Low beneficial effects of short term antidiabetic diet treatment in streptozo...iosrphr_editor
Oxidative stress is currently suggested to play a role in the pathogenesis of Diabetes mellitus. The role of dietary management in diabetes mellitus is to provide a proper balance of total nutrients while meeting the special dietary needs of the patient. The present study was designated to evaluate the effect of special antidiabetic diet treatment upon oxidative stress parameters in the initial stages of the development of diabetes. Male Wistar strain rats were used as an experimental model, divided into five groups. A significant decrease in superoxide dismutase and total glutathione activities were observed in the liver of diabetic rats when compared with control animals. The plasma level of aminotransferases, creatine kinase, lactate dehydrogenase and urea were significantly increased after induction of diabetes, in all groups under treatment. In contrast, rats fed special diet food, have shown slight different, but not significant changes. The findings of the present study suggest that special diet formula useful for prevention of progressive hyperglycaemia in age induced diabetes in dogs, could not restore the imbalance of cellular defence mechanism provoked by streptozotocin.
Whey protein products and their combination with L-methionine prevent liver f...iosrphr_editor
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
Regulation of synthesis and oxidation of fatty acids by adiponectin receptors (AdipoR1/R2) and insulin receptor substrate isoforms (IRS-1/-2) of the liver in a nonalcoholic steatohepatitis animal model
Low beneficial effects of short term antidiabetic diet treatment in streptozo...iosrphr_editor
Oxidative stress is currently suggested to play a role in the pathogenesis of Diabetes mellitus. The role of dietary management in diabetes mellitus is to provide a proper balance of total nutrients while meeting the special dietary needs of the patient. The present study was designated to evaluate the effect of special antidiabetic diet treatment upon oxidative stress parameters in the initial stages of the development of diabetes. Male Wistar strain rats were used as an experimental model, divided into five groups. A significant decrease in superoxide dismutase and total glutathione activities were observed in the liver of diabetic rats when compared with control animals. The plasma level of aminotransferases, creatine kinase, lactate dehydrogenase and urea were significantly increased after induction of diabetes, in all groups under treatment. In contrast, rats fed special diet food, have shown slight different, but not significant changes. The findings of the present study suggest that special diet formula useful for prevention of progressive hyperglycaemia in age induced diabetes in dogs, could not restore the imbalance of cellular defence mechanism provoked by streptozotocin.
Whey protein products and their combination with L-methionine prevent liver f...iosrphr_editor
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
Regulation of synthesis and oxidation of fatty acids by adiponectin receptors (AdipoR1/R2) and insulin receptor substrate isoforms (IRS-1/-2) of the liver in a nonalcoholic steatohepatitis animal model
Background: The present study sought to investigate erythrocyte glutathione S-transferases (GST),
NADH-Methaemoglobin reductase (NADH-MR) and Na+/K+-ATPase activities of hypoglycemic rats treated with
ethanol/water (1:2 v/v) extract of A. sativa as agent of glycemic control.
Methods: Hyperglycemia was induced by a single intra-peritoneal injection of 0.1 mol/L alloxan monohydrate in
phosphate buffer saline (PBS) solution (pH = 7.4); dosage = 140 mg/kg. At the end of the experimental time
(t = 76 h), erythrocyte GST, NADH-MR and Na+/K+-ATPase activities as well as serum fasting blood sugar (FBS)
levels were measured by spectrophotometric methods.
Results: Serum FBS levels of control/normal (C/N) rats ranged between 72.93 ± 0.82–95.12 ± 0.92 mg/dL, whereas
experimental rats without glycemic control gave: 249.41 ± 1.03–256.11 ± 1.23 mg/dL. Hyperglycemic rats treated
with ethanol/water (1:2 v/v) extract of A. sativa exhibited comparative reduced serum levels of FBS alongside with
erythrocyte GST, NADH-MR and Na+/K+-ATPase activities. The average relative activities of the three enzymes and
corresponding order of enzyme activity in hyperglycemic rats treated with ethanol/water (1:2 v/v) extract of A. sativa
was: NADH-MR = 60.99% > GST = 47.81% > Na+/K+-ATPase = 46.81%. In the same order, relative activities of the three
enzymes in rats without glycemic control were: NADH-MR = 49.65% > GST = 23.69% > Na+/K+-ATPase = 17.02%.
Conclusion: Erythrocyte GST, NADH-MR and Na+/K+-ATPase activities gave insights into the pathophysiology of
diabetic state and served as biomarkers for ascertaining therapeutic control in Type 1 diabetes mellitus.
Brazilian Red Propolis Attenuates Hypertension and Renal DamageBee Healthy Farms
Incorporating Brazilian Red Propolis in the diet of rats with reduced kidney function experienced a reduction of hypertension and renal damage. This scenario simulated Chronic Kidney Disease.and found the anti-inflammatory and antioxidant effects of Brazilian Red Propolis effective but requires additional studies to determine which mechanisms were prominent.
Comparative Study of The Antioxidant Activities of Monodora Myristica And A. ...iosrjce
IOSR Journal of Biotechnology and Biochemistry (IOSR-JBB) covers studies of the chemical processes in living organisms, structure and function of cellular components such as proteins, carbohydrates, lipids, nucleic acids and other biomolecules, chemical properties of important biological molecules, like proteins, in particular the chemistry of enzyme-catalyzed reactions, genetic code (DNA, RNA), protein synthesis, cell membrane transport, and signal transduction. IOSR-JBB is privileged to focus on a wide range of biotechnology as well as high quality articles on genetic engineering, cell and tissue culture technologies, genetics, microbiology, molecular biology, biochemistry, embryology, cell biology, chemical engineering, bioprocess engineering, information technology, biorobotics.
Evaluation of Metabolic Stability of Kinsenoside, an Antidiabetic Candidate, ...Cây thuốc Việt
Kinsenoside is a principle bioactive compound of Anoectochilus formosanus. It exhibits various pharmacological
effects such as antihyperglycemic, antioxidant, anti-inflammatory, immunostimulating, and hepatoprotective activities and has recently been developed as an antidiabetic drug candidate. In this study, as part of an in vitro pharmacokinetic study, the stability of kinsenoside in rat and human liver microsomes was evaluated. Kinsenoside was found to have good metabolic stability in both rat and human liver microsomes. These results will provide useful information for further in vivo pharmacokinetic and metabolism studies.
Hepatoprotective activity of aqueous extract of Hibiscus Sabdariffa on alcoho...Bhavana Gundavarapu
The aim of present study was to investigate the Hepatoprotective activity of aqueous extract of Hibiscus sabdariffa (Malvaceace) leaves in albino rats on alcohol induced hepatotoxic activity. .
Hepatoprotective Activity of Chara Parpam in Ccl4 Induced RatsIOSR Journals
Siddha system of medicine provides most frequently and to the extent possible and promising therapy for the relief of signs and symptoms of liver disorder over the generations. Their high therapeutic quality and lack of toxicity are exceptional. The present experimental work was to evaluate the hepatoprotective properties of Siddha herbo-mineral formulation Chara Parpam by CCl4 induced hepatotoxicity in albino rats. Two doses of Chara Parpam (5 mg/kg and 10 mg/kg) were administered to rats. Protection of hepatocytes was evaluated by estimate the level of ALT, AST, ALP, serum bilirubin, total protein, serum albumin, sodium and potassium during the exposure of CCL4 on wistar albino rats and to evaluate the effect of different doses of Chara Parpam against hepatotoxicity induced by CCL4. Liver histology was performed 24 hours after the administration of trial drug Chara Parpam. The result indicated that the concentration of ALT, AST, and ALP, released by hepatocytes were significantly reduced in the presence of Chara Parpam. The cytoprotective effects of the Chara Parpam are dose-dependent. Through this work, we demonstrate for the first time the direct protection of liver cells by administration of Chara Parpam confirming its hepatoprotective properties.
