Recommended
More Related Content
Similar to cell & dna.pptx
Similar to cell & dna.pptx (20)
More from carlmanaay
More from carlmanaay (20)
Recently uploaded
Recently uploaded (20)
cell & dna.pptx
- 1. First Class - PowerPoint lectures will be available on FirstClass - Go to: http://www.place.dawsoncollege.qc.ca/ Conferences Courses Physics 982-003-50(Conted) Brian’s Bio lecture folder Download ppt file
- 2. Lecture PowerPoint slides - PowerPoint lectures will be available on FirstClass • To print • Print ―Print what: Handouts Handouts: Slides per page: 3, 6, 9 (your choice)
- 3. BIOLOGY 003 Part 1: The Cell and DNA
- 4. What is Biology? The Scientific Study of Life Very Broad topic
- 7. So…
- 8. Order: living things are made up of cells Bacterial cells Plant cells Human bone cells Cells are the basic unit of life Single celled protist
- 9. Order Each cell has internal order & the cells within the body have specific arrangements & functions
- 10. Cell theory: principle in biology fundamental 1. a cell is the smallest unit of life 2. cells make up all living things 3. new cells arise from pre-existing cells
- 11. The Cell: as fundamental to biology as the atom is to chemistry atoms molecules cells tissues organ system http://aimediaserver4.co m/studiodaily/videoplaye r/?src=ai4/harvard/harva rd.swf&width=640&heig ht=520
- 12. Cell Size Mostneurons in µm range Eukaryotes Prokaryotes
- 13. Limitations to Cell size Cell size – variable small : 8 to 100 um 1 meter = 1000 mm = 1 000 000 um Larger organisms do not generally have larger cells than smaller organisms—simply more cells. Why so small?
- 14. Limitations to cell Size: homeostasis • Oxygen required • Waste products are released – must be removed from cell •Exchanges food, gases, nutrients takes place through cell surface cell size metabolic needs •As a cell becomes larger, its volume increases at a greater rate than its surface area (plasma membrane)
- 15. Cell Size limited by : • Cell surface area (plasma membrane) • Surface area-to-volume ratio • Metabolic demands: determined by volume •But the transport of materials into or out of the cell is determined by surface area Volume increases faster than surface area
- 16. Surface area / Volume Ratio • Small objects have large surface area to volume ratio • Cells – small lots of surface area Ex:
- 17. Things all Cells have in Common • surrounded by a membrane • internal mass (cytoplasm) • contain genetic information (DNA) • have ribosomes (protein synthesis)
- 18. Two Major Types of Cells • Prokaryotic cells – Domain: Bacteria and Archaea – No nucleus – Lack most organelles • Eukaryotic cells – Domain: Eukarya – Nucleus present in each cell – Organelles present
- 19. 1 µm Organelles Nucleus (contains DNA) Membrane Cytoplasm DNA (no nucleus) Membrane Eukaryotic cell Prokaryotic cell vs. Virus
- 20. • DNA – free in cytoplasm • ribosomes • outer capsule (sugar or protein) • cell wall Cytosol (fluid) Prokaryotic cells
- 21. Comparison Between Eukaryotic and Prokaryotic Cells Table 3.1
- 22. Eukaryotic Cell ex: plant and animals -Typically larger -Contain internal membranes that form organelles (more complex) - DNA in membrane bound nucleus
- 23. Plasma Membrane A cell is surrounded by Plasma Membrane - boundary between cell contents and surroundings -everything that enters/leaves cell passes through cell membrane - divides cells into compartments Why would me want to separate internal and external environments?
- 24. Structure of Plasma Membranes Two components: 1.Phospholipid molecules 2.Protein molecules
- 26. Phospholipid Molecules • One end attracted to water (Head) • One end repelled by water (Tail) When placed in water: - they self assemble into a bi- layer (double layer) - shield hydrophobic portions
- 27. Cell organization & Size - to maintain homeostasis: cell contents separated from external environment plasma membrane Phospholipid bi-layer (Proteins not shown) Cell Membrane: - Selectively permeable: it allows some substances to cross it more easily than others
- 28. Cytoplasm & Cytosol • Cytoplasm: region between the nucleus and the plasma membrane • Cytosol: semifluid substance within the membrane – contains the organelles (makes up most of the cell mass) - Therefore; the cytoplasm is filled with cytosol
- 29. Nucleus • contains Genes • wrapped in double membrane = nuclear envelope
- 30. Nucleus: Contains DNA + Protein • Chromatin: loosely arranged DNA and Protein • Chromosomes: tightly packed Contains Nucleolus: Not membrane bound makes ribosomes
- 31. The Cell’s Heritable Information - All cells contain deoxyribonucleic acid (DNA) = heritable material that directs the cell’s activities. Inherited DNA Directs development of an organism
- 32. Information Transfer -Living things must have a set of instructions that allow them to grow, develop, respond to stimuli, reproduce… - those ―instructions‖are found in DNA - blueprint for all cellular activities - DNA made up of genes -Genes are the units of inheritance that transmit information from parents to offspring.
