1) The document discusses various genes related to sperm motility including AKAP4, SPAG6, SPAG11, GAPDS, SMCP, and CatSper.
2) It provides information on the structure, function, expression and importance of each gene in regulating sperm motility and male fertility.
3) Mutations or deficiencies in these genes can lead to defects in sperm flagellum structure and motility resulting in male infertility.
Integrin V can form heterodimers with several subunits to mediate cell-cell and cell-extracellular matrix interactions. During zebrafish gastrulation, V is expressed maternally and zygotically. Here, we used a morpholino-mediated V knockdown strategy to study V function. Although V morphants displayed vascular defects, they also exhibited left-right body asymmetry defects affecting multiple visceral organs. This was preceded by mislocalization of dorsal forerunner cells (DFCs) and malformation of the Kupffer’s vesicle (KV) laterality organ
This study investigated how genetic variation in the serotonin transporter gene (Slc6a4) and integrin beta 3 gene (Itgb3) interact to modulate serotonin uptake and transporter expression in mouse brain synapses. The researchers prepared synaptoneurosomes (preserved pre- and post-synaptic structures) from mouse midbrain, hippocampus and cortex with different genotypes of Slc6a4 and Itgb3. They found reduced serotonin transporter expression and uptake activity in midbrain synaptoneurosomes of mice with both genes heterozygous, revealing an interaction between the two genes. In contrast, changes were driven mostly by Slc6a4 in the hippocampus. The study provides evidence that
Uncovering novel candidate genes for pyridoxine-responsive epilepsy in a cons...Golden Helix Inc
This document summarizes Hilal Al Shekaili's work on characterizing the genetic cause of pyridoxine-dependent epilepsy (PDE) in an Omani family. [1] Runs of homozygosity mapping and whole-exome sequencing identified two candidate genes involved in vitamin transport and neuropeptide processing. [2] Further studies are planned to validate the candidate genes and recruit additional families. [3] Identifying new PDE genes could improve treatment and fill knowledge gaps in pyridoxine metabolism.
Gmr2301 Breeding Transgenic Cattle For Human Therapeutics Avi Dey
Small breed cattle & pigs now can be part of small farm new product development via emerging agribio technology with recent breakthroughs in bioscience/bioengineering.
1) Researchers successfully constructed a fluorescent eukaryotic expression vector carrying the human telomerase reverse transcriptase (hTERT) gene and transfected it into human corpus cavernosum smooth muscle cells.
2) The hTERT-transfected cells showed significantly higher telomerase activity, mitotic index, and cell growth compared to non-transfected and control vector-transfected cells, while having lower apoptosis rates.
3) The hTERT-transfected smooth muscle cells did not exhibit any malignant phenotypes and remained normal diploid cells, indicating hTERT gene transfer reduced cell aging without causing tumorigenesis.
Poster - SULI Spring 2016 - Dziulko, AdamAdam Dziulko
This study investigated whether distant-acting limb enhancers besides the ZRS enhancer could activate Shh expression from ~1Mb away. CRISPR/Cas9 was used to generate mice with the ZRS replaced by three other limb enhancers: hs1109, mm1179, and hs72. hs1109 and mm1179 were able to rescue Shh expression like ZRS, but hs72 did not, resembling a ZRS knockout. However, hs72 activated Shh when placed nearby in a transgenic reporter, suggesting distance determines an enhancer's activity. Further experiments will test if surrounding tethering elements contribute to remote activity.
This document summarizes a study investigating microRNA regulatory networks in a mouse model of inherited retinal degeneration. In silico analysis predicted over 5,000 target genes for miRNAs found to be dysregulated in the mouse model. Proteomic analysis of mouse retinas identified over 1,800 proteins, with expression of over 800 proteins differing between normal and diseased retinas. 133 potential miRNA-target pairs were identified based on inverse expression patterns. The study validated interactions between miR-1 and its target Ctbp2, miR-96 and its target Slc6a9, and miR-96/182 targeting Rac1. Further analysis of the Rac1 interactome identified additional miRNAs that may target Rac1.
Integrin V can form heterodimers with several subunits to mediate cell-cell and cell-extracellular matrix interactions. During zebrafish gastrulation, V is expressed maternally and zygotically. Here, we used a morpholino-mediated V knockdown strategy to study V function. Although V morphants displayed vascular defects, they also exhibited left-right body asymmetry defects affecting multiple visceral organs. This was preceded by mislocalization of dorsal forerunner cells (DFCs) and malformation of the Kupffer’s vesicle (KV) laterality organ
This study investigated how genetic variation in the serotonin transporter gene (Slc6a4) and integrin beta 3 gene (Itgb3) interact to modulate serotonin uptake and transporter expression in mouse brain synapses. The researchers prepared synaptoneurosomes (preserved pre- and post-synaptic structures) from mouse midbrain, hippocampus and cortex with different genotypes of Slc6a4 and Itgb3. They found reduced serotonin transporter expression and uptake activity in midbrain synaptoneurosomes of mice with both genes heterozygous, revealing an interaction between the two genes. In contrast, changes were driven mostly by Slc6a4 in the hippocampus. The study provides evidence that
Uncovering novel candidate genes for pyridoxine-responsive epilepsy in a cons...Golden Helix Inc
This document summarizes Hilal Al Shekaili's work on characterizing the genetic cause of pyridoxine-dependent epilepsy (PDE) in an Omani family. [1] Runs of homozygosity mapping and whole-exome sequencing identified two candidate genes involved in vitamin transport and neuropeptide processing. [2] Further studies are planned to validate the candidate genes and recruit additional families. [3] Identifying new PDE genes could improve treatment and fill knowledge gaps in pyridoxine metabolism.
Gmr2301 Breeding Transgenic Cattle For Human Therapeutics Avi Dey
Small breed cattle & pigs now can be part of small farm new product development via emerging agribio technology with recent breakthroughs in bioscience/bioengineering.
