Bio003 part1 cell and dna

1,184 views

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,184
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
12
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Bio003 part1 cell and dna

  1. 1. First Class- PowerPoint lectures will be available on FirstClass- Go to: http://www.place.dawsoncollege.qc.ca/ Conferences  Courses  Physics 982-003-50(Conted)  Brian’s Bio  lecture folder  Download ppt file
  2. 2. Lecture PowerPoint slides- PowerPoint lectures will be available on FirstClass• To print • Print ―Print what: Handouts Handouts: Slides per page: 3, 6, 9 (your choice)
  3. 3. BIOLOGY 003 Part 1:The Cell and DNA
  4. 4. What is Biology?The Scientific Study of LifeVery Broad topic
  5. 5. Living vs. Non- living
  6. 6. Properties of Life
  7. 7. So…
  8. 8. Order: living things are made up of cells Bacterial cells Human bone cells Plant cellsSingle celled protist Cells are the basic unit of life
  9. 9. OrderEach cell has internal order & the cells within thebody have specific arrangements & functions
  10. 10. Cell theory: fundamental principle in biology1. a cell is the smallest unit of life2. cells make up all living things3. new cells arise from pre-existing cells
  11. 11. The Cell: cellsasfundamental moleculesto biology as atomsthe atom is to tissueschemistry organhttp://aimediaserver4.com/studiodaily/videoplayer/?src=ai4/harvard/harvard.swf&width=640&height=520 system
  12. 12. Cell Size Prokaryotes Most neurons in µm range Eukaryotes
  13. 13. Limitations to Cell sizeCell size – variable small : 8 to 100 um 1 meter = 1000 mm = 1 000 000 um Larger organisms do not generally have larger cells than smaller organisms—simply more cells. Why so small?
  14. 14. Limitations to cell Size: homeostasis• Oxygen required• Waste products are released – must be removed from cell• Exchanges food, gases, nutrients takes place through cellsurface cell size metabolic needs • As a cell becomes larger, its volume increases at a greater rate than its surface area (plasma membrane)
  15. 15. Cell Size limited by : • Cell surface area (plasma membrane) • Surface area-to-volume ratio• Metabolic demands: determined by volume• But the transport of materials into or out of the cell isdetermined by surface area Volume increases faster than surface area
  16. 16. Surface area / Volume Ratio• Small objects have large surface area to volume ratio• Cells – small  lots of surface area Ex:
  17. 17. Things all Cells have in Common• surrounded by a membrane• internal mass (cytoplasm)• contain genetic information (DNA)• have ribosomes (protein synthesis)
  18. 18. Two Major Types of Cells• Prokaryotic cells – Domain: Bacteria and Archaea – No nucleus – Lack most organelles • Eukaryotic cells – Domain: Eukarya – Nucleus present in each cell – Organelles present
  19. 19. Eukaryotic cell vs. Prokaryotic cell DNA (no nucleus) Membrane Membrane Cytoplasm Virus OrganellesNucleus (contains DNA) 1 µm
  20. 20. Prokaryotic cells• DNA – free in cytoplasm• ribosomes• outer capsule (sugar or protein)• cell wall Cytosol (fluid)
  21. 21. Comparison Between Eukaryotic and Prokaryotic Cells Table 3.1
  22. 22. Eukaryotic Cell-Typically larger- Contain internal membranes that form organelles(more complex)- DNA in membrane bound nucleus ex: plant and animals
  23. 23. Plasma MembraneA cell is surrounded by Plasma Membrane- boundary between cell contentsand surroundings- everything that enters/leavescell passes through cellmembrane- divides cells into compartmentsWhy would me want to separate internal and external environments?