- 33. Four main classes of biological molecules 1.Carbohydrates 2. Lipids 3. Proteins 4. Nucleic acids
- 34. Organic Compounds • Contain carbon (C backbone) • Most contain H and O • May contain other elements N = Nitrogen P = Phosphorus S = Sulfur
- 35. Why is Carbon Special? Carbon can form 4 covalent bonds – bonds with up to 4 separate atoms – can bond with other C atoms long chains of carbon atoms can combine with many other kinds of atoms
- 36. • Straight chains – short or long • Branched chains – Single or multiple • Rings Carbon Skeleton:
- 37. Distinctive properties of an organic molecule depends on: 1) Arrangement of carbon skeleton 2)Functional groups = molecular components attached to that carbon skeleton) • Give molecule distinctive chemical properties
- 40. Biological molecules are composed of subunits that are linked to each other • Single unit = monomer (pearl) • Chain or ring of of monomers = polymer (pearl necklace)
- 41. Synthesis and Breakdown of Polymers • Synthesis –Addition of subunits chain grows • Breakdown –Removal of subunits chain shortens
- 42. Dehydration synthesis: Building Chains (polymers)
- 43. Condensation or Dehydration synthesis is the chemical reaction that links repeating subunits together. When dehydration synthesis occurs, a bond forms and WATER is released. Result: • Increase in ―chain‖ •molecule of water released
- 44. Breakdown of polymers Hydrolysis: Splitting a polymer by the addition of water
- 45. Nucleic acids (DNA and RNA)
- 46. Nucleic acids Purpose: - Store and transmit hereditary information in Genes = units of inheritance - Program amino acid sequence of Proteins Made of nucleotides
- 47. Types 1. Deoxyribonucleic acid (DNA): Stores information for protein synthesis 2.Ribonucleic acid (RNA): Directs protein synthesis
- 48. Structure – Consists of building blocks called nucleotides Nitrogenous base CH2 5’C 3’C O O P O O Phosphate group Pentose sugar Nucleotide O i) phosphate molecule (P) ii) 5-carbon sugar (S) iii) nitrogenous base (B)
- 49. Structure Nucleotides form chains called polynucleotides Fig. 5-27ab 5'C 3'C 3' end (a) Polynucleotide, or nucleic acid Nucleoside Nitrogenous base 5'C Phosphate 3'C group Sugar (pentose) Nitrogenous base CH2 5’C 3’C O O P O O Phosphate group Pentose sugar (b) Nucleotide O
- 50. Structure Nucleotide = building block Nucleic acid = chain
- 51. DNA vs. RNA DNA RNA Phosphate Sugar Deoxyribose Ribose Bases Adenine (A) Guanine (G) Cytosine (C) _ Thymine (T) Double stranded Uracil (U) Single-stranded
- 52. DNA and RNA – 4 POSSIBLE NUCLEOTIDES FOR EACH DNA RNA
- 53. DNA • Needed for cell replication • Contains genes • Genes tell cells which proteins to make • Complementary base pairing Hydrogen bond J Watson & F Crick Cambridge University; 1953 The sequence of bases along a nucleotide polymer is unique for each gene
- 54. DNA Assembly P P – B S -- B - S P P S - B -- B - S P P S - B -- B - S P P S - B -- B - S Bases: Adenine (A) Guanine (G) Cytosine (C) Thymine (T) 2 strands held together by hydrogen bonds between the paired bases
- 55. Complementary Base Pairing In DNA: A and T C and G – always line up together! Referred to as complementary base pairing
- 56. P P S – A -- T -- S P P S -- G -- C --S P P S -- C -- G -- S P P S -- T -- A -- S DNA Assembly
- 57. Summary: DNA •DNA contains the genetic code • DNA contains ―blueprint‖for making different proteins DNA over 2m long!
