Genetika
Upcoming SlideShare
Loading in...5
×
 

Genetika

on

  • 737 views

 

Statistics

Views

Total Views
737
Views on SlideShare
737
Embed Views
0

Actions

Likes
0
Downloads
39
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Genetika Genetika Presentation Transcript

    • Apa Genetika ?Apa Genetika ? Genetika : Ilmu Keturunan (berasal dariGenetika : Ilmu Keturunan (berasal darikata latin “Genos”kata latin “Genos”  Suku Bangsa atauSuku Bangsa atauAsal Usul)Asal Usul) Dalam Genetika dipelajari bagaimanaDalam Genetika dipelajari bagaimanasifat keturunan (heriditas) diwariskansifat keturunan (heriditas) diwariskankepada anakkepada anak
    • Bidang Pemakaian GenetikaBidang Pemakaian Genetika KedokteranKedokteran : Kelainan penyakit keturunan,: Kelainan penyakit keturunan,golongan darahgolongan darah KH & PeternakanKH & Peternakan : Bibit unggul hewan: Bibit unggul hewan PertanianPertanian : Bibit unggul tumbuhan: Bibit unggul tumbuhan Psikologi & antropologiPsikologi & antropologi : Sifat yang: Sifat yangberkenaan dng kejiwaan, asal usul suatuberkenaan dng kejiwaan, asal usul suatusuku bangsasuku bangsa
    • Sejarah PerkembanganSejarah Perkembangan Sudah ada sebelum abad XIX (Pre Mendel)Sudah ada sebelum abad XIX (Pre Mendel)  Bangsa Babilonia 6000Bangsa Babilonia 6000tahun lalu telah telah menyusun silsilah kuda untuk memperbaikitahun lalu telah telah menyusun silsilah kuda untuk memperbaikiketurunannyaketurunannya Gregor Mendel (1822-1884) genetika berkembang menjadi suatu cabangGregor Mendel (1822-1884) genetika berkembang menjadi suatu cabangilmu dalam biologiilmu dalam biologi  “Hukum Mendel”“Hukum Mendel”  Dikenal “Dikenal “Bapak GenetikaBapak Genetika”” Mendel berhasil mengamati suatu macam sifat keturunan (Karakter) dariMendel berhasil mengamati suatu macam sifat keturunan (Karakter) darigenerasi ke generasi kacang ercis, dan berhasil membuat perhitungangenerasi ke generasi kacang ercis, dan berhasil membuat perhitunganmatematika tentang sifat genetis karakter tersebut.matematika tentang sifat genetis karakter tersebut. Namun Karya Mendel yang dipublikasikan pada tahun 1868 di negaranyaNamun Karya Mendel yang dipublikasikan pada tahun 1868 di negaranya(Austria) tidak mendapat tanggapan di negaranya.(Austria) tidak mendapat tanggapan di negaranya. Tahun 1900 karya mendel dibaca kembali dan menjadi bahan referensi paraTahun 1900 karya mendel dibaca kembali dan menjadi bahan referensi paraahli.ahli. W.Bateson (1861-1926) membuat percobaan pada ayam untukW.Bateson (1861-1926) membuat percobaan pada ayam untukmembuktikan apakah penemuan Mendel berlaku pada hewan ?membuktikan apakah penemuan Mendel berlaku pada hewan ? J.Belling (1930) berjasa mengembangkan sitogenetikaJ.Belling (1930) berjasa mengembangkan sitogenetika  mengamti tingkahmengamti tingkahlaku kromosom dengan mikroskop.laku kromosom dengan mikroskop.