  24. 24. Structure of Plasma Membranes Two components: 1. Phospholipid molecules 2. Protein molecules
  25. 25. Phospholipid MoleculesAmphipathic molecules HEAD TAIL
  26. 26. Phospholipid Molecules • One end attracted to water (Head) • One end repelled by water (Tail)When placed in water: - they self assemble into a bi- layer (double layer) - shield hydrophobic portions
  27. 27. Cell organization & Size- to maintain homeostasis: cellcontents separated from externalenvironment plasma membrane Phospholipid bi-layer (Proteins not shown) Cell Membrane: - Selectively permeable: it allows some substances to cross it more easily than others
  28. 28. Cytoplasm & Cytosol• Cytoplasm: region between the nucleus and the plasma membrane• Cytosol: semifluid substance within the membrane – contains the organelles (makes up most of the cell mass)- Therefore; the cytoplasm is filled with cytosol
  29. 29. Nucleus • contains Genes • wrapped in double membrane = nuclear envelope
  30. 30. Nucleus:Contains DNA + Protein• Chromatin: loosely arrangedDNA and Protein• Chromosomes: tightly packed Contains Nucleolus: Not membrane bound  makes ribosomes
  31. 31. The Cell’s Heritable Information- All cells contain deoxyribonucleic acid(DNA)= heritable material that directs thecell’s activities. Inherited DNA Directs development of an organism
  32. 32. Information Transfer- Living things must have a set of instructions thatallow them to grow, develop, respond to stimuli,reproduce…- those ―instructions‖ are found in DNA- blueprint for all cellular activities- DNA made up of genes- Genes are the units of inheritancethat transmit information from parentsto offspring.
  33. 33. Four main classes of biological molecules 1.Carbohydrates 2. Lipids 3. Proteins 4. Nucleic acids
  34. 34. Organic Compounds• Contain carbon (C backbone)• Most contain H and O• May contain other elements N = Nitrogen P = Phosphorus S = Sulfur
  35. 35. Why is Carbon Special?Carbon can form 4 covalent bonds – bonds with up to 4 separate atoms – can bond with other C atoms long chains of carbon atoms  can combine with many other kinds of atoms
  36. 36. Carbon Skeleton:• Straight chains – short or long• Branched chains – Single or multiple• Rings
  37. 37. Distinctive properties of an organic molecule depends on:1) Arrangement of carbon skeleton2) Functional groups = molecular components attached to that carbon skeleton)• Give molecule distinctive chemical properties
  38. 38. Functional groups:
  39. 39. Biological molecules are composed of subunits thatare linked to each other • Single unit = monomer (pearl) • Chain or ring of of monomers = polymer (pearl necklace)
  40. 40. Synthesis and Breakdown of Polymers• Synthesis –Addition of subunits  chain grows• Breakdown –Removal of subunits  chain shortens
  41. 41. Building Chains (polymers)Dehydration synthesis:
  42. 42. Condensation or Dehydration synthesis is thechemical reaction that links repeating subunitstogether.When dehydration synthesis occurs, a bond formsand WATER is released. Result: • Increase in ―chain‖ • molecule of water released
  43. 43. Breakdown of polymersHydrolysis:Splitting a polymer by the addition of water
  44. 44. Nucleic acids(DNA and RNA)
  45. 45. Nucleic acidsPurpose:- Store and transmit hereditary information in Genes = units of inheritance- Program amino acid sequence of ProteinsMade of nucleotides
  46. 46. Types 1. Deoxyribonucleic acid (DNA): Stores information for protein synthesis 2. Ribonucleic acid (RNA): Directs protein synthesis
  47. 47. Structure – Consists of building blocks called nucleotides Nitrogenousi) phosphate molecule (P) base O 5’Cii) 5-carbon sugar (S) O P O CH2 O Oiii) nitrogenous base (B) Phosphate 3’C group Pentose sugar Nucleotide