Protective effects of commelina benghalensis linn (root) extract on ethanol i...IJSIT Editor
The present study was undertaken to investigate the protective effect and possible mechanism of
alcoholic (AlE) and aqueous extract (AqE) from Commelina benghalensis root (CB) on EtOH-induced hepatic
injury in Wistar rat. Hepatotoxic parameters studied in vivo include serum transaminases (AST, and ALT),
ALP, bilirubin, protein, lipid profile (Cholesterol, triglyceride, VLDL and HDL) and level of antioxidants
together with histopathological examination. Liv 52® was used as a reference hepatoprotective agent
(5ml/kg-1b.w.). AlE and AqE (200 mg/kg-1b.w.) on oral administration decreased the level of AST, ALP, ALT,
bilirubin, cholesterol, triglyceride, VLDL, MDA and increased the level of protein, HDL and antioxidants (SOD,
GSH and CAT) in rats being treated with ethanol (EtOH). Pentobarbitone -induced sleeping time study was
carried out to verify the effect on microsomal enzymes Histopathological observations confirmed the
beneficial roles of MF against EtOH-induced liver injury in rats. Possible mechanism may involve their
antioxidant activity
Strategie nutraceutiche per ridurre l'infiammazione.CreAgri Europe
I polifenoli estratti dalle olive sono in grado di ridurre l'infiammazione mediata da TNF alfa. Esiste inoltre un effetto sinergico nella riduzione dello stato infiammatorio tra idrossitirosolo e glucosammina.
- inglese - testo scientifico -
Background: The present study sought to investigate erythrocyte glutathione S-transferases (GST),
NADH-Methaemoglobin reductase (NADH-MR) and Na+/K+-ATPase activities of hypoglycemic rats treated with
ethanol/water (1:2 v/v) extract of A. sativa as agent of glycemic control.
Methods: Hyperglycemia was induced by a single intra-peritoneal injection of 0.1 mol/L alloxan monohydrate in
phosphate buffer saline (PBS) solution (pH = 7.4); dosage = 140 mg/kg. At the end of the experimental time
(t = 76 h), erythrocyte GST, NADH-MR and Na+/K+-ATPase activities as well as serum fasting blood sugar (FBS)
levels were measured by spectrophotometric methods.
Results: Serum FBS levels of control/normal (C/N) rats ranged between 72.93 ± 0.82–95.12 ± 0.92 mg/dL, whereas
experimental rats without glycemic control gave: 249.41 ± 1.03–256.11 ± 1.23 mg/dL. Hyperglycemic rats treated
with ethanol/water (1:2 v/v) extract of A. sativa exhibited comparative reduced serum levels of FBS alongside with
erythrocyte GST, NADH-MR and Na+/K+-ATPase activities. The average relative activities of the three enzymes and
corresponding order of enzyme activity in hyperglycemic rats treated with ethanol/water (1:2 v/v) extract of A. sativa
was: NADH-MR = 60.99% > GST = 47.81% > Na+/K+-ATPase = 46.81%. In the same order, relative activities of the three
enzymes in rats without glycemic control were: NADH-MR = 49.65% > GST = 23.69% > Na+/K+-ATPase = 17.02%.
Conclusion: Erythrocyte GST, NADH-MR and Na+/K+-ATPase activities gave insights into the pathophysiology of
diabetic state and served as biomarkers for ascertaining therapeutic control in Type 1 diabetes mellitus.
Brazilian Red Propolis Attenuates Hypertension and Renal DamageBee Healthy Farms
Incorporating Brazilian Red Propolis in the diet of rats with reduced kidney function experienced a reduction of hypertension and renal damage. This scenario simulated Chronic Kidney Disease.and found the anti-inflammatory and antioxidant effects of Brazilian Red Propolis effective but requires additional studies to determine which mechanisms were prominent.
Comparative Study of The Antioxidant Activities of Monodora Myristica And A. ...iosrjce
IOSR Journal of Biotechnology and Biochemistry (IOSR-JBB) covers studies of the chemical processes in living organisms, structure and function of cellular components such as proteins, carbohydrates, lipids, nucleic acids and other biomolecules, chemical properties of important biological molecules, like proteins, in particular the chemistry of enzyme-catalyzed reactions, genetic code (DNA, RNA), protein synthesis, cell membrane transport, and signal transduction. IOSR-JBB is privileged to focus on a wide range of biotechnology as well as high quality articles on genetic engineering, cell and tissue culture technologies, genetics, microbiology, molecular biology, biochemistry, embryology, cell biology, chemical engineering, bioprocess engineering, information technology, biorobotics.
Evaluation of Metabolic Stability of Kinsenoside, an Antidiabetic Candidate, ...Cây thuốc Việt
Kinsenoside is a principle bioactive compound of Anoectochilus formosanus. It exhibits various pharmacological
effects such as antihyperglycemic, antioxidant, anti-inflammatory, immunostimulating, and hepatoprotective activities and has recently been developed as an antidiabetic drug candidate. In this study, as part of an in vitro pharmacokinetic study, the stability of kinsenoside in rat and human liver microsomes was evaluated. Kinsenoside was found to have good metabolic stability in both rat and human liver microsomes. These results will provide useful information for further in vivo pharmacokinetic and metabolism studies.
Hepatoprotective activity of aqueous extract of Hibiscus Sabdariffa on alcoho...Bhavana Gundavarapu
The aim of present study was to investigate the Hepatoprotective activity of aqueous extract of Hibiscus sabdariffa (Malvaceace) leaves in albino rats on alcohol induced hepatotoxic activity. .
Hepatoprotective Activity of Chara Parpam in Ccl4 Induced RatsIOSR Journals
Siddha system of medicine provides most frequently and to the extent possible and promising therapy for the relief of signs and symptoms of liver disorder over the generations. Their high therapeutic quality and lack of toxicity are exceptional. The present experimental work was to evaluate the hepatoprotective properties of Siddha herbo-mineral formulation Chara Parpam by CCl4 induced hepatotoxicity in albino rats. Two doses of Chara Parpam (5 mg/kg and 10 mg/kg) were administered to rats. Protection of hepatocytes was evaluated by estimate the level of ALT, AST, ALP, serum bilirubin, total protein, serum albumin, sodium and potassium during the exposure of CCL4 on wistar albino rats and to evaluate the effect of different doses of Chara Parpam against hepatotoxicity induced by CCL4. Liver histology was performed 24 hours after the administration of trial drug Chara Parpam. The result indicated that the concentration of ALT, AST, and ALP, released by hepatocytes were significantly reduced in the presence of Chara Parpam. The cytoprotective effects of the Chara Parpam are dose-dependent. Through this work, we demonstrate for the first time the direct protection of liver cells by administration of Chara Parpam confirming its hepatoprotective properties.
Protective effects of commelina benghalensis linn (root) extract on ethanol i...IJSIT Editor
The present study was undertaken to investigate the protective effect and possible mechanism of
alcoholic (AlE) and aqueous extract (AqE) from Commelina benghalensis root (CB) on EtOH-induced hepatic
injury in Wistar rat. Hepatotoxic parameters studied in vivo include serum transaminases (AST, and ALT),
ALP, bilirubin, protein, lipid profile (Cholesterol, triglyceride, VLDL and HDL) and level of antioxidants
together with histopathological examination. Liv 52® was used as a reference hepatoprotective agent
(5ml/kg-1b.w.). AlE and AqE (200 mg/kg-1b.w.) on oral administration decreased the level of AST, ALP, ALT,
bilirubin, cholesterol, triglyceride, VLDL, MDA and increased the level of protein, HDL and antioxidants (SOD,
GSH and CAT) in rats being treated with ethanol (EtOH). Pentobarbitone -induced sleeping time study was
carried out to verify the effect on microsomal enzymes Histopathological observations confirmed the
beneficial roles of MF against EtOH-induced liver injury in rats. Possible mechanism may involve their
antioxidant activity
Strategie nutraceutiche per ridurre l'infiammazione.CreAgri Europe
I polifenoli estratti dalle olive sono in grado di ridurre l'infiammazione mediata da TNF alfa. Esiste inoltre un effetto sinergico nella riduzione dello stato infiammatorio tra idrossitirosolo e glucosammina.