1) Researchers successfully constructed a fluorescent eukaryotic expression vector carrying the human telomerase reverse transcriptase (hTERT) gene and transfected it into human corpus cavernosum smooth muscle cells.
2) The hTERT-transfected cells showed significantly higher telomerase activity, mitotic index, and cell growth compared to non-transfected and control vector-transfected cells, while having lower apoptosis rates.
3) The hTERT-transfected smooth muscle cells did not exhibit any malignant phenotypes and remained normal diploid cells, indicating hTERT gene transfer reduced cell aging without causing tumorigenesis.
Poster - SULI Spring 2016 - Dziulko, AdamAdam Dziulko
This study investigated whether distant-acting limb enhancers besides the ZRS enhancer could activate Shh expression from ~1Mb away. CRISPR/Cas9 was used to generate mice with the ZRS replaced by three other limb enhancers: hs1109, mm1179, and hs72. hs1109 and mm1179 were able to rescue Shh expression like ZRS, but hs72 did not, resembling a ZRS knockout. However, hs72 activated Shh when placed nearby in a transgenic reporter, suggesting distance determines an enhancer's activity. Further experiments will test if surrounding tethering elements contribute to remote activity.
This document summarizes a study investigating microRNA regulatory networks in a mouse model of inherited retinal degeneration. In silico analysis predicted over 5,000 target genes for miRNAs found to be dysregulated in the mouse model. Proteomic analysis of mouse retinas identified over 1,800 proteins, with expression of over 800 proteins differing between normal and diseased retinas. 133 potential miRNA-target pairs were identified based on inverse expression patterns. The study validated interactions between miR-1 and its target Ctbp2, miR-96 and its target Slc6a9, and miR-96/182 targeting Rac1. Further analysis of the Rac1 interactome identified additional miRNAs that may target Rac1.
This study investigated how oxidative stress activates the PI3K pathway in neurons affected by neurodegenerative diseases. The researchers found that ingestion of the oxidative stress inducer Paraquat in Drosophila larvae caused axonal transport defects and neuronal cell death. Expressing active PI3K suppressed Paraquat-mediated cell death but not axonal blocks, indicating PI3K acts downstream of transport defects. Expression of active PI3K also suppressed cell death from polyQ protein expression but did not affect associated transport defects. Dominant negative PI3K disrupted normal transport of huntingtin protein, linking PI3K directly to transport. Together, the findings suggest axonal transport defects activate the PI3K pathway to decrease oxidative stress-induced
Knockout mice are produced by disrupting genes in mice through the insertion of artificial DNA, allowing researchers to observe the effects of gene deletion and gain insight into gene function. This document discusses how knockout mice are made via embryonic stem cell manipulation and gene targeting or trapping. It provides the example of cystic fibrosis knockout mice modeling the human disease. While mice are a valuable model for human genetics, there are also limitations such as differences in phenotypes between mice and humans.
Escrt proteins in physiology and diseasesSandeep Kumar
The document summarizes the roles of ESCRT proteins in various physiological processes and diseases. It discusses how ESCRT proteins mediate multivesicular body formation and are involved in cytokinesis, HIV budding, development, signal attenuation, cancer, autophagy, and neurodegeneration. It also provides unanswered questions about ESCRT protein functions in MVBs fusing with lysosomes vs plasma membrane, their specific roles in neurodegenerative diseases, and how ESCRT mutations can be lethal in multicellular organisms but not yeast.
it contain some production techniques of transgenic animals with some examples and utility in drug development (available transgenic animals model of drug and their activity).
Applications and uses in different field
Another techniques like transposons and knock-out & knock-in discussed later
KDM5 epigenetic modifiers as a focus for drug discoveryChristopher Wynder
A summary presentation of my scientific work.
My laboratory focused on an enzyme KDM5b (aka PLU-1, JARID1b) that was widely expressed during development and played a key role in progression of breast cancer through HER-2.
My lab focused on understanding the key biochemical activity of the enzyme through dissecting the proteomic and genomic interactors.
Our results were confirmed through the use of ES cells, adult stem cells and mouse models.
Much of this work remains unpublished, please contact me for more information and/or access to any reagents that I still have as part of this work.
crwynder@gmail.com
- The document discusses neuronal cell death in Alzheimer's disease, which is linked to two protein aggregates - amyloid beta plaques and tau tangles. When amyloid beta is introduced to healthy mouse neurons in culture, it leads to rapid cell death.
- Amyloid beta treatment of the neurons increases the activity of calcium-dependent proteases (calpains) and cysteine proteases (caspases), which quickly degrade tau through cleavage into lower molecular weight fragments. This degradation of tau by proteases appears to contribute to neuronal cell death.
- The phosphorylation of tau by kinases such as GSK3 beta and CDK5 also increases after amyloid beta treatment, further implicating tau changes in the neuronal death caused by amyloid
Marker-Assisted Introgression of opaque2 and crtRB1 for Enhancement of Amino Acids and Provitamin-A in Sweet Corn.Marker-Assisted Introgression of opaque2 and crtRB1 for Enhancement of Amino Acids and Provitamin-A in Sweet Corn
1) STAT3 signaling plays a critical role in regulating astrocyte reactivity and scar formation after spinal cord injury.
2) Mice with conditional deletion of STAT3 from astrocytes showed attenuated upregulation of GFAP, failed astrocyte hypertrophy, and disrupted scar formation after injury.
3) These changes were associated with increased spread of inflammation and increased lesion size, with partially attenuated motor recovery over 28 days following injury.
The document discusses how breeding has impacted genetic diversity in maize genomes over time. It examines changes in ancestry across the maize genome and how the genome has responded to selection for increasing hybrid yield. Specifically, it finds that changing ancestry, not selection sweeps, has driven diversity loss across heterotic groups. The diversity of ancestral lines making up modern inbreds has decreased as germplasm pools have become smaller and more homogeneous. Within a single breeding program, genetic drift in small breeding populations also reduced diversity despite selection for yield.