  48. 48. Fig. 5-27ab Structure Nucleoside Nitrogenous Nitrogenous base base O 5C 5’C O P O CH2 O O Phosphate Phosphate 3’C 3C group group Pentose Sugar 5C sugar (pentose) (b) Nucleotide 3C 3 end Nucleotides form chains (a) Polynucleotide, or nucleic acid called polynucleotides
  49. 49. Structure Nucleotide = building block Nucleic acid = chain
  50. 50. DNA vs. RNA DNA RNA Phosphate   Sugar Deoxyribose Ribose Bases Adenine (A)  Guanine (G)  Cytosine (C)  Thymine (T) Uracil (U)____________ ____________ ___________ _ Double stranded Single-stranded
  51. 51. DNA and RNA –4 POSSIBLE NUCLEOTIDES FOR EACH DNA RNA
  52. 52. DNA• Needed for cell replication• Contains genes• Genes tell cells which proteins to make• Complementary base pairing Hydrogen bond The sequence of bases along a nucleotide polymer is unique for each gene J Watson & F Crick Cambridge University; 1953
  53. 53. DNA Assembly P P Bases: S – B -- B - S Adenine (A) P P Guanine (G) S - B -- B - S Cytosine (C) Thymine (T) P P S - B -- B - S P P  2 strands held together by S - B -- B - S hydrogen bonds between the paired bases
  54. 54. Complementary Base Pairing In DNA: A and T C and G – always line up together! Referred to as complementary base pairing
  55. 55. DNA Assembly P P S– A -- T -- S P P S -- G -- C --S P P S -- C -- G -- S P P S -- T -- A -- S
  56. 56. Summary: DNA• DNA containsthe genetic code• DNA contains―blueprint‖ formaking differentproteins DNA over 2m long!
  57. 57. The way DNA encodes a cell’sinformation is analogous to the way we arrange the letters of the alphabet RAT = ART= Sequence in letters = changes in meaning Sequence of nucleotides = different proteins
  58. 58. Genetic Information• Each gene carries information needed to make a specific PROTEIN• Genes carry information that determines the primary sequence of the protein Protein synthesis
  59. 59. Proteinsaka polypeptides
  60. 60. ProteinsProteins account for 50% of the organic matter in a typical animalbody, and they play a critical role in almost all life processes
  61. 61. Proteins• Proteins are made of amino acids.• There are 20 common a.a.• Polypeptide: chain of a.a.• Protein: 1 or more polypeptides folded/coiled into a specific shape
  62. 62. Amino Acids -building blocks of proteins• All amino acids have same basic skeleton: Carboxyl group R group - variable
  63. 63. Essential Amino Acids• Animal cells can make some, but not all amino acids• Essential a.a.: those that we can’t make or make enough of to meet our needs. – Required from dietAsparagine  Ammonia (pee) and OxaloacetateAsparagusic Acid  Methylmercaptan
  64. 64. Harmful Amino Acids;Aspartame?
  65. 65. Protein = chain of amino acids Synthesis reaction As the chain grows you create a polypeptide
  66. 66. Structure• very complex – large variety of amino acids – very large – different protein molecules have their own distinct shape
  67. 67. 4 levels of structure • Primary • Secondary • Tertiary • Quaternary • Polypeptide can spontaneously organize into complex shapes (change) • Protein shape essential to function – Ex receptor, antibody, enzyme
  68. 68. i) PRIMARY STRUCTURE:- Number and SequenceEach sphere = 1 amino acidEx. insulin
  69. 69. ii) SECONDARY STRUCTURE: 2 types a) alpha helix (coiled) Hydrogen bonds hold helix cells in shape
  70. 70. ii) SECONDARY STRUCTUREb) Beta Pleated sheet (folded) Hydrogen bonds hold neighboring strands of sheet together
  71. 71. iii) TERTIARY STRUCTURE: Protein already coiled or folded Examples: Hydrogen bonds Ionic Bonds Disulfide bridges Hydrophobic interactions
  72. 72. iv) QUATERNARY STRUCTUREThe fusion of two or more proteinsExamples:
  73. 73. A very important protein: Ribosome• Uses RNA to make other proteins• Made in the nucleolus
  74. 74. Conformation: determines function - single amino aid substitution