- 58. The way DNA encodes a cell’s information is analogous to the way we arrange the letters of the alphabet RAT = ART= Sequence in letters = changes in meaning Sequence of nucleotides = different proteins
- 59. Genetic Information • Each gene carries information needed to make a specific PROTEIN • Genes carry information that determines the primary sequence of the protein Protein synthesis
- 61. Proteins Proteins account for 50% of the organic matter in a typical animal body, and they play a critical role in almost all life processes
- 62. Proteins • Proteins are made of amino acids. • There are 20 common a.a. • Polypeptide: chain of a.a. • Protein: 1 or more polypeptides folded/coiled into a specific shape
- 63. Amino Acids - building blocks of proteins • All amino acids have same basic skeleton: R group - variable Carboxyl group
- 64. • Animal cells can make some, but not all amino acids • Essential a.a.: those that we can’t make or make enough of to meet our needs. – Required from diet Essential Amino Acids Asparagine Ammonia (pee) and Oxaloacetate Asparagusic Acid Methylmercaptan
- 66. Protein = chain of amino acids Synthesis reaction As the chain grows you create a polypeptide
- 67. Structure • very complex – large variety of amino acids – very large – different protein molecules have their own distinct shape
- 68. 4 levels of structure • Primary • Secondary • Tertiary • Quaternary • Polypeptide can spontaneously organize into complex shapes (change) • Protein shape essential to function – Ex receptor, antibody, enzyme
- 69. i) PRIMARY STRUCTURE: - Number and Sequence Each sphere = 1 amino acid Ex. insulin
- 70. ii) SECONDARY STRUCTURE: 2 types a) alpha helix (coiled) Hydrogen bonds hold helix cells in shape
- 71. b) Beta Pleated sheet (folded) ii) SECONDARY STRUCTURE Hydrogen bonds hold neighboring strands of sheet together
- 72. iii) TERTIARY STRUCTURE: Protein already coiled or folded Examples: Hydrogen bonds Ionic Bonds Disulfide bridges Hydrophobic interactions
- 73. iv) QUATERNARY STRUCTURE The fusion of two or more proteins Examples:
- 74. A very important protein: Ribosome • Uses RNA to make other proteins • Made in the nucleolus
- 75. Conformation: determines function - single amino aid substitution
- 76. Denaturation - when a protein unravels and loses its native conformation Denaturation Renaturation Denatured protein Normal protein
- 77. •For cell to reliably make proteins, it must be able to control the placement of animo acids •Each protein has its own unique primary sequence! Proteins are complex –made up of building blocks called amino acids –20 different kinds –number and sequence of the aa’s = primary sequence controls shape function Recall… Protein Structure
- 78. How does the Information on the DNA Molecule get Converted into a Protein? • DNA not used directly • Involves various forms of RNA (the other nucleic acid) • Accomplished by a process called: PROTEIN SYNTHESIS
- 79. mRNA Synthesis of mRNA in the nucleus DNA NUCLEUS mRNA CYTOPLASM Ribosome Amino acids Polypeptide 1 2 Movement of mRNA into cytoplasm via nuclear pore 3 Synthesis of protein P ro te in S y nt h e si s Transcription Translation
- 80. 1) Transcription DNA RNA 2) Translation RNA Protein 2 major steps in protein synthesis (information storage) (information carrier) (product)
- 81. Step 1: Transcription Transcription = transfer of genetic information from DNA to messenger RNA (mRNA)
- 82. Transcription a) Separation of DNA Gene = DNA Sequence that codes for a protein:
- 83. Transcription of a Hypothetical Gene: a) Separation of DNA ATG GGA TTT AAC CCT GGA GGG TAA * TAC CCT AAA TTG GGA CCT CCC ATT** - Two strands separate in region of gene XXXX XXXX ATG GGA TTT AAC CCT GGA GGGTAA XXXXXX XXXXXX **TAC CCT AAA TTG GGA CCT CCC ATT** **coding strand
- 84. Transcription: b) Synthesis of mRNA Synthesis of an RNA molecule that is complementary to the DNA (following the base pair rule) DNA mRNA = This molecule is called messenger RNA
- 85. Transcription: b) Synthesis of mRNA (DNA) XXXX ATG GGA TTT AAC CCT GGA GGG TAA XXXXXX (mRNA) AUG GGA UUU AAC CCU GGA GGG UAA (DNA)XXXX TAC CCT AAA TTG GGA CCT CCC ATT ** XXXX DNA: A T C G RNA: U A G C
- 86. Summary of Transcription and Release of completed mRNA molecule enzyme Once the mRNA molecule is complete the transcription process is over
- 87. • Transfer of information from DNA to mRNA completes first phase of protein synthesis (Transcription) Next question: How is the information in mRNA used to make a protein?