Bioinformatic data analysis – comparison from three human studies using diffe...Agnieszka Caruso
This document summarizes three bioinformatics studies comparing gene expression data from human samples using different Affymetrix platforms: 1) comparing periodontal ligament and gingival cells, 2) identifying genes regulated by nuclear IGFBP5 in osteoblasts, and 3) effects of LPS on osteoblasts. Key findings include identification of differentially expressed genes and biological processes between tissue types in study 1, and processes related to cell cycle, proliferation and splicing regulated by IGFBP5 in study 2. Study 3 on LPS effects found upregulation of factors stimulating osteoclasts and downregulation of processes like mitosis and cell cycle. The document discusses analysis tools and validation of array results.
2013 List_The role of GH in adipose tissue-LiGHRKO miceEdward List
1) The study generated mice with the GH receptor gene specifically disrupted in adipose tissue (FaGHRKO mice) to clarify the role of GH in adipose tissue.
2) FaGHRKO mice were obese with increased total body fat and enlarged adipocytes, similar to global GHR knockout mice. However, FaGHRKO mice did not show improvements in glucose homeostasis or increased levels of resistin and adiponectin like global knockouts.
3) Specific removal of the GH receptor in adipose tissue was sufficient to increase adiposity and decrease circulating adipsin, but did not alter glucose metabolism or increase resistin or adiponectin levels. This suggests GH does not directly regulate these factors
Human beta cells express several TRP channel transcripts including TRPC1, TRPM2, TRPM3, TRPM4, TRPM7, TRPML1, TRPML3, and TRPP1. TRP channels may mediate the "background current" required for plasma membrane depolarization and insulin secretion. Further research is needed to understand the specific functions of TRP channels in human beta cells and their role in insulin secretion.
Knockout mice are genetically engineered mice that have had one or more of their genes made defective or inactivated through genetic manipulation. This allows researchers to study the effects of removing or altering the function of a gene. Some examples of knockout mice used in disease modeling include models of cancer, heart disease, and diabetes. Specifically, mice with knocked out insulin receptors in muscles, fat, and liver tissues show defects that mimic diabetes in humans. Knockout mice are a valuable tool for disease research and drug testing due to similarities between mouse and human genes.
Transgenic animals are produced by inserting foreign genes into their genomes using recombinant DNA methodology. This allows for increased growth, improved disease resistance, and other benefits. However, it can also lead to unintended effects if the inserted gene has multiple functions or causes mutations. Common methods to create transgenic animals include embryonic stem cell methods, pronuclear injection, and retrovirus-mediated gene transfer. Examples include transgenic mice, cows, fish, sheep, and monkeys.
This study aimed to validate an osteocyte-specific growth hormone receptor (GHR) knockout mouse model generated using the Cre/loxP system with Cre recombinase driven by the dentin matrix protein 1 (DMP1) promoter. The researchers found that while the DMP1-derived Cre mediated GHR knockout specifically in osteocytes as intended, GHR gene recombination was also detected in muscle tissue. They concluded that the DMP1-GHRKO mouse model is valid for studying the role of GHR in osteocytes, but the bone phenotype needs to be characterized with the knowledge that the gene recombination also occurred in muscle.
Historical Genomics of US Maize: Domestication and Modern Breedingjrossibarra
This document summarizes research on the historical genomics of maize evolution in North America. The study applied population genetic analysis to genome sequencing data from maize and teosinte lines to analyze patterns of evolution during domestication and modern breeding. They found distinct impacts of selection during these two epochs and identified candidate genes targeted during each. A separate analysis of a panel of 400 North American corn belt lines genotyped over time found decreasing genetic diversity and ancestral contributions, indicating selection shaped the genetic structure of modern maize.
Transgenesis techniques have evolved from early microinjection methods to more precise engineered nuclease approaches. Initial methods like pronuclear microinjection resulted in random integration with low efficiency. The development of embryonic stem cells and nuclear transfer enabled greater control over transgenic status but required extensive cloning. Newer tools like transposons, zinc finger nucleases, and CRISPR/Cas9 allow for stable, heritable integration at targeted genomic loci with higher efficiency and less mosaicism than early random integration methods. These advances facilitate the creation of transgenic and gene-edited animal models for agricultural and biomedical applications.
Transgenic pigs have been developed through genetic modification techniques for various applications. Pigs are useful biomedical models for human diseases due to their similar physiology to humans. Various methods can be used to introduce foreign DNA into pig zygotes, including pronuclear injection and somatic cell nuclear transfer. Transgenic pigs have been created that produce human proteins, are rich in omega-3 fatty acids, can digest phosphorus more efficiently to reduce environmental pollution, and have genes knocked out to avoid immune rejection of pig organs in xenotransplantation. Genetically modified pigs show promise for advancing medical research and treatment.
This document summarizes research on replacing the mitochondrial DNA (mtDNA) in human eggs to prevent inherited mtDNA diseases. Key points include:
- Over 700 mtDNA mutations can cause inherited diseases affecting thousands born each year in the US. Current treatments don't exist.
- Researchers developed a technique called spindle transfer to replace the entire mtDNA in an egg by transferring its nuclear DNA to a donor egg, eliminating future risk of transmission.
- Studies in monkey eggs and embryos showed very low levels of mutated mtDNA carryover and normal development. Similar success was found in human eggs and stem cell lines derived from resulting embryos.
- Ongoing clinical trials aim to use this technique to help families affected
The document summarizes the processes of spermatogenesis and oogenesis. It describes how sperm are produced in the testes through mitosis, meiosis and differentiation. Millions of sperm are produced daily starting at puberty. Oogenesis occurs in the ovaries, with one egg maturing each month through meiosis. Only one egg is produced per month from fetal development to menopause. The three hormones that regulate spermatogenesis - FSH, LH, and testosterone - are also outlined.