- inglese - testo scientifico -
Alterations of Mitochondrial Functions and DNA in Diabetic Cardiomyopathy of ...CrimsonPublishersIOD
Alterations of Mitochondrial Functions and DNA in Diabetic Cardiomyopathy of CCK1 Receptors-Deficient Rats by Abdelbary Prince, Magdy A Ghoneim, Abdallah M El-Ebidi, Hala A Mousa and Jin Han in Interventions in Obesity & Diabetes
Effects of Astaxanthin on Body and Liver Weight of High-Fat Diet through Regulation of Peroxisome Proliferator-Activated Receptors (PPARs)
http://dx.doi.org/10.21276/SSR-IIJLS.2020.6.2.4
Review that illustartes the link between bile acids and non steroideal anti-inflmmatory drugs and aspirin in the small intestine.
Discovery of the activity of liquorice on FXR
Edible Bird’s Nest Attenuates Procoagulation Effects of High-Fat Diet in RatsElabscience
Edible bird’s nest (EBN) is used traditionally in many parts of Asia to improve wellbeing, but there are limited studies on its
efficacy. We explored the potential use of EBN for prevention of high fat diet- (HFD-) induced insulin resistance in rats.
The role of curcumin in streptozotocin induced hepatic damage and the trans-d...Prof. Hesham N. Mustafa
Diabetic patients frequently suffer from non-alcoholic steatohepatitis. The current study aimed to investigate the role of curcumin and the response of hepatic stellate cells in streptozotocin (STZ)-induced hepatic damage. Sixty male rats were divided into three groups. The normal control injected with a citrate buffer vehicle and the diabetic control group which was injected intraperitoneally (IP) with a single-dose of streptozotocin (50mg/kg body weight) and a diabetic group was treated with an oral dose of curcumin at 80 mg/kg body weight daily for 60 days. Curcumin effectively counteracts oxidative stress-mediated hepatic damage and improves biochemical parameters. Alpha-smooth muscle actin (α-SMA) was significantly reduced, and insulin antibodies showed strong positive immunoreactivity with curcumin administration. These results optimistically demonstrate the potential use of curcumin, which is attributed to its antiradical/antioxidant activities and its potential β-cell regenerative properties. Also, it has the capability to encourage the trans-differentiation of hepatic stellate cells into insulin-producing cells for a period of time. In addition, as it is an anti-fibrotic mediator that inhibits hepatic stellate cell activation and the transition to myofibroblast-like cells, this suggests the possibility of considering curcumin's novel therapeutic effects in reducing hepatic dysfunction in diabetic patients.
Biochemical Study on Endothelial Nitric Oxide Gene Polymorphism in Fatty Live...iosrjce
IOSR Journal of Pharmacy and Biological Sciences(IOSR-JPBS) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of Pharmacy and Biological Science. The journal welcomes publications of high quality papers on theoretical developments and practical applications in Pharmacy and Biological Science. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Recent lecture (june 2011)
Nutrigenomics of FAT: What is “good” or “bad” for human health?
Less healthy: Dietary fats rich in long chain saturated fatty acids that can be pro-inflammatory if chronically “overconsumed”
More favorable: Unsaturated fatty acids (in particular PUFAs from fish oil) have anti-inflammatory properties
A healthy adipose tissue is essential to efficiently store fat and prevent ectopic fat deposition
Healthy : Subcutanous fat > visceral fat > ectopic fat : Unhealthy
Future challenge: To prevent the unhealthy effects of a surplus of added sugars (sucrose, fructose) & high GI carbs
Will be converted into saturated fat
Linked to ectopic fat deposition e.g. NASH
Linked to obesity, diabetes, CVD….
Childhood obesity
Effect of Piper crocatum Extract Against Weight Loss and Liver Enzyme Levels ...iosrphr_editor
Piper crocatum is one of Indonesian medicinal plant that contain flavonoids, tannins, alkaloids, and saponins. Aims of this study were to evaluate the effect of Piper crocatum aqueous extract against a decrease in body weight (BW) and the activity of enzymes involved in lipid metabolism (AMPK, ACC, FAS) in liver obese rats. This study used four groups of Sprague dawley rat (n = 6), including normal group (N), obese controls (OC), Piper crocatum extract dose 1260 mg/kgBW (PcA), and Piper crocatum extract dose of 1890 mg/kgBW (PcB). Measurement of metabolic liver enzyme levels (AMPK, ACC, FAS) are using ELISA kit (CusabioTM). Results of this study showed that the PcA group produce the highest reduction in body weight (4.52%), and the lowest levels of ACC (9.13 ng/g) and FAS (360.68 ng/g) which was significantly different from obese control group (95% CI). Piper crocatum extract can't activate AMPK. The highest levels in rat liver AMPK is in N group with 8.42 ng/g, but this value is not significantly different from other groups.
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
Prix Galien International 2024 Forum ProgramLevi Shapiro
June 20, 2024, Prix Galien International and Jerusalem Ethics Forum in ROME. Detailed agenda including panels:
- ADVANCES IN CARDIOLOGY: A NEW PARADIGM IS COMING
- WOMEN’S HEALTH: FERTILITY PRESERVATION
- WHAT’S NEW IN THE TREATMENT OF INFECTIOUS,
ONCOLOGICAL AND INFLAMMATORY SKIN DISEASES?
- ARTIFICIAL INTELLIGENCE AND ETHICS
- GENE THERAPY
- BEYOND BORDERS: GLOBAL INITIATIVES FOR DEMOCRATIZING LIFE SCIENCE TECHNOLOGIES AND PROMOTING ACCESS TO HEALTHCARE
- ETHICAL CHALLENGES IN LIFE SCIENCES
- Prix Galien International Awards Ceremony
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journeygreendigital
Tom Selleck, an enduring figure in Hollywood. has captivated audiences for decades with his rugged charm, iconic moustache. and memorable roles in television and film. From his breakout role as Thomas Magnum in Magnum P.I. to his current portrayal of Frank Reagan in Blue Bloods. Selleck's career has spanned over 50 years. But beyond his professional achievements. fans have often been curious about Tom Selleck Health. especially as he has aged in the public eye.
Follow us on: Pinterest
Introduction
Many have been interested in Tom Selleck health. not only because of his enduring presence on screen but also because of the challenges. and lifestyle choices he has faced and made over the years. This article delves into the various aspects of Tom Selleck health. exploring his fitness regimen, diet, mental health. and the challenges he has encountered as he ages. We'll look at how he maintains his well-being. the health issues he has faced, and his approach to ageing .
Early Life and Career
Childhood and Athletic Beginnings
Tom Selleck was born on January 29, 1945, in Detroit, Michigan, and grew up in Sherman Oaks, California. From an early age, he was involved in sports, particularly basketball. which played a significant role in his physical development. His athletic pursuits continued into college. where he attended the University of Southern California (USC) on a basketball scholarship. This early involvement in sports laid a strong foundation for his physical health and disciplined lifestyle.
Transition to Acting
Selleck's transition from an athlete to an actor came with its physical demands. His first significant role in "Magnum P.I." required him to perform various stunts and maintain a fit appearance. This role, which he played from 1980 to 1988. necessitated a rigorous fitness routine to meet the show's demands. setting the stage for his long-term commitment to health and wellness.
Fitness Regimen
Workout Routine
Tom Selleck health and fitness regimen has evolved. adapting to his changing roles and age. During his "Magnum, P.I." days. Selleck's workouts were intense and focused on building and maintaining muscle mass. His routine included weightlifting, cardiovascular exercises. and specific training for the stunts he performed on the show.
Selleck adjusted his fitness routine as he aged to suit his body's needs. Today, his workouts focus on maintaining flexibility, strength, and cardiovascular health. He incorporates low-impact exercises such as swimming, walking, and light weightlifting. This balanced approach helps him stay fit without putting undue strain on his joints and muscles.