- 88. What information do we have? mRNA: AUG GGA UUU AAC CCU GGA GGG UAA Need to: convert nucleic acid language (in the mRNA) into amino acid language (protein)
- 89. Step 2: Translation Polypeptide Amino acids tRNA with amino acid attached Ribosome tRNA Anticodon Codons 3 5 mRNA Translation = Assembly of the protein primary structure according to instructions (codon sequence) on the mRNA
- 90. •information on mRNA is contained in groups of 3 nucleotides called CODONS mRNA: AUG GGA UUU AAC CCU GGA GGG UAA •Codons on mRNA provide the sequence or order in which the amino acids must be arranged to create the primary structure of the protein •mRNA has the information but doesn’t do the work Translation mRNA Protein
- 91. In example: 8 codons AUG GGA UUU AAC CCU GGA GGGUAA Amino Acids are not nucleic acids – so they have nothing to do with the base pair rules The cell needs a way to match up amino acids with the 3 letter codons on the mRNA…. translation requires a second type of RNA called transfer RNA (tRNA) Translation
- 93. Transfer RNA (tRNA): Anticodon ANTICODON = group of 3 Nucleotides complementary to CODONS on mRNA In example anticodon is AAG - AAG (ANTICODON) would pair with CODON UUC on a mRNAmolecule Translation aa
- 94. Transfer RNA (tRNA): Amino Acids At other end Attachment site for 1 AMINO ACID molecule Recall… there are 20 aa How many codons are there? aa Translation
- 95. Many Kinds of tRNA Each kind is unique in that: 1. it has a unique ANTICODON 2. Each can attach 1 (and only 1 kind) of AMINO ACID (aa) Translation
- 96. Each codon site on mRNA: - has only 1 ANTICODON that can bind to it -the tRNA with the appropriate anticodon can only transport 1 kind of amino acid - Therefore only one kind of amino acid can be placed at a particular codon site aa aa aa Codons on mRNA Translation
- 97. Example • Suppose a mRNA: – UUU UUU UUU UUUUUU • What tRNA can be used? • How many amino acids are in the protein? • What amino acids are they? Translation
- 98. Codons for Amino Acids (on the mRNA) • MANY amino acids have several CODONS 64 possible anticodons: • 1 start (met), 3 stop • 61 anticodons code for amino acids Translation
- 99. AUG (on the mRNA) = START CODON - Met is inserted! Translation
- 100. codon on mRNA: AUC therefore anticodon on tRNA UAG…. Translation
- 101. Role of tRNA • Positions each amino acid in its proper order in the amino acid chain as determined by the sequence of codons in the mRNA molecule •Each tRNA has a unique anticodon and it carries only 1 kind of amino acid Translation
- 102. Ribosomes (= Protein + rRNA) • Attach to start end of mRNA • As tRNAs attach to mRNA the ribosome begins to move along mRNA molecule • As it does, it aligns first 2 aas which are then joined together by an enzyme • Repeats by aligning & joining aa# 3 to aa#1+2 so they can be joined and so on • When it reaches the end of mRNA molecule the aa chain is released into cytoplasm Translation
- 103. ribosome Translation
- 106. Genetic Code - Same in almost all organisms!
- 107. Mutation & Sexual Recombination Produce Genetic Variation • New genes and new alleles originate only by mutation • A mutation is a change in the nucleotide sequence of an organism’s DNA. • Most mutations occur in somatic cells and are lost when the individual dies. • Only mutations in gametes can be passed on to offspring, and only a small fraction of these spread through populations and become fixed. Mutations = changes in the nucleotide sequence of DNA Cause new genes and alleles to arise
- 108. Mutation rates – Tend to be low in animals and plants – Average about one mutation in every 100,000 genes per generation – Are more rapid in microorganisms
- 109. RNA: CGAUGCGAGUUACCCAGCUCGGAUAA - what is this step called? - what kind of RNA did you make? Step 1. Coding strand: DNA: GCTACGCTCAATGGGTCGAGCCTATT REVIEW:
- 110. mRNA: CG AUG CGA GUU ACC CAG CUC GGAUAA (Start) Arg- Val- Thr- Gln - Leu – Gly (stop) - steps involved? -Types of RNA? Codon on mRNA aa ontRNA Trp REVIEW:
- 111. ribosomes (rRNA) help in aa assembly to make the protein codons on mRNA decoded by tRNA base pair rule mRNA Translation Transcription REVIEW:
- 112. DNA molecule Gene 1 Gene 2 Gene 3 DNA template strand TRANSCRIPTION TRANSLATION mRNA Codon Protein Amino acid REVIEW: