This document discusses genetic markers and their use in plant breeding. It begins by defining genetic markers as locations on chromosomes that can be used as landmarks for genome analysis. It then provides examples of different types of markers, including morphological, biochemical, and molecular DNA-based markers. The bulk of the document focuses on DNA-based markers, describing different marker techniques, characteristics of good markers, and applications of markers such as gene tagging, mapping, and marker-assisted selection. It concludes by listing some DNA-based marker work being done at Indira Gandhi Krishi Vishwavidyalaya related to traits like drought tolerance and disease resistance.

1. Satish Verulkar
Department of Plant Molecular Biology and Biotechnology
Indira Gandhi Krishi Vishwavidyalaya
Raipur (C.G.) 492 006

2. What is a marker?
 An object used to indicate a position, place, or
route.
 Any thing which is used for the purpose of
identification
 Genetic markers are specific locations on a
chromosome which serve as landmarks for
genome analysis

3. Can you identify these ladies are from which community?
Yes, you guessed it right – European, Chinese, Indian, African
How you guessed? Used one or more features
(may be hair, eye color, nose and other facial features)
So all those features are markers

4. Why Markers?
• Let me tell you the utility of marker with one example
• Suppose you want to improve variety “X” for BLB resistance
• Normally we will make cross between a donor for BLB
resistance and the recipient variety “X”
• The F2 generation of this cross will segregate for resistance
and susceptibility
• Say Yes or No, Yes it will segregate
• BUT you can identify susceptible plants IF disease severity
is optimum, and if NOT then what? – No Selection
• At this point Marker can help in identifying resistant plant
even in the absence of disease incidence

5. Segregating Population (NO selection possible)
Segregating Population (Resistant Plants can be selected)
NO Disease development
Optimum Disease severity
TtRr Ttrr TtRr Ttrr Ttrr TtRrttrr ttRr ttrr ttRr ttRr ttrr
TtRr Ttrr TtRr Ttrr Ttrr TtRrttrr ttRr ttrr ttRr ttRr ttrr

6. Types of Markers
• Morphological / Cytological Markers
• Biochemical Markers
• Molecular (DNA based) Markers

7. Morphological Markers

8. Rice Hybrid (KRH-2)
DNA based Marker

9. Tall and Resistant (Donor) Dwarf and susceptible (Recipient)
TTRR
ttrr
F1 - Tall and Resistant (Donor)
TtRr
ttrr
Test cross progeny
TtRr Ttrr TtRr Ttrr Ttrr TtRrttrr ttRr ttrr ttRr ttRr ttrr
Tall and Resistant - 3 Dwarf and Resistant - 3
Independent Assortment
Tall and Susceptible - 3 Dwarf and Susceptible - 3

10. Tall and Resistant (Donor) Dwarf and susceptible (Recipient)
TTRR
ttrr
F1 - Tall and Resistant (Donor)
TtRr
ttrr
Test cross progeny
TtRr TtRr TtRr TtRr TtRr TtRrttrr ttrr ttrr ttrr ttrr ttrr
Tall and Resistant - 6 Dwarf and susceptible - 6
Linkage (Tall plant can be used as marker for resistance)

11. DNA based SSR marker
Variety A Variety B
RM m r
A B
M
mMarker for R Marker for r

12. Genetic Bases of Polymorphism
Variation in DNA
– Sequence variation
CGCACGATATGATTAA CGCACGGAATGATTAA
GCGTGCTATACTAATT GCGTGCCTTACTAATT
– Length variation
CGCATGATGATGATGGAA CGCATGATGATGATGATGATGGAA
GCGTACTACTACTACCTT GCGTACTACTACTACTACTACCTT