    • Sejarah PerkembanganSejarah Perkembangan T.H. Morgan (1914) menemukan bahwa “Gen” yang menjadi unit terkecilT.H. Morgan (1914) menemukan bahwa “Gen” yang menjadi unit terkecilbahan genetika.bahan genetika. Pengetahuan genetika lebih maju lagi dengan dengan diketahuinyaPengetahuan genetika lebih maju lagi dengan dengan diketahuinyasusunan molekul GEN yang terdiri dari DNA (Deoksiribosa Nucleid Acid)susunan molekul GEN yang terdiri dari DNA (Deoksiribosa Nucleid Acid)dengan model DNA diperkenalkan olehdengan model DNA diperkenalkan oleh J.D. Watson dan F.H.C. CrickJ.D. Watson dan F.H.C. Crick(1953)(1953) dan disempurnakan oleh M.H.F. Wilkins pada tahun 1961.dan disempurnakan oleh M.H.F. Wilkins pada tahun 1961. M.W. Nirenberg (1961) menyusunM.W. Nirenberg (1961) menyusun kode genetiskode genetis yang menentukan urutanyang menentukan urutanasam amino dalam sintesis proteinasam amino dalam sintesis protein  Maka diketahui bahwa gen itu bekerjaMaka diketahui bahwa gen itu bekerjamembentuk suatu karakter melalui sintesa protein dalam sel-sel tubuh.membentuk suatu karakter melalui sintesa protein dalam sel-sel tubuh. Perkembangan genetika paling mutakhir adalahPerkembangan genetika paling mutakhir adalah Transpormasi GenTranspormasi Gen Gen dapat dipindah-pindahkan dari satu individu ke individu lain denganGen dapat dipindah-pindahkan dari satu individu ke individu lain denganmemperalat vurus atau bakteri.memperalat vurus atau bakteri. Dasar transpormasi ditemukan oleh F.Griffith (1928) pada bakteriDasar transpormasi ditemukan oleh F.Griffith (1928) pada bakteriPneumococcusPneumococcus, kemudian dikembangkan oleh banyak ahli lainnya., kemudian dikembangkan oleh banyak ahli lainnya.
    • Bagaimana Cara Mempelajari Genetika ???Bagaimana Cara Mempelajari Genetika ??? HibridHibrid  Persilangan/kawinPersilangan/kawin Silsilah keluargaSilsilah keluarga Anak kembar (Kembar Fraternal atau Identik)Anak kembar (Kembar Fraternal atau Identik) Kawin sekerabatKawin sekerabat Percobaan/eksperimenPercobaan/eksperimen SitologiSitologi Anatomi-MorfologiAnatomi-Morfologi Fisiologi-biokimiaFisiologi-biokimia BiometrikaBiometrika  Perhitungan matematis.Perhitungan matematis.
    • Apa itu GEN ??Apa itu GEN ?? Urutan nukleotida atau basa-basa nitrogen padaUrutan nukleotida atau basa-basa nitrogen padaDNA yang mengkode karakter makhluk hidup.DNA yang mengkode karakter makhluk hidup. Materi dasar GEN adalah DNAMateri dasar GEN adalah DNA Tugas gen adalah mengatur berbagai jenisTugas gen adalah mengatur berbagai jeniskarakter (sifat) makhluk hidupkarakter (sifat) makhluk hidup  Karakter fisikKarakter fisik(morfologi & anatomi), karakter psikis (pemalu,(morfologi & anatomi), karakter psikis (pemalu,pamarah, panakut)pamarah, panakut) Cara kerja gen dalam mengatur berbagaiCara kerja gen dalam mengatur berbagaikarakter adalah melalui sintesis protein (Enzimkarakter adalah melalui sintesis protein (Enzim& Hormon)& Hormon)