  75. 75. Denaturation- when a protein unravels and loses its native conformation Denaturation Normal protein Denatured protein Renaturation
  76. 76. Recall… ProteinStructure • For cell to reliably make proteins, it must be able to control the placement of animo acids • Each protein has its own unique primary sequence! Proteins are complex –made up of building blocks called amino acids –20 different kinds –number and sequence of the aa’s = primary sequence  controls shape  function
  77. 77. How does the Information on the DNA Molecule get Converted into a Protein?• DNA not used directly• Involves various forms of RNA (the other nucleic acid)• Accomplished by a process called: PROTEIN SYNTHESIS
  78. 78. DNAP Sro 1 Synthesis of Transcription yte mRNA in the nucleus mRNA ntin h NUCLEUS e CYTOPLASM si mRNA 2 Movement of s mRNA into cytoplasm Ribosome via nuclear pore 3 Synthesis of protein Translation Amino Polypeptide acids
  79. 79. 2 major steps in protein synthesis 1) Transcription (information storage) DNA RNA2) Translation (information carrier) RNA Protein (product)
  80. 80. Step 1: TranscriptionTranscription = transfer of genetic information from DNA to messenger RNA (mRNA)
  81. 81. Transcriptiona) Separation of DNA Gene = DNA Sequence that codes for a protein:
  82. 82. Transcription of a Hypothetical Gene:a) Separation of DNA ATG GGA TTT AAC CCT GGA GGG TAA * TAC CCT AAA TTG GGA CCT CCC ATT** - Two strands separate in region of gene ATG GGA TTT AAC CCT GGA GGG TAA XXXX XXXXXX XXXX XXXXXX **TAC CCT AAA TTG GGA CCT CCC ATT ** **coding strand
  83. 83. Transcription: b)Synthesis of mRNA Synthesis of an RNA molecule that is complementary to the DNA (following the base pair rule) DNA  mRNA = This molecule is called messenger RNA
  84. 84. Transcription: b)Synthesis of mRNA(DNA) XXXX ATG GGA TTT AAC CCT GGA GGG TAA XXXXXX(mRNA) AUG GGA UUU AAC CCU GGA GGG UAA(DNA)XXXX TAC CCT AAA TTG GGA CCT CCC ATT ** XXXX DNA: A T C G RNA: U A G C
  85. 85. Summary of Transcription and Release of completed mRNA moleculeenzyme Once the mRNA molecule is complete the transcription process is over
  86. 86. • Transfer of information from DNA to mRNA completes first phase of protein synthesis (Transcription)Next question: How is the information in mRNA used to make a protein?
  87. 87. What information do we have?mRNA: AUG GGA UUU AAC CCU GGA GGG UAA Need to: convert nucleic acid language (in the mRNA) into amino acid language (protein)
  88. 88. Step 2:Translation Amino Polypeptide acidsTranslation = tRNA with amino acidAssembly of the Ribosome attachedprotein primarystructureaccording to tRNAinstructions Anticodon(codon sequence)on the mRNA 5 Codons 3 mRNA
  89. 89. Translation mRNA  Protein • information on mRNA is contained in groups of 3 nucleotides called CODONS mRNA: AUG GGA UUU AAC CCU GGA GGG UAA• Codons on mRNA provide the sequence ororder in which the amino acids must bearranged to create the primary structure ofthe protein• mRNA has the information but doesn’t do thework
  90. 90. Translation In example: 8 codons AUG GGA UUU AAC CCU GGA GGG UAAAmino Acids are not nucleic acids – so they have nothing to dowith the base pair rulesThe cell needs a way to match up amino acids with the 3 lettercodons on the mRNA…. translation requires a second type of RNA called transfer RNA (tRNA)
  91. 91. Translationtransfer RNA (tRNA)“decoder” aa Amino Acid Anticodons
  92. 92. Translation Transfer RNA (tRNA): Anticodon aaANTICODON= group of 3 Nucleotidescomplementary to CODONS on mRNAIn example anticodon is AAG- AAG (ANTICODON) would pair withCODON UUC on a mRNA molecule
  93. 93. TranslationTransfer RNA (tRNA):Amino Acids At other end aa Attachment site for 1 AMINO ACID molecule Recall… there are 20 aa How many codons are there?