Gametes are haploid sex cells, either eggs or sperm, that are produced through meiosis. Gametogenesis is the process by which precursor cells undergo cell division and differentiation to form mature haploid gametes. This occurs either through meiotic division of diploid cells into gametes or mitotic division of existing haploid cells, depending on the organism's life cycle.
This study investigated how oxidative stress activates the PI3K pathway in neurons affected by neurodegenerative diseases. The researchers found that ingestion of the oxidative stress inducer Paraquat in Drosophila larvae caused axonal transport defects and neuronal cell death. Expressing active PI3K suppressed Paraquat-mediated cell death but not axonal blocks, indicating PI3K acts downstream of transport defects. Expression of active PI3K also suppressed cell death from polyQ protein expression but did not affect associated transport defects. Dominant negative PI3K disrupted normal transport of huntingtin protein, linking PI3K directly to transport. Together, the findings suggest axonal transport defects activate the PI3K pathway to decrease oxidative stress-induced
Knockout mice are produced by disrupting genes in mice through the insertion of artificial DNA, allowing researchers to observe the effects of gene deletion and gain insight into gene function. This document discusses how knockout mice are made via embryonic stem cell manipulation and gene targeting or trapping. It provides the example of cystic fibrosis knockout mice modeling the human disease. While mice are a valuable model for human genetics, there are also limitations such as differences in phenotypes between mice and humans.
Escrt proteins in physiology and diseasesSandeep Kumar
The document summarizes the roles of ESCRT proteins in various physiological processes and diseases. It discusses how ESCRT proteins mediate multivesicular body formation and are involved in cytokinesis, HIV budding, development, signal attenuation, cancer, autophagy, and neurodegeneration. It also provides unanswered questions about ESCRT protein functions in MVBs fusing with lysosomes vs plasma membrane, their specific roles in neurodegenerative diseases, and how ESCRT mutations can be lethal in multicellular organisms but not yeast.
it contain some production techniques of transgenic animals with some examples and utility in drug development (available transgenic animals model of drug and their activity).
Applications and uses in different field
Another techniques like transposons and knock-out & knock-in discussed later
KDM5 epigenetic modifiers as a focus for drug discoveryChristopher Wynder
A summary presentation of my scientific work.
My laboratory focused on an enzyme KDM5b (aka PLU-1, JARID1b) that was widely expressed during development and played a key role in progression of breast cancer through HER-2.
My lab focused on understanding the key biochemical activity of the enzyme through dissecting the proteomic and genomic interactors.
Our results were confirmed through the use of ES cells, adult stem cells and mouse models.
Much of this work remains unpublished, please contact me for more information and/or access to any reagents that I still have as part of this work.
crwynder@gmail.com
- The document discusses neuronal cell death in Alzheimer's disease, which is linked to two protein aggregates - amyloid beta plaques and tau tangles. When amyloid beta is introduced to healthy mouse neurons in culture, it leads to rapid cell death.
- Amyloid beta treatment of the neurons increases the activity of calcium-dependent proteases (calpains) and cysteine proteases (caspases), which quickly degrade tau through cleavage into lower molecular weight fragments. This degradation of tau by proteases appears to contribute to neuronal cell death.
- The phosphorylation of tau by kinases such as GSK3 beta and CDK5 also increases after amyloid beta treatment, further implicating tau changes in the neuronal death caused by amyloid
Marker-Assisted Introgression of opaque2 and crtRB1 for Enhancement of Amino Acids and Provitamin-A in Sweet Corn.Marker-Assisted Introgression of opaque2 and crtRB1 for Enhancement of Amino Acids and Provitamin-A in Sweet Corn
1) STAT3 signaling plays a critical role in regulating astrocyte reactivity and scar formation after spinal cord injury.
2) Mice with conditional deletion of STAT3 from astrocytes showed attenuated upregulation of GFAP, failed astrocyte hypertrophy, and disrupted scar formation after injury.
3) These changes were associated with increased spread of inflammation and increased lesion size, with partially attenuated motor recovery over 28 days following injury.
The document discusses how breeding has impacted genetic diversity in maize genomes over time. It examines changes in ancestry across the maize genome and how the genome has responded to selection for increasing hybrid yield. Specifically, it finds that changing ancestry, not selection sweeps, has driven diversity loss across heterotic groups. The diversity of ancestral lines making up modern inbreds has decreased as germplasm pools have become smaller and more homogeneous. Within a single breeding program, genetic drift in small breeding populations also reduced diversity despite selection for yield.
Bioinformatic data analysis – comparison from three human studies using diffe...Agnieszka Caruso
This document summarizes three bioinformatics studies comparing gene expression data from human samples using different Affymetrix platforms: 1) comparing periodontal ligament and gingival cells, 2) identifying genes regulated by nuclear IGFBP5 in osteoblasts, and 3) effects of LPS on osteoblasts. Key findings include identification of differentially expressed genes and biological processes between tissue types in study 1, and processes related to cell cycle, proliferation and splicing regulated by IGFBP5 in study 2. Study 3 on LPS effects found upregulation of factors stimulating osteoclasts and downregulation of processes like mitosis and cell cycle. The document discusses analysis tools and validation of array results.
2013 List_The role of GH in adipose tissue-LiGHRKO miceEdward List
1) The study generated mice with the GH receptor gene specifically disrupted in adipose tissue (FaGHRKO mice) to clarify the role of GH in adipose tissue.
2) FaGHRKO mice were obese with increased total body fat and enlarged adipocytes, similar to global GHR knockout mice. However, FaGHRKO mice did not show improvements in glucose homeostasis or increased levels of resistin and adiponectin like global knockouts.
3) Specific removal of the GH receptor in adipose tissue was sufficient to increase adiposity and decrease circulating adipsin, but did not alter glucose metabolism or increase resistin or adiponectin levels. This suggests GH does not directly regulate these factors
Human beta cells express several TRP channel transcripts including TRPC1, TRPM2, TRPM3, TRPM4, TRPM7, TRPML1, TRPML3, and TRPP1. TRP channels may mediate the "background current" required for plasma membrane depolarization and insulin secretion. Further research is needed to understand the specific functions of TRP channels in human beta cells and their role in insulin secretion.
Knockout mice are genetically engineered mice that have had one or more of their genes made defective or inactivated through genetic manipulation. This allows researchers to study the effects of removing or altering the function of a gene. Some examples of knockout mice used in disease modeling include models of cancer, heart disease, and diabetes. Specifically, mice with knocked out insulin receptors in muscles, fat, and liver tissues show defects that mimic diabetes in humans. Knockout mice are a valuable tool for disease research and drug testing due to similarities between mouse and human genes.
Transgenic animals are produced by inserting foreign genes into their genomes using recombinant DNA methodology. This allows for increased growth, improved disease resistance, and other benefits. However, it can also lead to unintended effects if the inserted gene has multiple functions or causes mutations. Common methods to create transgenic animals include embryonic stem cell methods, pronuclear injection, and retrovirus-mediated gene transfer. Examples include transgenic mice, cows, fish, sheep, and monkeys.
This study aimed to validate an osteocyte-specific growth hormone receptor (GHR) knockout mouse model generated using the Cre/loxP system with Cre recombinase driven by the dentin matrix protein 1 (DMP1) promoter. The researchers found that while the DMP1-derived Cre mediated GHR knockout specifically in osteocytes as intended, GHR gene recombination was also detected in muscle tissue. They concluded that the DMP1-GHRKO mouse model is valid for studying the role of GHR in osteocytes, but the bone phenotype needs to be characterized with the knowledge that the gene recombination also occurred in muscle.
Historical Genomics of US Maize: Domestication and Modern Breedingjrossibarra
This document summarizes research on the historical genomics of maize evolution in North America. The study applied population genetic analysis to genome sequencing data from maize and teosinte lines to analyze patterns of evolution during domestication and modern breeding. They found distinct impacts of selection during these two epochs and identified candidate genes targeted during each. A separate analysis of a panel of 400 North American corn belt lines genotyped over time found decreasing genetic diversity and ancestral contributions, indicating selection shaped the genetic structure of modern maize.
Transgenesis techniques have evolved from early microinjection methods to more precise engineered nuclease approaches. Initial methods like pronuclear microinjection resulted in random integration with low efficiency. The development of embryonic stem cells and nuclear transfer enabled greater control over transgenic status but required extensive cloning. Newer tools like transposons, zinc finger nucleases, and CRISPR/Cas9 allow for stable, heritable integration at targeted genomic loci with higher efficiency and less mosaicism than early random integration methods. These advances facilitate the creation of transgenic and gene-edited animal models for agricultural and biomedical applications.
Transgenic pigs have been developed through genetic modification techniques for various applications. Pigs are useful biomedical models for human diseases due to their similar physiology to humans. Various methods can be used to introduce foreign DNA into pig zygotes, including pronuclear injection and somatic cell nuclear transfer. Transgenic pigs have been created that produce human proteins, are rich in omega-3 fatty acids, can digest phosphorus more efficiently to reduce environmental pollution, and have genes knocked out to avoid immune rejection of pig organs in xenotransplantation. Genetically modified pigs show promise for advancing medical research and treatment.
This document summarizes research on replacing the mitochondrial DNA (mtDNA) in human eggs to prevent inherited mtDNA diseases. Key points include:
- Over 700 mtDNA mutations can cause inherited diseases affecting thousands born each year in the US. Current treatments don't exist.
- Researchers developed a technique called spindle transfer to replace the entire mtDNA in an egg by transferring its nuclear DNA to a donor egg, eliminating future risk of transmission.
- Studies in monkey eggs and embryos showed very low levels of mutated mtDNA carryover and normal development. Similar success was found in human eggs and stem cell lines derived from resulting embryos.
- Ongoing clinical trials aim to use this technique to help families affected
The document summarizes the processes of spermatogenesis and oogenesis. It describes how sperm are produced in the testes through mitosis, meiosis and differentiation. Millions of sperm are produced daily starting at puberty. Oogenesis occurs in the ovaries, with one egg maturing each month through meiosis. Only one egg is produced per month from fetal development to menopause. The three hormones that regulate spermatogenesis - FSH, LH, and testosterone - are also outlined.
Gametes are haploid sex cells, either eggs or sperm, that are produced through meiosis. Gametogenesis is the process by which precursor cells undergo cell division and differentiation to form mature haploid gametes. This occurs either through meiotic division of diploid cells into gametes or mitotic division of existing haploid cells, depending on the organism's life cycle.
Spermatogenesis is the process by which male gametes, or sperm, are created. It occurs within the seminiferous tubules of the testis. Spermatogonia undergo two divisions via meiosis to become haploid spermatids from a single diploid spermatogonium. Sertoli cells within the seminiferous tubules support and provide nutrients to the various sperm precursors as they develop and differentiate into mature sperm cells.
The document discusses sperm DNA fragmentation, including its causes, types of DNA damage, effects on reproductive outcomes, diagnostic tests, and guidelines for clinical practice. Some of the key points covered include that sperm chromatin is highly compacted to fit in a small volume, leaving DNA vulnerable to damage; intrinsic factors like improper packaging and oxidative stress or extrinsic factors like smoking can cause DNA breaks; double stranded breaks are more serious than single breaks; and while tests exist, there is debate around their predictive power for outcomes like spontaneous pregnancy.
The document discusses male reproductive anatomy and physiology. It describes the role of structures like the testes, epididymis, vas deferens, seminal vesicles, ejaculatory duct, and prostate in sperm production and ejaculation. It explains spermatogenesis, the process by which sperm develop and mature in the testes and epididymis. A semen analysis is described as the gold standard test for evaluating semen volume, sperm count, morphology, and motility to assess male fertility.
