the analysis of the partially purified
riproximin isoforms.
The type II RIP active A-chain with N-glycosidase activity is
approximately 30 kDa in size and can also be glycosylated [14].
The A-chain of ricin, for example, was described to contain one or
two glycosylation sites [16,17]. The published riproximin A-chain
amino acid sequence showed only one potential N-glycosylation
site, which could be abolished by a single nucleotide polymorphism
[2]. Accordingly, fruit kernel riproximin’s lower bands, which were
considered to be the A-chains, were of lower MW and clearly de-
fined. Upon PNGase treatment, no MW shift was observed for these
polypeptides. However, after chemical deglycosylation, all three
bands converged at the level of the lowest one, indicating that the
upper two bands possess PNGase-resistant glycosylation.
MS analysis assigned the A-chains into two similar but not iden-
tical homology groups. This can be exemplified by the identified
peptides with the masses of 1577 and 1591 Da, which are key
markers for groups 1 and 2, respectively and showed a high degree
of homology. Together, these findings strongly support the hypoth-
esis that fruit kernel riproximin consists of a mixture of at least two
isoenzymes.
The fact that after chemical deglycosylation of riproximin only
two bands remained does not exclude the presence of isoforms,
since a similar electrophoretic mobility might hide subtle differ-
ences in amino acid composition. Accordingly, the two riproximin
isoforms, which could be partially separated by chromatographic
methods, differed explicitly within their A-chains, while they still
showed very similar physico-chemical and biological properties.
Type II RIP isoforms are common in plants expressing this group
of proteins [4,14]. For many of them, gene families coding for differ-
ent isoenzymes with various homology degrees have been described
[15]. For ricin, the best investigated type II RIP, several isoforms
including ricin D, ricin E and Ricinus communis agglutinin (RCA) have
been characterized [18]. Ricin D and RCA show 84% identity within
their B-chains and 93% within their A-chains [19]. Ricin E appears
to be a gene recombination product of ricin D and RCA [20]. The ri-
cin/RCA gene family is assumed to be composed of 7–8 members,
of which at least three are non-functional [21,22]. Three lectin iso-
forms have been isolated from mistletoe (Viscum album), MLI, MLII
and MLIII, which differ in their MW and sugar specificity. Accord-
ingly, three different genes have been described to encode these lec-
tins [23,24]. For the Korean mistletoe (Viscum album coloratum)
several cDNA isoforms have been amplified using a single primer
set, indicatingthat heterogeneityof the mistletoelectins is not solely
due to posttranslational modifications [25]. Himalayan mistletoe re-
vealed four different protein isoforms, which have not yet been char-
acterized on DNA level [26]. Several different isoforms have also
been described for the type II RIPs expressed by plants of the Sambu-
cus genus. Sambucus nigra, for example, produces the three lectins
SNAI, SNAI’and SNAV (nigrin b), and the two lectin-related proteins
SNALRP1 and SNALRP2 [15,27].
Interestingly, expression of the isoforms can vary with the plant
tissue [7,28,29], maturation status [18,30] and season [31–33].
Moreover, the genetic drift observed in plants from the same spe-
cies from different continents has been shown to lead to the
expression of isoforms. For example, a new lectin ricin E has been
described in Ricinus communis adapting from the tropical to the
temperate zone [20].
The finding that the MS analysis did not prove identity between
fruit kernel riproximin and the published riproximin sequence
104 H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105

9. should be considered within this context. Molecular biology anal-
ysis demonstrated that the published riproximin sequence was
present in the fruit kernel RNA pool. Extensive posttranslational
processing is, however, an intrinsic part of type II RIP protein syn-
thesis and expected to account for some dissimilarity between the
protein- and cDNA-derived peptide maps. RIPs of type II are syn-
thesized as precursors from a single gene and posttranslationally
modified by proteolysis. The amino acid sequence of the N- and
C-terminal peptides of the mature A- and B-chains is therefore
not identical with the theoretic sequence obtained by translation
from the precursor mRNA sequence. Moreover, glycosylation is ex-
pected to interfere with the MS identification of the internal pep-
tides that contain the respective sites.
However, apart from these considerations, the fact that the pub-
lished sequence of riproximin could be confirmed at RNA but not at
protein level strongly suggests that not only various riproximin
genes exist in X. americana, but also that the encoded, different iso-
forms are translated at different efficacies, as common for other
type II RIP expressing plants.
For better understanding the genetic identity of the riproximin
isoforms, deeper analyses including de novo protein sequencing
supported by advanced molecular biology methods need to be
employed.
In summary, X. americana fruit kernels were a defined, season-
ally available and potentially unlimited herbal source for riproxi-
min. The newly established purification procedure was
reproducible, supplied highly pure riproximin and is suitable for
up-scaling. The resulting product, fruit kernel riproximin, consists
of a mixture of closely related isoforms, which are strongly related
to the riproximin isoforms that had been characterized from the
African plant material. The riproximin isoforms possessed very
similar physical and biological properties that render them difficult
to separate.
Nevertheless, the appearance, biochemical and biological prop-
erties of the purified riproximin isoform mixture were consistent
over many purification batches. Therefore, riproximin purified
based on the established protocol can and will be used for further
research and development.
Acknowledgments
Helene Bayer was funded by a grant from the Federal Ministry
of Economics and Technology (Pro Inno II, KF0425101UL6). We
thank Dr. Bernd Heiss from GE Healthcare for technical advice
and kindly providing the prototype resin lactosyl–Sepharose.
References
[1] C. Voss, E. Eyol, M.R. Berger, Identification of potent anticancer activity in
Ximenia americana aqueous extracts used by African traditional medicine,
Toxicol. Appl. Pharmacol. 211 (2006) 177–187.
[2] C. Voss, E. Eyol, M. Frank, C.W. von der Lieth, M.R. Berger, Identification and
characterization of riproximin, a new type II ribosome-inactivating protein
with antineoplastic activity from Ximenia americana, FASEB J. 20 (2006) 1194–
1196.
[3] S. Olsnes, The history of ricin, abrin and related toxins, Toxicon 44 (2004) 361–
370.
[4] F. Stirpe, Ribosome-inactivating proteins, Toxicon 44 (2004) 371–383.
[5] Y. Endo, K. Tsurugi, The RNA N-glycosidase activity of ricin A-chain. The
characteristics of the enzymatic activity of ricin A-chain with ribosomes and
with rRNA, J. Biol. Chem. 263 (1988) 8735–8739.
[6] Y. Endo, A. Gluck, I.G. Wool, Ribosomal RNA identity elements for ricin A-chain
recognition and catalysis, J. Mol. Biol. 221 (1991) 193–207.
[7] F. Stirpe, M.G. Battelli, Ribosome-inactivating proteins: progress and problems,
Cell Mol. Life Sci. 63 (2006) 1850–1866.
[8] C. Horrix, Z. Raviv, E. Flescher, C. Voss, M.R. Berger, Plant ribosome-inactivating
proteins type II induce the unfolded protein response in human cancer cells,
Cell Mol. Life Sci. 68 (2011) 1269–1281.
[9] H. Zwierzina, L. Bergmann, H. Fiebig, S. Aamdal, P. Schoffski, K. Witthohn, H.
Lentzen, The preclinical and clinical activity of aviscumine: A potential
anticancer drug, Eur. J. Cancer 47 (2011) 1450–1457.
[10] L. Herrera, B. Bostrom, L. Gore, E. Sandler, G. Lew, P.G. Schlegel, V. Aquino, V.
Ghetie, E.S. Vitetta, J. Schindler, A phase 1 study of Combotox in pediatric
patients with refractory B-lineage acute lymphoblastic leukemia, J. Pediatr.
Hematol. Oncol. 31 (2009) 936–941.
[11] P. Weingarten, P. Lutter, A. Wattenberg, M. Blueggel, S. Bailey, J. Klose, H.E.
Meyer, C. Huels, Application of proteomics and protein analysis for biomarker
and target finding for immunotherapy, Methods Mol. Med. 109 (2005) 155–
174.
[12] M.B. Eisen, P.T. Spellman, P.O. Brown, D. Botstein, Cluster analysis and display
of genome-wide expression patterns, Proc. Natl. Acad. Sci. USA 95 (1998)
14863–14868.
[13] J.D. Robertus, A.F. Monzingo, The structure of ribosome inactivating proteins,
Mini. Rev. Med. Chem. 4 (2004) 477–486.
[14] L. Barbieri, M.G. Battelli, F. Stirpe, Ribosome-inactivating proteins from plants,
Biochim. Biophys. Acta 1154 (1993) 237–282.
[15] M.R. Hartley, J.M. Lord, Genetics of ribosome-inactivating proteins, Mini Rev.
Med. Chem. 4 (2004) 487–492.
[16] M.R. Hartley, J.M. Lord, Cytotoxic ribosome-inactivating lectins from plants,
Biochim. Biophys. Acta 1701 (2004) 1–14.