    • DNA (Deoksiribosa Nucleid Acid)DNA (Deoksiribosa Nucleid Acid)
    • Cara kerja GEN dalam mengaturCara kerja GEN dalam mengatur KarakterKarakterMelalui Sintesis ProteinMelalui Sintesis Protein Membuat perangkat sintesa proteinMembuat perangkat sintesa proteinyaitu :yaitu : (1) m-RNA, (2) t-RNA, (3) r-RNA(1) m-RNA, (2) t-RNA, (3) r-RNAmelalui proses transkripsi.melalui proses transkripsi. Menterjemahkan kode-kode genetik yangMenterjemahkan kode-kode genetik yangdibawa oleh m-RNA melalui tiga tahap,dibawa oleh m-RNA melalui tiga tahap,yaitu :yaitu :1. Tahap inisiasi1. Tahap inisiasi2. Tahap perpanjangan rantai polipeptida2. Tahap perpanjangan rantai polipeptida3. Tahap terminasi3. Tahap terminasi
    • Transkripsi RNATranskripsi RNA
    • SINTESIS PROTEIN
    • Ada Berapa Asam Amino ???1. Lanin2. Valin3. Triptofan4. Metionin5. Isoleusin6. Prolin7. Leusin8. Fenil Alanin9. Serin10. Glisin11. Treonin12. Sistein13. Asparagin14. Glutamin15. Tirosin16. Asam Aspartat17. Asam Glutamat18. Arginin19. Lisin20. Histidin
    • m-RNAU C U C C A G C U C A AAGAGGTCGAGTTTCTCCAGCTCAA5”3”3”5”Ser Pro Ala Gln COOHNHHGlukosa Glukosa-6-PosfatEnzimCARA KERJA “GEN”(SALAH SATU TAHAP GLIKOLISIS)
    • Fe++NH2COOHNH2COOHNH2COOHABCHAEMOGLOBINDibentuk Oleh :Protein-A = 100 asam aminoProtein-B = 80 asam aminoProtein-C = 120 asam aminoPERTANYAAN ???1. Berapa GEN yang terlibat untukmembuat haemoglobin ?2. Berapa nukleotida yang terlibatdalam sintesis haemoglobin ?3. Berapa kodon yang terlibat yangterlibat dalam sintesishaemoglobin ?PERAN “GEN” DALAM SINTESIS “HAEMOGLOBIN”
    • PERAN GEN DALAM METABOLISMEPERAN GEN DALAM METABOLISMEGlukosa-6-posfatGlukosaFruktosa-6-posfatFruktosa-1,6-posfatFruktosa-1,6-posfatGliseraldehida-3-Posfat(G-3-P)Dihidroksi Aseton Posfat(DHAP)Enzim-1 = 20 asam aminoEnzim-2 = 30 asam aminoEnzim-3 = 40 asam aminoEnzim-4 = 50 asam aminoEnzim-5 = 20 asam aminoEnzim-6 = 10 asam aminoGLIKOLISIS :
    • PERAN GEN DALAM PEMBUATAN MATA1. Bola Mata = 200 enzim  1800 As.Amino2. Retina = 100 enzim  520 As.Amino3. Lensa Mata = 50 enzim  420 As.Amino4. Kelopak Mata = 150 enzim  720 As.Amino5. Rambut Mata = 50 enzim  230 As.Amino6. Kornea Mata = 50 enzim  250 As.AminoPertanyaan :1. Berapa GEN yang terlibat dalam pembuatan mata ?2. Berapa NUKLEOTIDA yang terlibat dalam pembuatan mata ?3. Berapa KODON yang terlibat dalam pembuatan mata ?4. Berapa TAHAP yang harus ditempuh dalam pembuatan mata ?
    • Mengapa kerja GEN melaluiMengapa kerja GEN melaluisintesis protein ????sintesis protein ???? Sebagian besar (±95%) tubuh makhluk hidup terdiri dariSebagian besar (±95%) tubuh makhluk hidup terdiri dariprotein (kulit, keratin, otot, hemoglobin, globulin, albumin,protein (kulit, keratin, otot, hemoglobin, globulin, albumin,protombin dll)protombin dll) Enzim & HormonEnzim & Hormon  Katalisis & RegulasiKatalisis & RegulasiContoh : Untuk menumbuhkan warna kulit dibutuhkan pigmen kulitmelanin. Melanin dibuat dari asam amino fenilalanin. Untuk mencapai menjadiMelanin, tentu menempuh serangkaian reaksi kimia yang semuanya hanyabisa berlansung bila ada ENZIM. Setiap tahapan reaksi hanya bisaberlangsung dengan kehadiran enzim sendiri pula. Puluhan enzim yangdibutuhkan unuk mengubah asam amino untuk menjadi melanin (pigmen kulit) Semua enzim yang dibutuhkan tersebut dikode dari GEN pada DNA.
    • GEN & KarakterGEN & Karakter Misalkan ManusiaMisalkan Manusia  Jumlah karakter sangatJumlah karakter sangatbanyak, misalnya karakter Darahbanyak, misalnya karakter Darah  dikenaldikenalGolongan darah A, B, AB, dan O, Eritrosit bulanGolongan darah A, B, AB, dan O, Eritrosit bulansabit, darah sukar membeku, dan sebagainya.sabit, darah sukar membeku, dan sebagainya. 1 gen 1 karakter1 gen 1 karakter : Contoh lain 1 gen 1 karakter: Contoh lain 1 gen 1 karakter Polydactily (jari-6), kidal, buta warna, hemofili,Polydactily (jari-6), kidal, buta warna, hemofili,keriting.keriting. karakterkarakter  Karakter “Bule” pada manusiaKarakter “Bule” pada manusiaditentukan oleh 1 gen. Ini berarti pigmentasi kulitditentukan oleh 1 gen. Ini berarti pigmentasi kulitditentukan oleh satu gen. Mungkin saja ada genditentukan oleh satu gen. Mungkin saja ada genlain yang ikut berperan, tapi belum diketahui.lain yang ikut berperan, tapi belum diketahui.
    • GEN & KarakterGEN & Karakter1 GEN banyak karakter :1 GEN banyak karakter : Ada gen disamping menentukan satuAda gen disamping menentukan satukarakter utama, juga mempengaruhikarakter utama, juga mempengaruhikarakter lain. Contoh : Gen yangkarakter lain. Contoh : Gen yangmengkode “Fenilketonuria” yaitu gen yangmengkode “Fenilketonuria” yaitu gen yangmenghambat sintesis fenilalanin. Efekmenghambat sintesis fenilalanin. Efeksamping dari gen ini menyebebkan warnasamping dari gen ini menyebebkan warnarambut terang (kurang pigmentasi)rambut terang (kurang pigmentasi)
    • GEN & KarakterGEN & KarakterBanyak Gen 1 Karakter :Banyak Gen 1 Karakter : Ini terjadi kalau satu karakter ditentukan olehIni terjadi kalau satu karakter ditentukan olehbanyak faktor. Contoh :banyak faktor. Contoh : Tinggi badanTinggi badan Apakah tulang kaki, ruas tulang belakang, ruasApakah tulang kaki, ruas tulang belakang, ruastulang leher, atau juga bentuk tengkoraktulang leher, atau juga bentuk tengkorakditentukan oleh sejumlah gen.ditentukan oleh sejumlah gen. Contoh Lain “Buta Keturunan” yang disebabkanContoh Lain “Buta Keturunan” yang disebabkanoleh Kerusakan retina, kerusakan lensa,oleh Kerusakan retina, kerusakan lensa,kerusakan saraf mata. Masing-masing bagiankerusakan saraf mata. Masing-masing bagianmata tersebut ditentukan oleh gen-genmata tersebut ditentukan oleh gen-gentersendiri.tersendiri.