13. DNA based Marker techniques
 Restriction fragment length polymorphism (RFLP) (Wyman and White 1980, Botstein et al.1980
 Multi-locus minisatellite fingerprinting (Jeffreys et al., 1985)
 Random amplified polymorphic DNA (RAPD) (Williams et al. 1990)
 Amplified (restriction) Fragment length Polymorphism (AFLP) (Vos et al. 1995)
 Simple sequence repeat PCR (SSR-PCR) (Litt and Luty 1989, Weber and May 1989, Tautz 1989)
 Allele specific oligonucleotide (ASO) hybridization (Saiki et al. 1986)
 TaqMan ASO (Livak et al. 1995)
 Allele specific reverse dot blot hybridization (Keller et al. 1991)
 Single strand conformation polymorphism (SSCP) (Orita et al. 1989)
 Cleaved amplified polymorphic sequence (CAPS) analysis (Konieczny and Ausubel 1993)
 Coupled amplification and sequencing (CAS) (Ruano and Kidd 1991)
 Amplification refractory mutation system (ARMS) (Newton et al. 1989)
 Oligonucleotide ligation assay (OLA) (Landegren et al. 1988, Nickerson et al. 1990)
 Coupled amplification and oligonucleotide ligation (CAL) (Eggerding 1995)
 Genetic bit analysis (GBA) (Nikiforov et al. 1994)
 Oligonucleotide arrays (reviewed in Southern 1996)
 Alu-PCR (Nelson et al. 1989)
 rep-PCR (Versalovic et al. 1994)
 Microsatellite-primed PCR (MP-PCR) (Meyer et al. 1993; Perring et al. 1993)
 Anchored MP-PCR (AMP-PCR) (Zietkiewicz et al. 1994)
 Random amplified microsatellite polymorphism (RAMP) (Wu et al. 1994)
 Random amplified hybridization microsatellites (RAHM) (Cifarelli et al. 1995,
 Richardson et al. 1995; Ender et al. 1996)
 Nucleic acid scanning-by-hybridization (NASBH) (Salazar and Caetano-Anollés 1996)
 RAPD dot-blot hybridization (Penner et al. 1996)
 Differential display reverse transcription (DDRT) PCR (Liang and Pardee 1992)
 RNA arbitrarily primed PCR (RAP-PCR) (Welsh et al. 1992)
 cDNA-AFLP (Bachem et al. 1996)
 Amplified fragment length polymorphism (AmpFLP) (Jeffreys et al. 1988)
 Minisatellite variant repeat PCR (MVR-PCR) (Jeffreys et al. 1991)
 Arbitrarily primed PCR (AP-PCR) (Welsh and McClelland 1990)
 DNA amplification fingerprinting (DAF) (Caetano-Anollés et al. 1991)
 Minihairpin primer-driven DAF (mhpDAF) Caetano-Anollés and Gresshoff 1994)
 Arbitrary signatures from amplification profiles (ASAP) (Caetano-Anollés and Gresshoff 1996)

14. Characters of Good Markers
• Highly polymorphic
• Highly stable and reproducible
• Evenly distributed through the genome
• Low cost
• Easy to observe
• Preferably should work across species
• Preferably should be co-dominant
• With known map position
• Exhibits Mendelian Inheritance

15. Applications of DNA Marker
 Diversity analysis
 DNA Fingerprinting Protecting intellectual property
 Varietal Identification
 Paternity diagnostic / Testing of hybridity
 Tagging and Mapping of genes
 Marker Assisted Selection
 Foreground selection
 Background selection
 Pyramiding of genes
 Identification of QTLs
 Identification of Candidate Genes
 Positional gene isolation
 Establishment of Syntenic relationships
 Phylogeny and evolution
 Disease diagnostics
 Identification of Microbes
 Genome analysis
 …………

16. DNA based marker work at IGKV
• DNA fingerprinting of all rice accessions
• Identification of QTLs for drought tolerance
• Introgression of QTLs for drought tolerance
• Introgression of genes for BLB, Blast and Gall midge.
• Identification of markers for grain yield and other
important traits
• Identification of markers for Nutrient Use Efficiency
• Bar coding of rice varieties

17. • For any discussion on this topic do write to
me, my E-mail ID is
satishverulkar@gmail.com
• My phone number is 9752152034