  94. 94. TranslationMany Kinds of tRNAEach kind is unique in that:1. it has a unique ANTICODON2. Each can attach 1 (and only 1 kind) of AMINO ACID (aa)
  95. 95. TranslationEach codon site on mRNA: - has only 1 ANTICODON that can bind to it - the tRNA with the appropriate anticodon can only transport 1 kind of amino acid - Therefore only one aa aa aa kind of amino acid can be placed at a particular codon site Codons on mRNA
  96. 96. Translation Example• Suppose a mRNA: – UUU UUU UUU UUU UUU• What tRNA can be used?• How many amino acids are in the protein?• What amino acids are they?
  97. 97. TranslationCodons for Amino Acids(on the mRNA)• MANY amino acids have several CODONS64 possible anticodons:• 1 start (met), 3 stop• 61 anticodons code for amino acids
  98. 98. TranslationAUG (on the mRNA) =START CODON- Met is inserted!
  99. 99. Translationcodon on mRNA: AUCtherefore anticodon ontRNA UAG….
  100. 100. TranslationRole of tRNA• Positions each amino acid in its proper order in the amino acid chain as determined by the sequence of codons in the mRNA molecule• Each tRNA has a unique anticodon and itcarries only 1 kind of amino acid
  101. 101. Translation Ribosomes (= Protein + rRNA)• Attach to start end of mRNA• As tRNAs attach to mRNA the ribosome begins to move along mRNA molecule• As it does, it aligns first 2 aas which are then joined together by an enzyme• Repeats by aligning & joining aa# 3 to aa#1+2 so they can be joined and so on• When it reaches the end of mRNA molecule the aa chain is released into cytoplasm
  102. 102. Translation ribosome
  103. 103. Transcription Translation
  104. 104. Videos:- http://www.youtube.com/watch?v=D3fOXt4MrOM&feature=related- http://jacusers.johnabbott.qc.ca/~biology/index.asp
  105. 105. Genetic Code- Same in almost all organisms!
  106. 106. Mutation & Sexual Recombination Produce Genetic Variation• New genes and new alleles originate only by mutation• A mutation is a change in the nucleotide sequence of an organism’s DNA.• Most mutations occur in somatic cells and are lost when the individual dies.• Only mutations in gametes can be passed on to offspring, and only a small fraction of these spread through populations and become fixed. Mutations = changes in the nucleotide sequence of DNA  Cause new genes and alleles to arise
  107. 107. Mutation rates– Tend to be low in animals and plants– Average about one mutation in every 100,000 genes per generation– Are more rapid in microorganisms
  108. 108. REVIEW: Step 1. Coding strand: DNA: GCTACGCTCAATGGGTCGAGCCTATT RNA: CGAUGCGAGUUACCCAGCUCGGAUAA - what is this step called? - what kind of RNA did you make?
  109. 109. REVIEW:mRNA: CG AUG CGA GUU ACC CAG CUC GGA UAA (Start) Arg- Val- Thr- Gln - Leu – Gly (stop) - steps involved? -Types of RNA? Codon on mRNA Trp aa on tRNA
  110. 110. REVIEW: Transcription base pair rule  mRNA codons on mRNA decoded by Translation tRNA ribosomes (rRNA) help in aa assembly to make the protein
  111. 111. REVIEW: Gene 2 DNA molecule Gene 1 Gene 3 DNA template strand TRANSCRIPTION mRNA Codon TRANSLATION Protein Amino acid

×