    • Fenotipe dan GenotipeFenotipe dan Genotipe FenotipeFenotipe yaitu : Bentuk luar atau karakteryaitu : Bentuk luar atau karakteryang tampak pada suatu individuyang tampak pada suatu individu Rambut pirang, rambut lurus, mata biruRambut pirang, rambut lurus, mata birudll.dll. GenonotipeGenonotipe yaitu : Susunan kode genyaitu : Susunan kode genpada DNA yang mengkode karakterpada DNA yang mengkode karaktertertentu pada individu.tertentu pada individu. Kode gen ditulis dengan simbul huruf-Kode gen ditulis dengan simbul huruf-huruf, misalnya AA, Bb, Cc dll.huruf, misalnya AA, Bb, Cc dll.
    • AlelaAlela Berasal darikataBerasal darikata “allelon”“allelon” = bentuk lain= bentuk lain Umpama genUmpama gen “A”“A” mengkode pertumbuhanmengkode pertumbuhanpigmentasi kulit secara normal. Lalu genpigmentasi kulit secara normal. Lalu gen “A”“A”mengalami mutasi sehingga tidak mampumengalami mutasi sehingga tidak mampumembentuk pigmentasi kulit secara normal lagimembentuk pigmentasi kulit secara normal lagisehingga menyebabkan kulitsehingga menyebabkan kulit “albino”“albino” gengen “A”“A”yang bermutasi tersebut diberi simbol “a”yang bermutasi tersebut diberi simbol “a” Kenapa ditulisKenapa ditulis “a”“a”, karena karakter yang, karena karakter yangditumbuhkan bersifat resesif, artinya kalauditumbuhkan bersifat resesif, artinya kalauberada bersama genberada bersama gen “A”“A” maka sifat genmaka sifat gen “a”“a” akanakanditutupi oleh genditutupi oleh gen “A”“A”
    • Homozigot - HeterozigotHomozigot - Heterozigot GenGen “AA”“AA”  Homozigot dominanHomozigot dominan GenGen “Aa”“Aa”  HeterozigotHeterozigot GenGen “aa”“aa”  Homozigot resesifHomozigot resesifKenapa GEN ditulisberpasangan ????A| |A B| |b m| |m
    • Simbul GEN dalam perkawinanSimbul GEN dalam perkawinan AAAA xx AaAa (Mono Hibrid)(Mono Hibrid) aaBbaaBb xx AabbAabb (Dihibrid)(Dihibrid) AaBbCcAaBbCc xx aaBBCCaaBBCC (Trihibrid)(Trihibrid) AABbCcDDeeFfAABbCcDDeeFf xx aaBBCcddEeFFaaBBCcddEeFF(Polihibrid)(Polihibrid)Apa maksud “Kawin” (X) dalam Genetika ???
    • Melalui apa GEN diwariskan kepada keturunanMelalui apa GEN diwariskan kepada keturunan Reproduksi Secara SeksualReproduksi Secara Seksual  ???????????? Sel Kelamin JantanSel Kelamin Jantan ???? (Manusia,???? (Manusia,hewan, tumbuhan)hewan, tumbuhan)  Dimana dibentukDimana dibentuk Sel Kelamin BetinaSel Kelamin Betina  ??? (Manusia,??? (Manusia,hewan, tumbuhan)hewan, tumbuhan)  Dimana dibentukDimana dibentuk Bagaimana Proses pembentukan selBagaimana Proses pembentukan selkelamin jantan dan betina ????kelamin jantan dan betina ????
    • Apa Artinya ????Apa Artinya ????P. O AABBMmKKP. O AABBMmKK xx O aaBBmmKkO aaBBmmKk Berapa Macam Sel Gamet O yang dibentuk ??Berapa Macam Sel Gamet O yang dibentuk ??Tuliskan macam sel gamet tersebut !Tuliskan macam sel gamet tersebut ! Berapa Macam Sel Gamet O yang dibentuk ??Berapa Macam Sel Gamet O yang dibentuk ??Tuliskan macam sel gamet tersebut !Tuliskan macam sel gamet tersebut ! Bagaimana kemungkinan susunan “gen”Bagaimana kemungkinan susunan “gen”keturunan nya ???keturunan nya ???
    • SEKIANDANTERIMAKASIH