The document discusses the female menstrual cycle. It begins with menstruation which lasts 5-7 days and signals the start of a new cycle. It then explains how hormones like FSH and LH cause an egg to mature and be released from the ovaries (ovulation) around day 14. If the egg is not fertilized, progesterone and estrogen levels fall, causing the uterine lining to shed through menstruation and restarting the cycle. The entire process repeats roughly every 28 days and is controlled by the hypothalamus, pituitary gland, ovaries and uterus.
Spermatogenesis and oogenesis are the processes by which gametes (sperm and eggs) are produced in the male and female reproductive systems. Spermatogenesis occurs in the seminiferous tubules of the testes and involves the production of sperm through meiosis and differentiation. Oogenesis begins during embryonic development with the formation of oocytes, and involves meiosis, follicular growth, and ovulation of a secondary oocyte from the ovaries each menstrual cycle. Fertilization occurs when a sperm fuses with an egg in the fallopian tubes, forming a zygote.
Oogenesis is the process by which eggs, or ova, are formed in the ovaries. It occurs in 5 stages:
1) Germinal epithelial cells divide to form oogonia, which develop into primary oocytes surrounded by follicle cells.
2) The primary oocytes undergo the first meiotic division to become secondary oocytes and first polar bodies.
3) The follicle cells surrounding the primary follicle develop into the secondary follicle, with its layer thickening and folding to form the Graafian follicle.
4) Mature Graafian follicles rupture and release secondary oocytes, which complete meiosis II if fertilized by sperm.
The document summarizes key differences between spermatogenesis and oogenesis. Spermatogenesis produces four small equal gametes from each primary spermatocyte, while oogenesis produces one large gamete and polar bodies from each primary oocyte. The ovum stores nutrients and cytoplasmic information important for development, undergoing growth and yolk deposition during the vitellogenic phase prior to ovulation.
This document summarizes the process of spermatogenesis and sperm development. It describes how sperm develop from immature forms through spermatogenesis and spermiogenesis in the testes, with support from Leydig and Sertoli cells. The document also outlines characteristics of mature semen and various factors that can influence sperm development, including hormones, temperature, diet, and environmental exposures.
Gametogenesis is the process by which haploid gametes are formed from diploid germ cells through meiosis. It occurs in the gonads (ovaries in females and testes in males) and results in the production of eggs in females through oogenesis and sperm in males through spermatogenesis. Both processes involve germ cells undergoing cell division and differentiation through meiosis to form mature haploid gametes - eggs in females and sperm in males - that can fuse during fertilization to form a new diploid organism.
Gametogenesis is the process by which germ cells undergo meiosis to form gametes. Spermatogonia and oogonia are the germ cells that develop into sperm or eggs. Meiosis involves two divisions that reduce the number of chromosomes by half to form haploid gametes. In males, meiosis produces four sperm cells, while in females it produces one egg and three polar bodies. The timing of meiosis differs between males and females. In males, spermatogenesis occurs continuously from puberty, while in females the first meiotic division starts before birth but is completed just before ovulation. Eggs are protected by elaborate envelopes that develop after fertilization to safeguard the developing embryo.
El proceso de gametogénesis produce células sexuales haploides llamadas gametos a través de la meiosis en los ovarios y testículos. En los hombres, la espermatogénesis dura aproximadamente 74 días y produce espermatozoides a partir de espermatogonias. En las mujeres, la ovogénesis comienza en el útero fetal y produce óvulos a partir de ovogonios en los folículos ováricos.
unreduced gamete formation and its role in plant breeding Anilkumar C
This document discusses unreduced gamete formation and its role in plant breeding. It begins with an introduction and overview of unreduced gametes, also called 2n gametes, which have the same chromosome number as the parent plant. It then covers sources and mechanisms of 2n gamete formation, including interspecific hybrids, meiotic mutants, and odd polyploids. The mechanisms of 2n gamete formation through mitosis and various types of meiotic restitution are explained. Detection methods and factors that influence 2n gamete frequency are outlined. The role of 2n gametes in plant breeding applications such as ploidy level manipulation, inter-genomic recombination, and development of new crop varieties is then
Spermatogenesis and oogenesis both use meiosis to produce gametes. Spermatogenesis occurs in the testes and results in 4 haploid sperm from one diploid germ cell. Oogenesis occurs in the ovaries and results in one haploid egg and 3 polar bodies from the original diploid oocyte. Both processes arrest at different stages of meiosis until fertilization.
Proses pembentukan sel kelamin jantan (spermatozoa) dari sel punca di testis yang disebut spermatogenesis. Dipengaruhi oleh hormon FSH dan LH serta testosteron, memerlukan waktu 65-75 hari hingga terbentuk sperma fungsional yang akan diejakulasi melalui jalur epididimis, vas deferens, dan uretra.
Understanding of Models use for biomedical research who have similar physiological function like humans ,and the how to generate and which models are useful
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Wani Ahad
The Bakerwal breed of goat in Kashmir valley is a good meat purpose breed of goat. That attains
an appreciable body weight under a low input production system. As these goats are mainly
reared by Gujjar and Bakarwal tribes of the J & K state, so they usually are fed with the weeds,
herbs, shrubs and grasses of pastures that will otherwise go waste. These goats constitute the
main livestock wealth. With the good productive and reproductive potential, it makes these animals
an important animal protein source for developing countries like India. The myostatin gene
(GDF8) is important in the physiology of stock animals because its product produces a direct effect
on muscle development and consequently also on meat production. The myostatin sequence is
known in several mammalian species and shows a high degree of amino acid sequence conservation,
although several alterations in the intron and exon regions have been identified. The objective
of our work is to characterize the myostatin coding regions using gene sequencing and polymerase
chain reaction methods of Capra hircus (Bakerwal breed) and to compare them with the
Ovis aries and other livestock species of animal, looking for variations in nucleotide and protein
sequences. As mutations in the myostatin gene can inactivate its expression and result in a
non-functional protein, which leads to increase in muscle growth in many species. In this way, we are able to identify 3 alterations on the presumed myostatin protein sequence as compared to non
double-muscled ovine sequences.