Importance of Flexibility and Mobility
In recent years, Selleck has emphasized the importance of flexibility and mobility in his fitness regimen. Understanding the natural decline in muscle mass and joint flexibility with age. he includes stretching and yoga in his routine. These practices help prevent injuries, improve posture, and maintain mobilit
Ethanol (CH3CH2OH), or beverage alcohol, is a two-carbon alcohol
that is rapidly distributed in the body and brain. Ethanol alters many
neurochemical systems and has rewarding and addictive properties. It
is the oldest recreational drug and likely contributes to more morbidity,
mortality, and public health costs than all illicit drugs combined. The
5th edition of the Diagnostic and Statistical Manual of Mental Disorders
(DSM-5) integrates alcohol abuse and alcohol dependence into a single
disorder called alcohol use disorder (AUD), with mild, moderate,
and severe subclassifications (American Psychiatric Association, 2013).
In the DSM-5, all types of substance abuse and dependence have been
combined into a single substance use disorder (SUD) on a continuum
from mild to severe. A diagnosis of AUD requires that at least two of
the 11 DSM-5 behaviors be present within a 12-month period (mild
AUD: 2–3 criteria; moderate AUD: 4–5 criteria; severe AUD: 6–11 criteria).
The four main behavioral effects of AUD are impaired control over
drinking, negative social consequences, risky use, and altered physiological
effects (tolerance, withdrawal). This chapter presents an overview
of the prevalence and harmful consequences of AUD in the U.S.,
the systemic nature of the disease, neurocircuitry and stages of AUD,
comorbidities, fetal alcohol spectrum disorders, genetic risk factors, and
pharmacotherapies for AUD.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
These lecture slides, by Dr Sidra Arshad, offer a quick overview of physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar leads (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Explore natural remedies for syphilis treatment in Singapore. Discover alternative therapies, herbal remedies, and lifestyle changes that may complement conventional treatments. Learn about holistic approaches to managing syphilis symptoms and supporting overall health.
Pharynx and Clinical Correlations BY Dr.Rabia Inam Gandapore.pptx
Matsunami et al., 2010 4th
1. Introduction
Nonalcoholic fatty liver disease (NAFLD) is de-
fined as a constellation of clinical conditions
characterized predominantly by macrovesicular
steatosis of the liver [1]. The histologic spec-
trum of NAFLD includes fatty liver alone or non-
alcoholic steatohepatitis (NASH) [2, 3]. NASH
can be associated with progressive hepatic fi-
brosis and is an important cause of cirrhosis of
the liver [4]. The pathogenesis of NASH is not
well understood; however, the progression of
hepatic steatosis to NASH is attributed to a
“second hit” that leads to the development of
liver inflammation and fibrosis [5]. Progression
of fatty liver to NASH has been linked to oxida-
tive stress and lipid peroxidation in the liver,
leading to inflammation [6-8].
Adiponectin, a hormone secreted by adipocytes,
acts as an antidiabetic and anti-atherogenic
adipocytokine [9]. It can improve hepatic insulin
sensitivity, decrease lipid accumulation in liver
and skeletal muscle, and has anti-inflammatory
effects via NFκB activation [10-12]. Adiponectin
has been shown to improve steatosis and in-
flammation in patients and mice with NAFLD
[13, 14]. Musso et al. reported that adiponectin
has a hepatoprotective action [15]. The two
types of adiponectin receptors (AdipoR1/R2)
clearly differ in their signaling pathways. Adi-
poR1 is more tightly linked to the activation of
the AMP-activated protein kinase (AMPK) path-
way and regulates the inhibition of hepatic glu-
cose production (HGP) together with increased
fatty acid oxidation, while AdipoR2 is mainly
involved in the activation of the peroxisome pro-
Int J Clin Exp Pathol 2010;3(5):472-481
www.ijcep.com /IJCEP1005002
Original Article
Regulation of oxidative stress and inflammation by hepatic
adiponectin receptor 2 in an animal model of nonalcoholic
steatohepatitis
Tokio Matsunami, Yukita Sato, Satomi Ariga, Takuya Sato, Haruka Kashimura, Yuki Hasegawa,
Masayoshi Yukawa
Laboratory of Biomedical Science, Department of Veterinary Medicine, College of Bioresource Sciences,
Nihon University, Fujisawa 252-0880, Japan.
Received May 7, 2010, accepted May 19, 2010, available online May 22, 2010
Abstract: The pathogenesis of nonalcoholic steatohepatitis (NASH) is not well understood; however, the progression
of fatty liver to NASH has been linked to oxidative stress and lipid peroxidation in the liver, leading to inflammation.
Although the adiponectin receptor 2 (AdipoR2) has been identified as a modulator of oxidative stress and inflamma-
tion in the liver, it remains unclear whether the receptor has hepatic antioxidant and anti-inflammatory effects in
NASH. In this study, we used an animal model of NASH to examine hepatic AdipoR2. Obese fa/fa Zucker rats fed a
high-fat and high-cholesterol (HFC) diet spontaneously developed fatty liver with inflammation and fibrosis, character-
istic of NASH, after 4, 8, or 12 weeks of HFC diet consumption. AdipoR2 expression was significantly decreased,
whereas the expression of genes related to NADPH oxidase complex were increased. As a result of the decrease in
AdipoR2 expression, the mRNA expression of genes located downstream of AdipoR2, i.e., Cu-Zn superoxide dismu-
tase (Cu-Zn SOD) and Mn-SOD, also decreased. Furthermore, the expression of genes related to inflammation was
increased. Increased oxidative stress and inflammation by down-regulation of AdipoR2 may contribute to the progres-
sion of NASH. Thus, the AdipoR2 might be a crucially important regulator of hepatic oxidative stress and inflammation
in NASH.
Keywords: Nonalcoholic steatohepatitis, adiponectin receptor 2, inflammation, oxidative stress, Zucker rats
2. Oxidative stress, inflammation and hepatic adiponectin receptor
473 Int J Clin Exp Pathol 2010;3(5):472-481
liferator-activated receptor α (PPARα) pathway,
which stimulates energy dissipation by increas-
ing fatty acid oxidation, and inhibits inflamma-
tion and oxidative stress [16]. Moreover, in mice
over-expressing AdipoR2, decreased expression
of tumour necrosis factor α (TNFα), monocyte
chemoattractant protein-1 (MCP-1), and re-
duced formation reactive oxidative species
(ROS) is observed [12]. However, the role of
AdipoR2 in mediating hepatic anti-inflammatory
and antioxidants effects in NASH remains un-
clear.
Little is known about the hepatic expression of
genes related to inflammatory and oxidative
stress factors in obese animals with NASH. To
reveal the role of AdipoR2 in the pathogenesis
of NASH, we examined the hepatic expression
of inflammatory and oxidative stress factors in
animals fed a diet to induce NASH and obese
animals fed a control diet.
Materials and methods
Animals and experimental design
Male obese fa/fa Zucker rats were purchased
from Japan SLC Inc (Shizuoka, Japan) at 7
weeks of age. After a 1-week acclimation pe-
riod, all animals were subdivided into groups
fed standard chow or a high-fat and -cholesterol
(HFC) diet. The standard chow diet, containing
5.9% fat (in the form of soy oil) by weight
(control, n = 6), and the HFC diet, containing
25% fat (in the form of lard and beef tallow) and
5% cholesterol by weight (NASH, n = 6) were fed
to rats for 4, 8, and 12 weeks. Both diets were
purchased from Oriental Yeast (Tokyo, Japan).
All rats were housed in an animal facility with
controlled temperature and a 12-hour light/dark
cycle (light on at 7:00 AM and off at 7:00 PM). In
addition, the rats fed the control diet had free
access to water, and those fed the HFC diet had
free access to sodium chloride solution (1%) ad
libitum at all times. All experimental procedures
were implemented in accordance with the Insti-
tutional Guidelines for Animal Experiments at
the College of Bioresource Sciences, Nihon Uni-
versity under the permission of the Committee
of Experimental Animal in our college.
Tissue preparation, blood sampling, and
analysis
Blood sampling was performed at 4, 8, and 12
weeks in rats fasted overnight. Blood samples
were collected from the inferior vena cava im-
mediately prior to sacrifice of rats under ether
anesthesia. Blood samples were centrifuged at
3000 rpm for 5 min, and then the plasma was
collected and stored at -80°C until analysis.
After sacrifice, liver weight and intra-abdominal
fat (epididymal fat pad, mesenteric fat, and per-
inephric fat) weight were measured. In addition,
liver samples were collected in liquid nitrogen
for analysis of antioxidant enzymes, lipid peroxi-
dation, and hepatic triglyceride content, and
stored at -80°C until analysis. Additional, liver
samples were collected in RNAlater solution
(Qiagen, Hilden, Germany) for molecular biologic
studies, and stored at -80°C until analysis.
Biochemical analysis
Fasting plasma glucose, total cholesterol, and
triglyceride concentrations were measured us-
ing commercially available enzyme-linked colori-
metric diagnostic kits (DRI-CHEM4000, Fujifilm,
Tokyo, Japan), and the plasma free fatty acid
(FFA) concentration was measured by an en-
zyme method using a JCA-BM2250 (JEOL Ltd.,
Tokyo, Japan). Fasting plasma insulin concen-
trations were determined using a rat insulin
ELISA kit (AKRIN-010H, Shibayagi, Gunma, Ja-
pan).
Analysis of antioxidant enzymes, lipid peroxida-
tion, and hepatic triglycerides
Liver homogenates were prepared at a 1:10
(w:v) dilution in 10 mM potassium phosphate
buffer, pH 7.4, using a Ultra-Turrax® homoge-
nizer (IKA® Japan, Nara, Japan). Samples were
centrifuged at 3000 rpm for 10 min at 4°C, and
the supernatants were collected and immedi-
ately assayed for enzyme activities. For total
glutathione (GSH), ~50 μg of liver was homoge-
nized in 5% trichloroacetic acid at a ratio of
1:10 (w:v) and centrifuged for 5 min at 8000
rpm and 4°C. Total GSH was measured in the
tissues as previously described [17]. Total su-
peroxide dismutase (SOD), catalase, and total
GSH peroxidase (Gpx) activities were measured
according to the methods of Sun et al. [18],
Aebi [19], and Paglia and Valentine [20], re-
spectively. Lipid peroxidation levels were meas-
ured by the thiobarbituric acid (TBA) reaction
using the method of Ohkawa et al. [21]. For
quantification of hepatic triglyceride content,
liver tissue was lysed with buffer using a com-
3. Oxidative stress, inflammation and hepatic adiponectin receptor
474 Int J Clin Exp Pathol 2010;3(5):472-481
mercially available kit (Wako, Osaka, Japan) and
disrupted by sonication. The hepatic triglyceride
content of the homogenate were then deter-
mined according to the kit manufacturer’s in-
structions.
Liver histopathological examination
Liver tissue samples were fixed overnight in
10% buffered formalin and embedded in paraf-
fin. Sections (5 μm) of liver tissue were stained
with hematoxylin and eosin (H&E) and Masson’s
trichrome. Steatosis, activity (inflammation),
and stage (fibrosis) were semiquantitatively
evaluated according to the standard criteria for
grading and staging NASH, with minor modifica-
tions [3]. The degree of steatosis was scored as
the percentage of hepatocytes containing lipid
droplets. Activity was evaluated as the sum of
scores (score 0-6) for acinar inflammation
(score 0-3) and portal inflammation (score 0-3).
Fibrosis was graded from 0 (absent) to 4 (1,
perisinusoidal/pericellular fibrosis; 2, periportal
fibrosis; 3, bridging fibrosis; 4, cirrhosis).
RNA extraction and Quantitative Real- time
PCR
RNA isolation was performed by homogeniza-
tion with a Micro Smash-100RTM (Tomy Seiko,
Tokyo, Japan) using Isogen (Nippon Gene, To-
kyo, Japan) for liver. RNA purification was car-
ried out using RNeasy Mini kits (Qiagen, Hil-
den, Germany) for all the tissues studied. All
samples were treated with DNase I (RNase
Free DNase set, Qiagen). The concentrations
of total RNA were measured by absorbance at
260 nm using a NanoDrop® ND-1000
(NanoDrop, USA). The purity was estimated by
the 260/280 nm absorbance ratio. Total RNA
(1 μg) was subjected to reverse transcription
using oligo(dT)12-18 primer and M-MuLV reverse
transcriptase (SuperScriptTM Ⅲ First-Strand
Synthesis, Invitrogen Life Science, USA) ac-
cording to the manufacturer’s instructions. The
transcript levels of specific primers (Table 1)
were quantified by real-time PCR (7500 Real
Time PCR System, Applied Biosystems, CA,
USA). The cDNA was amplified under the fol-
lowing conditions: 95°C for 10 min, followed
by 45 cycles of 15 s at 95°C and 1 min at 59°
C, using Power SYBR® Green PCR Master Mix
(Applied Biosystems) with each primer at a
concentration of 400 nM/L. After PCR, a melt-
ing curve analysis was performed to demon-
strate the specificity of the PCR product, which
was displayed as a single peak (data not
shown). All samples were analyzed in tripli-
cate. The relative expression ratio (R) of a tar-
get gene was expressed for the sample versus
Table 1. Primers sequences used for real-time PCR reactions
Genebank
Forward 5' → 3' Reverse 5' → 3'
Gene accession no.
AdipoR2 NM_001037979 CATGTTTGCCACCCCTCAGTA ATGCAAGGTAGGGATGATTCCA
gp91phox NM_023965 CGGAATCTCCTCTCCTTCCT GCATTCACACACCACTCCAC
p22phox NM_024160 TGTTGCAGGAGTGCTCATCTGTCT AGGACAGCCCGGACGTAGTAATTT
p47phox NM_053734 AGGTTGGGTCCCTGCATCCTATTT TGGTTACATACGGTTCACCTGCGT
Nox4 NM_053524 TCATGGATCTTTGCCTGGAGGGTT AGGTCTGTGGGAAATGAGCTTGGA
Cu-Zn SOD NM_017050 CTGGACAAACCTCAGCCCTA TGATGGCTTCCAGCAACTC
Mn-SOD NM_017051 GACCTGCCTTACGACTATG TACTTCTCCTCGGTGACG
Gpx1 NM_030826 GCTGCTCATTGAGAATGTCG GAATCTCTTCATTCTTGCCATT
Catalase NM_012520 ATTGCCGTCCGATTCTCC CCAGTTACCATCTTCAGTGTAG
TNF α NM_012675 ATACACTGGCCCGAGGCAAC CCACATCTCGGATCATGCTTTC
MCP-1 NM_031530 GATCTCTCTTCCTCCACCACTATG GAATGAGTAGCAGCAGGTGAGT
18s rRNA M11188 GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
4. Oxidative stress, inflammation and hepatic adiponectin receptor
475 Int J Clin Exp Pathol 2010;3(5):472-481
the control in comparison to the 18S rRNA
[22]. R was calculated based on the following
equation [23]: R = 2-ΔΔCt , where Ct represents
the cycle at which the fluorescence signal was
significantly from background and ΔΔCt was
(Ct, target – Ct, 18s rRNA) treatment – (Ct, target – Ct, 18s
rRNA) control.
Data analysis
The results are expressed as mean ± standard
error of the mean (SEM). Statistical significance
was determined by unpaired t-test with a P
value of < 0.05.