[17] Y. Kimura, S. Hase, Y. Kobayashi, Y. Kyogoku, T. Ikenaka, G. Funatsu, Structures
of sugar chains of ricin D, J. Biochem. 103 (1988) 944–949.
[18] J.M. Lord, L.M. Roberts, J.D. Robertus, Ricin: structure, mode of action, and
some current applications, FASEB J. 8 (1994) 201–208.
[19] L.M. Roberts, F.I. Lamb, D.J. Pappin, J.M. Lord, The primary sequence of Ricinus
communis agglutinin, comparison with ricin, J. Biol. Chem. 260 (1985) 15682–
15686.
[20] T. Araki, G. Funatsu, The complete amino acid sequence of the B-chain of ricin
E isolated from small-grain castor bean seeds. Ricin E is a gene recombination
product of ricin D and Ricinus communis agglutinin, Biochim. Biophys. Acta
911 (1987) 191–200.
[21] J. Leshin, M. Danielsen, J.J. Credle, A. Weeks, K.P. O’Connell, K. Dretchen,
Characterization of ricin toxin family members from Ricinus communis,
Toxicon 55 (2010) 658–661.
[22] J.W. Tregear, L.M. Roberts, The lectin gene family of Ricinus communis: cloning
of a functional ricin gene and three lectin pseudogenes, Plant Mol. Biol. 18
(1992) 515–525.
[23] H. Franz, P. Ziska, A. Kindt, Isolation and properties of three lectins from
mistletoe (Viscum album L.), Biochem. J. 195 (1981) 481–484.
[24] A.G. Kourmanova, O.J. Soudarkina, S. Olsnes, J.V. Kozlov, Cloning and
characterization of the genes encoding toxic lectins in mistletoe (Viscum
album L), Eur. J. Biochem. 271 (2004) 2350–2360.
[25] C.H. Park, D.W. Lee, T.B. Kang, K.H. Lee, T.J. Yoon, J.B. Kim, M.S. Do, S.K. Song,
CDNA cloning and sequence analysis of the lectin genes of the Korean
mistletoe (Viscum album coloratum), Mol. Cells 12 (2001) 215–220.
[26] V. Mishra, R.S. Sharma, S. Yadav, C.R. Babu, T.P. Singh, Purification and
characterization of four isoforms of Himalayan mistletoe ribosome-
inactivating protein from Viscum album having unique sugar affinity, Arch.
Biochem. Biophys. 423 (2004) 288–301.
[27] I. Kozlov, O.I. Sudarkina, A.G. Kurmanova, Ribosome-inactivating lectins from
plants, Mol. Biol. (Mosk) 40 (2006) 711–723.
[28] A. Gasperi-Campani, L. Barbieri, E. Lorenzoni, L. Montanaro, S. Sperti, E. Bonetti,
F. Stirpe, Modeccin, the toxin of Adenia digitata. Purification, toxicity and
inhibition of protein synthesis in vitro, Biochem. J. 174 (1978) 491–496.
[29] F. Stirpe, L. Barbieri, A. Abbondanza, A.I. Falasca, A.N. Brown, K. Sandvig, S.
Olsnes, A. Pihl, Properties of volkensin, a toxic lectin from Adenia volkensii, J.
Biol. Chem. 260 (1985) 14589–14595.
[30] R.J. Youle, A.H. Huang, Protein bodies from the endosperm of castor bean:
subfractionation, protein components, lectins, and changes during germination,
Plant Physiol. 58 (1976) 703–709.
[31] T. Girbes, J.M. Ferreras, F.J. Arias, R. Munoz, R. Iglesias, P. Jimenez, M.A. Rojo, Y.
Arias, Y. Perez, J. Benitez, D. Sanchez, M.J. Gayoso, Non-toxic type 2 ribosome-
inactivating proteins (RIPs) from Sambucus: occurrence, cellular and
molecular activities and potential uses, Cell Mol. Biol. (Noisy. -le-grand) 49
(2003) 537–545.
[32] M.A. Rojo, L. Citores, F.J. Arias, J.M. Ferreras, P. Jimenez, T. Girbes, CDNA
molecular cloning and seasonal accumulation of an ebulin l-related dimeric
lectin of dwarf elder (Sambucus ebulus L) leaves, Int. J. Biochem. Cell Biol. 35
(2003) 1061–1065.
[33] M. Nsimba-Lubaki, W.J. Peumans, Seasonal fluctuations of lectins in barks of
elderberry (Sambucus nigra) and black locust (Robinia pseudoacacia), Plant
Physiol. 80 (1986) 747–751.
H. Bayer et al. / Protein Expression and Purification 82 (2012) 97–105 105