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Wani Ahad
The Bakerwal breed of goat in Kashmir valley is a good meat purpose breed of goat. That attains
an appreciable body weight under a low input production system. As these goats are mainly
reared by Gujjar and Bakarwal tribes of the J & K state, so they usually are fed with the weeds,
herbs, shrubs and grasses of pastures that will otherwise go waste. These goats constitute the
main livestock wealth. With the good productive and reproductive potential, it makes these animals
an important animal protein source for developing countries like India. The myostatin gene
(GDF8) is important in the physiology of stock animals because its product produces a direct effect
on muscle development and consequently also on meat production. The myostatin sequence is
known in several mammalian species and shows a high degree of amino acid sequence conservation,
although several alterations in the intron and exon regions have been identified. The objective
of our work is to characterize the myostatin coding regions using gene sequencing and polymerase
chain reaction methods of Capra hircus (Bakerwal breed) and to compare them with the
Ovis aries and other livestock species of animal, looking for variations in nucleotide and protein
sequences. As mutations in the myostatin gene can inactivate its expression and result in a
non-functional protein, which leads to increase in muscle growth in many species. In this way, weare able to identify 3 alterations on the presumed myostatin protein sequence as compared to non
double-muscled ovine sequences.
This summary provides the key points from the document in 3 sentences:
The document describes 3 studies that analyzed gene expression and behaviors related to puberty and reproduction in cattle. The first study used RNA sequencing to identify gene expression changes in the pituitary gland between pre-pubertal and post-pubertal beef heifers. The second study found that supplementing niacin to dairy cows before calving increased colostral immunoglobulin G levels. The third study observed changes in populations of immune cells in the mammary tissue of developing dairy heifers in relation to age, ovariectomy and estrogen treatment.
The study cloned and analyzed the GJB6 gene, which encodes the connexin 30 protein, from 16 bat species and 4 other mammals. Analysis showed purifying selection on GJB6 in mammals generally, maintaining its important role in hearing. One amino acid substitution was unique to bats, and 10 were shared among artiodactyls. The cytoplasmic loop and carboxy terminus were more variable than other domains in all mammals. The results demonstrate evolutionary conservation of GJB6 in mammals but also lineage-specific rapid evolution in some domains.
1) The study analyzed the effects of Csk knockouts on development of the initial segment of the mouse epididymis. Csk knockout was expected to promote cell proliferation and differentiation through increased ERK pathway activity due to lack of inhibition of SRC kinases.
2) A tissue-specific Csk conditional knockout mouse model was generated using Cre/lox recombination. Genotyping identified one mouse with the desired genotype.
3) Preliminary results found increased vasculogenesis in the initial segment of Csk knockout mice, suggesting effects on differentiation through the ERK pathway. Immunofluorescence found decreased activity of phospho-SRC in knockouts while other markers were similar to controls.
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black CattleBoon Keat Ngan
1. CRISPR/Cas9 was used to repair a mutation in the IARS gene that causes growth retardation and death in Japanese Black cattle calves.
2. The mutation site was targeted using a sgRNA and Cas9 nuclease, and a donor DNA template was used to introduce the correct sequence.
3. Analysis of genome-edited fibroblast cell lines showed that the IARS mutation was precisely repaired without additional DNA changes.
Transgenic pigs have been developed through inserting foreign DNA into pig genomes using various techniques. Pigs are useful biomedical models because their physiology is similar to humans. Transgenic pigs have been created for various purposes, such as producing human proteins in their milk or blood, modeling human diseases, producing organs for xenotransplantation, and reducing phosphorus pollution through modified digestion of phytates. Genetic engineering of pigs continues to be studied for applications in biomedicine and agriculture.
Discriminating Facts from Artefacts in the Secreted Ly-6 Protein FamilyChris Southan
The document discusses several issues related to accurately characterizing the secreted Ly-6 protein family based on bioinformatic analysis. It describes the discovery of novel rat Ly-6 proteins from urine samples and EST data, but also finds chimeric mRNA sequences that combined portions of unrelated genes with Ly-6 sequences, complicating the analysis. Genome mapping showed the chimeras did not represent real gene fusions but likely arose from artifacts. While many rat and mouse homologs were identified, clear orthologs between species were difficult to determine due to high sequence divergence over time.
This study explores the wing phenotypes of crosses between male Drosophila melanogaster expressing RNAi targeting specific genes (RNAi driver lines) and female leon mutant flies. Various phenotypes were observed in the offspring wings, including rescue, deterioration, and distortion of wing veins and structures. A correlation between the wing phenotypes and physiological/metabolic functions of the targeted genes was found. Many of the genes are expressed in tissues like the brain, heart, and reproductive organs. The results provide insight into how knocking down gene expression can affect wing development and the roles of the genes studied.