Results
Effects of high-fat and-cholesterol (HFC) diet
on metabolic parameters
The general characteristics of the metabolic
profile of the experimental animals are sum-
marized in Table 2. Body weight gain and the
final weight of all rats fed the control or HFC
diets were measured after 4, 8, and 12 weeks
of treatment. The body weight and the weight
of daily food intake in the HFC group did not
differ from those of the control group at 4, 8,
and 12 weeks (Table 2). The liver weight was
2.3-fold higher in HFC rats than in control rats
at 4 weeks, 4-fold higher at 8 weeks, and 4.2-
fold higher at 12 weeks (Table 2). The fasting
plasma glucose, cholesterol, and FFA concen-
trations were all significantly higher in HFC rats
than in control rats, whereas plasma triglyc-
eride concentrations in the HFC rats were sig-
nificantly lower than those in control rats at 4,
8, and 12 weeks (Table 2). Plasma insulin con-
centrations did not differ between control and
HFC rats at 4, 8, and 12 weeks.
Antioxidant defense activities
The activities of total SOD, catalase, and Gpx
were significantly lower in HFC rats than in
control rats at 4, 8, and 12 weeks (Table 3).
The level of TBARS in HFC rats increased sig-
nificantly (P < 0.05) compared with control
rats at 4, 8, and 12 weeks (Figure 1).
Liver histopathology and the hepatic lipid
content in HFC rats
Figure 2 depicts the representative time
Table 2. Effects of high-fat and -cholesterol (HFC) treatment on metabolic parameters in HFC diet-induced rats
of nonalcoholic steatohepatitis at 4, 8, and 12 weeks of treatment
Obese (fa/fa) Zucker rats
4 weeks 8 weeks 12 weeks
Diet type Control HFC Control HFC Control HFC
Body weight (g) 398± 8.3 397± 4.8 566± 17.2 525± 25.9 622± 11.3 648 ± 18.5
Food intake (g/day) 26.7± 5.3 24.2 ± 7.3 26.3 ± 8.8 22.8 ± 4.8 25.4 ± 7.3 26.6 ± 3.4
Liver weight (g) 11.8 ± 0.8 26.9 ± 1.1* 12.8 ± 0.3 55.2 ± 1.5** 15.2 ± 0.7 63.3 ± 1.2**
Intra-abdominal fat weight (g) 23.7 ± 0.7 24.3 ± 1.3 40.5 ± 3.7 38.8 ± 4.2 45.8 ± 2.8 44.5 ± 3.8
Epididymal fat pad weight (g) 9.8 ± 0.6 9.7 ± 0.2 16.6 ± 1.2 16.5 ± 1.4 15.4 ± 0.3 15.3 ± 0.3
Mesenteric fat weight (g) 4.7 ± 0.8 4.8 ± 0.7 8.2 ± 0.4 6.1 ± 0.2 8.6 ± 0.2 7.1 ± 1.1
Perinephric fat weight (g) 9.2 ± 1.2 9.8 ± 0.6 15.7 ± 1.6 16.2 ± 3.7 21.8 ± 1.7 22.1 ± 2.7
Plasma glucose (mmol/L) 6 ± 0.3 7.7 ± 0.1 5.6 ± 0.3 8.2 ± 0.5* 5.8 ± 0.2 8.3 ± 0.4*
Plasma insulin (ng/mL) 11.3 ± 0.2 10.4 ± 1.1 17.4 ± 0.9 15.5 ± 0.5 18.3 ± 1.1 16.3 ± 0.4
Plasma total cholesterol (mg/
dL)
120 ± 16 896 ± 52** 166 ± 15 1360 ± 74** 190 ± 10 1280 ± 103**
Plasma triglycerides (mg/dL) 385 ± 45 186 ± 31* 335 ± 30.3 229 ± 13.6 587 ± 42 254 ± 15*
Plasma FFAs (mEq/L) 1.24 ± 0.2 3.04 ± 0.3* 1.35 ± 0.2 1.77 ± 0.1** 1.38 ± 0.6 1.91 ± 0.2**
FFAs, free fatty acids. *P < 0.05, **P < 0.01 for HFC diet-induced rats vs control diet-induced rats of same age.
Values are expressed as mean ± SEM (n = 6).
5. Oxidative stress, inflammation and hepatic adiponectin receptor
476 Int J Clin Exp Pathol 2010;3(5):472-481
course of histologic changes (Figures 2A and
2B) and scores (Figure 2C) in HFC and control
rats at 4, 8, and 12 weeks. The HFC diet
caused intense lobular inflammation and
perovenular and pericellular fibrosis promi-
nently in zone 3 of the liver at 4, 8, and 12
weeks. Steatosis scores in HFC rats (74.5 ±
8.2 vs. 1.2 ± 0.5 % at 4 weeks, 88.7 ± 3.3 vs.
1.8 ± 1.2 % at 8 weeks, and 92.3 ± 2.2 vs. 3.5
± 2 % at 12 weeks) and inflammation (3.8 ±
0.75 vs. 0.4 ± 0.12 at 4 weeks, 5.5 ± 0.54 vs.
1.2 ± 0.3 at 8 weeks, and 5.7 ± 0.51 vs. 1.4 ±
0.5 at 12 weeks) were greater than those of
control rats (Figures 2A and 2B). In addition,
the histological severity of fibrosis was signifi-
cantly greater in HFC rats at 4, 8, and 12
weeks (Figures 2A and 2B), and the histologic
scores for steatosis, inflammation, and fibrosis
in HFC rats at 12 weeks were significantly
higher than those in HFC rats at 4 and 8
weeks (Figure 2C).
HFC rats at 4, 8, and 12 weeks showed
macrovesicular steatosis in the liver (Figure
2A). The hepatic triglyceride content was
measured to evaluate the progression of stea-
tosis quantitatively after 4, 8, and 12 weeks
(Figure 3A). Hepatic triglyceride content in-
creased significantly in HFC rats at 4, 8, and
12 weeks (P < 0.05 vs control rats). Plasma
Table 3. Effects of high-fat and high-cholesterol (HFC) on antioxidant defense enzymes in at 4, 8, and 12
weeks of treatment
Treatment GSH SOD Catalase GPx
4 weeks
Control 66 ± 12 147 ± 23 6230 ± 524 748 ± 136
HFC 50.5 ± 17 3793 ± 167* 497± 39*
8 weeks
Control 61 ± 5.5 96 ± 10 5956± 278 604 ± 52
HFC 42 ± 5 54 ± 7.1* 1381 ± 141** 356 ± 43*
12 weeks
Control 67 ± 8 116 ± 18 6120 ± 320 670 ± 45
HFC 38 ± 3.8* 43 ± 4** 1220 ± 103** 330 ± 35*
Values are expressed as mean ± SEM (n = 6).
Levels of glutathione (GSH) was measured and expressed as nmol/mg of protein. The activities of superoxide dismu-
tase (SOD), catalase, and glutathione peroxidase (Gpx) are expressed as U/mg of protein. *P < 0.05, **P < 0.01 for
HFC diet-fed rats vs control diet-fed rats.
80 ± 21*
Figure 1 Comparison of lipid per-
oxidation levels (TBARS) in the liver
between rats fed control (control)
or high-fat and high-cholesterol
(HFC) diet for 4, 8, and 12 weeks.
TBAR values (mean ± SEM) are
expressed as nmol/mg protein (n =
6). *P < 0.05, **P < 0.01 for HFC
vs. group.
6. Oxidative stress, inflammation and hepatic adiponectin receptor
477 Int J Clin Exp Pathol 2010;3(5):472-481
ALT levels in HFC rats were higher by about
1.4-fold at 4 weeks, 1.9-fold at 8 weeks, and
3.9-fold at 12 weeks as compared with control
rats (Figure 3B). These results reconfirm that
the HFC rats met the definitions of NASH.
Thus, hereafter, we refer to HFC-fed rats as
the NASH group.
Expression of adiponectin receptor (AdipoR2)
Hepatic expression of the adiponectin receptor
(AdipoR2) gene was significantly down-
regulated (0.67-fold at 8 weeks and 0.58-fold
at 12 weeks) in NASH as compared with con-
trol rats (Figure 4A).
Expression of antioxidant enzyme genes
(Cu-Zn SOD, Mn-SOD, Catalase, Gpx1)
Oxidative stress is regulated by the balance
between ROS production and antioxidant en-
zyme activity [24]. We determined the mRNA
expression levels of the genes for Cu-Zn SOD,
Mn-SOD, catalase, and Gpx1, which reduce
ROS and lipid peroxides, resulting in de-
creased oxidative stress. In the present study,
the hepatic expression of mRNA for Cu-Zn SOD
and Mn-SOD was significantly down-regulated
(0.43-, and 0.57-fold, respectively) in NASH as
compared with control rats at 12 weeks
(Figure 4B).
Figure 2 Liver histopathology in HFC and control rats. Time course of histologic changes in liver samples stained
with hematoxylin and eosin (A) and Masson’s trichrome (B) at 4 weeks (left column), 8 weeks (middle column), and
12 weeks (right column) in rats fed control diet or high-fat and high-cholesterol (HFC) diet. Original magnification,
100×. Time course of histologic changes in HFC rats are represented by the histologic scores (C) in at 4, 8, and 12
weeks. Criteria for each score are described in Materials and Methods. HFC rats at 4 weeks (white bars, n = 6), at 8
weeks (light gray bars, n = 6), and at 12 weeks (black bars, n = 6). Values are expressed as mean ± SEM. *P <
0.05, **P < 0.01 at 8 and 12 weeks vs 4 weeks.
7. Oxidative stress, inflammation and hepatic adiponectin receptor
478 Int J Clin Exp Pathol 2010;3(5):472-481
Expression of genes related to inflammation
(TNFα, MCP-1)
In the NASH group, the expression of TNFα
and MCP-1 mRNAs was significantly up-
regulated (1.56-, and 2.31-fold at 8 weeks,
and 2.56-, and 3.33-fold at 12 weeks, respec-
tively) compared with the control group (Figure
4C). Moreover, the hepatic expression of MCP-
1 mRNA in NASH rats at 4 weeks was up-
regulated (2.01-fold vs the control rats at 4
weeks).
Expression of genes related to NADPH oxidase
complex (gp91phox, p22phox, p47phox, Nox4)
ROS are can arise from several biochemical
reactions: mitochondrial and peroxisomal fatty
acid β-oxidation, microsomal fatty acid ω-
oxidation, and reduction of oxygen by the nicoti-
namide adenine dinucleotide phosphate
(NADPH) oxidase (Nox) complex [25]. We meas-
ured the expression of mRNA for NADPH oxi-
dase complex (gp91phox, p22phox, p47phox, and
Nox4). In NASH rats, the mRNA expression of
genes encoding for key regulators of ROS, in-
cluding gp91phox (also called Nox2), p22phox, and
Nox4, were significantly up-regulated (1.69-,
1.87-, and 2.18-fold at 8 weeks, and 1.77-,
2.08-, and 3.37-fold at 12 weeks, respectively)
as compared with control rats (Figure 4D). In
addition, the hepatic expression of Nox4 mRNA
in NASH rats at 4 weeks was significantly up-
regulated (2.03-fold) relative to the control rats).
Discussion
In the present study, we showed that rats fed
a HFC diet for 4, 8, and 12 weeks developed
obesity, hyperglycemia, insulin resistance, and
hyperlipidemia, and also marked hepatic stea-
tosis, inflammation, and fibrosis, which are all
characteristics of NASH. Moreover, hepatocyte
ballooning and Mallory hyaline bodies, essen-
tial findings for the diagnosis of NASH in hu-
mans, were seen in HFC rats at 4, 8, and 12
weeks. These characteristics of the HFC rats
clearly meet the definition of NASH. We have
also shown, for the first time, the dynamic
panel of mRNA expression of genes related to
inflammatory and oxidative stress factors un-
der the control of AdipoR2 in the NASH liver.
In our dietary model of NASH, mRNA down-
regulation of the gene for AdipoR2 was ob-
served in the liver. AdipoR2 is mainly involved
in the activation of the PPARα pathway, which
up-regulates the expression of a suite of genes
that includes mitochondrial, peroxisomal, and
microsomal fatty acid oxidation enzymes in the
liver [16]. Recent studies have reported that
the down-regulation of AdipoR2 expression is
attributable to decreased PPARα expression in
NASH [26]. In the present study, however, we
demonstrated mRNA up-regulation of genes
involved in ROS production (gp91phox, p22phox,
p47phox, and Nox4) and the down-regulation of
genes related to antioxidant enzymes (Cu-Zn
SOD, Mn-SOD, GPx1, catalase) in liver with
NASH. The mRNA up-regulation of Nox
complex and the down-regulation of antioxi-
Figure 3. Hepatic triglyceride content (A) and
plasma ALT levels (B) in control diet-fed rats
(control) and rats fed a high-fat and high-cholesterol
(HFC) diet for 4, 8, and 12 weeks. Hepatic triglyc-
eride levels are expressed per gram of liver tissue,
and plasma ALT values are expressed in U/L. Data
represent mean ± SEM (n = 6). *P < 0.05, **P <
0.01 for HFC vs group.
8. Oxidative stress, inflammation and hepatic adiponectin receptor
479 Int J Clin Exp Pathol 2010;3(5):472-481
dant enzymes in the liver of NASH suggest that
mitochondrial and peroxisomal fatty acid β-
oxidation and microsomal fatty acid ω-
oxidation are increased in NASH liver. Further-
more, we speculate that the up-regulation of
fatty acid oxidation may lead to an increase in
ROS production in hepatocytes and the down-
regulation of antioxidant enzymes, resulting in
induction of hepatic oxidative stress in NASH.
The Nox complex may be a major source of
hepatic ROS production in NASH. The hepatic
expression of mRNA for gp91phox and its sub-
units p22phox were significantly up-regulated in
rats with NASH as compared with control rats.
gp91phox and/or Nox4 increase TGF-β
(transforming growth factor β) production,
which promotes fibrosis and the proliferation
of stellate cells [27]. We found that TGF-β
mRNA was upregulated in the liver of rats with
NASH (data not shown), which accompanied
the histopathological findings of steatohepati-
tis, inflammation, and fibrosis. Moreover, the
hepatic expression of TNFα and MCP-1 mRNAs
was significantly up-regulated in rats with
NASH as compared with control rats. Induction
of Nox1/2/4 by TNFα promotes hepatocyte
apoptosis and inflammation in experimental
models of NASH [28]. Thus NADPH oxidases,
especially gp91phox and Nox4, might to be in-
volved in pathways leading to insulin resis-
tance and steatosis in the liver, constituting
the ‘two hits theory’ for NASH pathogenesis
(steatosis, inflammation, and fibrosis) [5].
Thereby, the regulating of expression of Adi-
poR2, which negatively regulates the expres-
sion of genes related to inflammation and ROS
[12], seems to be crucially important.
In conclusion, our NASH animal model indicates
various gene expression dynamics and suggests
that the mRNA down-regulation of AdipoR2 in-
duces oxidative stress and inflammation, poten-
tially through the up-regulated expression of
genes that modulate ROS and inflammation,
and the down-regulated expression of antioxi-
dant enzymes in the liver. Thus, we have estab-
lished a dietary rodent model of steatohepatitis
which reflects the human pathophysiology of
NASH. Additionally, Tomita et al suggested that
Figure 4 Real-time PCR analysis of adiponectin and AdipoR2 (A), antioxidant enzyme (B), inflammatory (C), and
NADPH oxidase complex (D) gene expression in rats with NASH at 4, 8, and 12 weeks. Values are expressed as
mean ± SEM (n = 6). *P < 0.05, **P < 0.01 for NASH vs control group. AdipoR, adiponectin receptor; SOD, superox-
ide dismutase; Gpx, glutathione peroxidase; TNFα, tumour necrosis factor α; MCP-1, monocyte chemoattractant
protein-1, gp91phox, gp91phox protein; p22phox, p22phox protein; p47phox, p47phox protein; Nox4, NADPH oxidase
9. Oxidative stress, inflammation and hepatic adiponectin receptor
480 Int J Clin Exp Pathol 2010;3(5):472-481
the enhancement of the AdipoR2 signaling path-
way in the liver may be a promising strategy for
the treatment of NASH [26]. The present model
can be applied for further studies on the pathol-
ogy, treatment, and prevention of NASH.
Acknowledgements
This study was partially supported by the Aca-
demic Frontier Project “Surveillance and control
for zoonoses” and Strategic Research Base De-
velopment Program "International research on
epidemiology of zoonoses and training for young
researchers" from Ministry of Education, Cul-
ture, Sports, Science and Technology, Japan.
Please address correspondence to: Yukita Sato, PhD,
Laboratory of Biomedical Science, Department of
Veterinary Medicine, College of Bioresource Sciences,
Nihon University, Fujisawa 252-0880, Japan. Tel and
Fax: +81-466-84-3445, E-mail: sato.yukita@nihon-
u.ac.jp
References
[1] Ludwig J, Viggiano TR, McGill DB and Oh BJ. Non-
alcoholic steatohepatitis: Mayo Clinic experi-
ences with a hitherto unnamed disease. Mayo
Clin Proc 1980;55:434-438.
[2] Ludwig J, McGill DB and Lindor KD. Review: non-
alcoholic steatohepatitis. J Gastroenterol Hepa-
tol 1997;12:398-403.
[3] Brunt EM, Janney CG, Di Bisceglie AM
Neuschwander-Tetri BA and Bacon BR. Nonalco-
holic steatohepatitis: a proposal for grading and
staging the histological lesions. Am J Gastroen-
terol 1999;94:2467-2474.
[4] Bacon BR, Farahvash MJ, Janney CGand
Neuschwander-Tetri BA. Nonalcoholic steato-
hepatitis: an expanded clinical entity. Gastroen-
terology 1994;107:1103-1109.
[5] James OF and Day CP. Non-alcoholic steato-
hepatitis (NASH): a disease of emerging identity
and importance. J Hepatol 1998;29:495-501.
[6] George J. Ascorbic acid concentrations in di-
methylnitrosamine-induced hepatic fibrosis in
rats. Clin Chim Acta 2003;335:39-47.
[7] Browning JD and Horton JD. Molecular mediators
of hepatic steatosis and liver injury. J Clin Invest
2004;114:147-152.
[8] Carmiel-Haggai M, Cederbaum AI and Nieto N. A
high-fat diet leads to the progression of non-
alcoholic fatty liver disease in obese rats. Faseb
J 2005;19:136-138.
[9] Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki
H, Uchida S, Yamashita S, Noda M, Kita S, Ueki
K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre
P, Carling D, Kimura S, Nagai R, Kahn BB and
Kadowaki T. Adiponectin stimulates glucose
utilization and fatty-acid oxidation by activating
AMP-activated protein kinase. Nat Med
2002;8:1288-1295.
[10] Berg AH, Combs TP, Du X, Brownlee M and
Scherer PE. The adipocyte-secreted protein
Acrp30 enhances hepatic insulin action. Nat
Med 2001;7:947-953.
[11] Tsao TS, Murrey HE, Hug C, Lee DH and Lodish
HF. Oligomerization state-dependent activation
of NF-kappa B signaling pathway by adipocyte
complement-related protein of 30 kDa (Acrp30).
J Biol Chem 2002;277:29359-29362.
[12] Yamauchi T, Nio Y, Maki T, Takazawa T, Iwabu M,
Okada-Iwabu M, Kawamoto S, Kubota N, Kubota
T, Ito Y, Kamon J, Tsuchida A, Kumagai K, Ko-
zono H, Hada Y, Ogata H, Tokuyama K, Tsunoda
M, Ide T, Murakami K, Awazawa M, Takamoto I,
Froguel P, Hara K, Tobe K, Nagai R, Ueki K and
Kadowaki T. Targeted disruption of AdipoR1 and
AdipoR2 causes abrogation of adiponectin bind-
ing and metabolic actions. Nat Med
2007;13:332-339.
[13] Xu A, Wang Y, Keshaw H, Xu LY, Lam KS and
Cooper GJ. The fat-derived hormone adiponectin
alleviates alcoholic and nonalcoholic fatty liver
diseases in mice. J Clin Invest 2003;112:91-
100.
[14] Tsochatzis E, Papatheodoridis GV and Archiman-
dritis AJ. The evolving role of leptin and adi-
ponectin in chronic liver diseases. Am J Gastro-
enterol 2006;101:2629-2640.
[15] Musso G, Gambino R, De Michieli F, Biroli G,
Premoli A, Pagano G, Bo S, Durazzo M and Cas-
sader M. Nitrosative stress predicts the pres-
ence and severity of nonalcoholic fatty liver at
different stages of the development of insulin
resistance and metabolic syndrome: possible
role of vitamin A intake. Am J Clin Nutr
2007;86:661-671.
[16] Kadowaki T and Yamauchi T. Adiponectin and
adiponectin receptors. Endocr Rev 2005;26:
439-451.
[17] Meister A. Glutathione deficiency produced by
inhibition of its synthesis, and its reversal; appli-
cations in research and therapy. Pharmacol Ther
1991;51:155-194.
[18] Sun Y, Oberley LW and Li Y. A simple method for
clinical assay of superoxide dismutase. Clin
Chem 1988;34:497-500.
[19] Aebi H. Catalase in vitro. Methods Enzymol
1984;105:121-126.
[20] Paglia DE and Valentine WN. Studies on the
quantitative and qualitative characterization of
erythrocyte glutathione peroxidase. J Lab Clin
Med 1967;70:158-169.
[21] Ohkawa H, Ohishi N and Yagi K. Assay for lipid
peroxides in animal tissues by thiobarbituric acid
reaction. Anal Biochem 1979;95:351-358.
[22] Schmittgen TD and Zakrajsek BA. Effect of ex-
perimental treatment on housekeeping gene
expression: validation by real-time, quantitative
RT-PCR. J Biochem Biophys Methods
2000;46:69-81.
10. Oxidative stress, inflammation and hepatic adiponectin receptor
481 Int J Clin Exp Pathol 2010;3(5):472-481
[23] Pfaffl MW. A new mathematical model for rela-
tive quantification in real-time RT-PCR. Nucleic
Acids Res 2001;29:e45.
[24] Nordberg J and Arnér ES. Reactive oxygen spe-
cies, antioxidants, and the mammalian thiore-
doxin system. Free Radic Biol Med
2001;31:1287-1312.
[25] Krieger-Brauer HI and Kather H. Human fat cells
possess a plasma membrane-bound H2O2-
generating system that is activated by insulin via
a mechanism bypassing the receptor kinase. J
Clin Invest 1992;89:1006-1013.
[26] Tomita K, Oike Y, Teratani T, Taguchi T, Noguchi
M, Suzuki T, Mizutani A, Yokoyama H, Irie R,
Sumimoto H, Takayanagi A, Miyashita K, Akao M,
Tabata M, Tamiya G, Ohkura T and Hibi T. He-
patic AdipoR2 signaling plays a protective role
against progression of nonalcoholic steatohepa-
titis in mice. Hepatology 2008;48:458-473.
[27] Proell V, Carmona-Cuenca I, Murillo MM, Huber
H, Fabregat I and Mikulits W. TGF-beta depend-
ent regulation of oxygen radicals during transdif-
ferentiation of activated hepatic stellate cells to
myofibroblastoid cells. Comp Hepatol 2007;6:1.
[28] Feldstein AE, Canbay A, Angulo P, Taniai M, Bur-
gart LJ, Lindor KD and Gores GJ. Hepatocyte
apoptosis and fas expression are prominent
features of human nonalcoholic steatohepatitis.
Gastroenterology 2003;125:437-443.