This document describes the identification and characterization of a novel G protein-coupled receptor (GPCR) termed R527 that is highly expressed on human eosinophils and neutrophils. R527 was found to bind the eicosanoid 5-oxo-6E,8Z,11Z,14Z-eicosatetraenoic acid (5-oxo-ETE) and mediate its inflammatory effects. Stable cell lines expressing R527 were used to screen ligands and identified 5-oxo-ETE as an agonist. R527 showed pharmacological properties similar to the previously described 5-oxo-ETE receptor on immune cells. The identification of R527 provides insight into the physiological role
Combined Loss of the GATA4 and GATA6 Transcription Factors in Male Mice Disru...Heather Hatch
Combined deletion of GATA4 and GATA6 in male mice using Sf1Cre results in disrupted testicular development and confers adrenal-like function in the postnatal testes. In embryonic Sf1Cre; Gata4flox/floxGata6flox/flox testes, DMRT1 expression is absent in Sertoli cells and testes are smaller with fewer germ cells. Postnatally, steroidogenic gene expression changes from a testicular to adrenal-like pattern, and adrenal cell markers are strongly upregulated in the testes. This suggests a loss of normal testicular steroidogenic function accompanied by expansion of an adrenal-like cell population in the mutant
This document describes a study that investigated the seminal plasma proteome of Holstein bulls with low and high sperm freezability. Label-free mass spectrometry identified 1,445 seminal plasma proteins. There were 338 proteins differentially expressed between bulls with low and high freezability. Specific proteins were identified as markers of each phenotype, with BSP5 and seminal ribonuclease associated with high freezability and spermadhesin-1, gelsolin, and peroxiredoxin-5 associated with low freezability. Regression models found sperm freezability scores were related to levels of peroxiredoxin-5, spermadhesin-1, and their interaction. This research provides insights
This document describes a study that developed a cost-effective screening test for detecting microdeletions on the Y chromosome associated with male infertility.
The researchers established a preliminary diagnostic screening test using a set of six primer pairs ("set-of-six") that could detect up to 95% of published Y microdeletion cases. They tested this set-of-six on 114 infertile men and found 10 microdeletions (8.8%), demonstrating the set-of-six could reliably identify microdeletions. Testing another 34 patients with just the set-of-six again found 3 microdeletions (8.8%). Their results were similar to literature frequencies, showing the set-of-six provides
Comparative analysis of gene regulation in mouse rat and humanconstantina mylona
Which is the most suitable model mouse or rat even in the use of the latest gene editing tool-CRISPR/Cas 9 ?
Final Project presentaion on BSc Human Biology
1) The study investigates how localized protein translation in axons regulates presynaptic development at synapses.
2) The researchers developed a method to selectively repress cap-dependent translation in axons using a targeted translational repressor.
3) They found that repressing axonal translation enlarged synaptic vesicle recycling pools, and this effect was partly due to decreased levels of p35, a protein involved in regulating vesicle recycling pools. Local translation of p35 mRNA in axons normally helps regulate vesicle recycling.
Background: Diarrhoeal disease remains a major cause of child morbidity, growth faltering and mortality in low and middle income countries (LMICs), with Campylobacter among the most common causes. Previous work has identified source reservoirs in developed countries (e.g. contaminated poultry or unpasteurised milk), however little is known about the risk factors and transmission routes in LMICs, where incidence is extremely high (up to 85% of children infected before 1yr). Risk factors such as household crowding, poor sanitation, consumption of contaminated water and cohabitation with animals, all constitute potential transmission risks but their relative importance is unknown.
Methods: We compare core and accessory genome content within and between infection and source populations by host and region. Signatures of adaptation can be detected in Campylobacter jejuni and C. coli genomes as they recombine and adapt quickly to new hosts. Using sequence data from human clinical isolates and potential source reservoirs we are able to probabilistically attribute sources of infection and model complex transmission networks. Comparative genomics techniques are used to characterise core and accessory genome content within populations and bacterial genome-wide association studies (GWAS) are used to identify disease-severity associated genes and genetic elements.
Results: Pilot genomics studies of isolates from humans, animals and food in LMICs have identified genomic variation in strains that may indicate differences in source, survival, transmission or virulence (compared to the UK). Dissemination of homologous accessory genes across Campylobacter lineages in Egypt suggest recent acquisition and spread between hosts. Disease-severity associated genetic elements are identified through a GWAS of isolates from symptomatic and asymptomatic children in the Peruvian Amazon. We also identify novel lineages in isolates from Burkina Faso and high levels of antimicrobial resistance in isolates from Vietnam.
Conclusions: Using a global outlook, we have identified differences in the core and accessory genomes of Campylobacter populations that may explain some of the differences we observe in the global epidemiology of campylobacteriosis. As we begin to understand the relationship between the infecting isolate and disease severity, we are able to model transmission networks for appropriate intervention strategies.
This document summarizes a student research project that aims to determine the subcellular localization of the Arabidopsis thaliana p80 protein (Atp80) by expressing a GFP-tagged version of it in human HeLa cells. Atp80 shows sequence similarity to the human p80 protein, which localizes to endosomal vesicle membranes. The student will transfect HeLa cells with constructs expressing GFP-tagged Atp80 and various organelle markers. Using fluorescence microscopy, they will compare the localization of Atp80-GFP to the markers to determine if Atp80 localizes to endosomes, which would support the hypothesis that it is homologous to human p80. The student requests a budget of $350.11
Similar to Genomic insight of__sperm_motility (20)
TEST BANK For An Introduction to Brain and Behavior, 7th Edition by Bryan Kol...rightmanforbloodline
TEST BANK For An Introduction to Brain and Behavior, 7th Edition by Bryan Kolb, Ian Q. Whishaw, Verified Chapters 1 - 16, Complete Newest Versio
TEST BANK For An Introduction to Brain and Behavior, 7th Edition by Bryan Kolb, Ian Q. Whishaw, Verified Chapters 1 - 16, Complete Newest Version
TEST BANK For An Introduction to Brain and Behavior, 7th Edition by Bryan Kolb, Ian Q. Whishaw, Verified Chapters 1 - 16, Complete Newest Version
Rasamanikya is a excellent preparation in the field of Rasashastra, it is used in various Kushtha Roga, Shwasa, Vicharchika, Bhagandara, Vatarakta, and Phiranga Roga. In this article Preparation& Comparative analytical profile for both Formulationon i.e Rasamanikya prepared by Kushmanda swarasa & Churnodhaka Shodita Haratala. The study aims to provide insights into the comparative efficacy and analytical aspects of these formulations for enhanced therapeutic outcomes.
Histololgy of Female Reproductive System.pptxAyeshaZaid1
Dive into an in-depth exploration of the histological structure of female reproductive system with this comprehensive lecture. Presented by Dr. Ayesha Irfan, Assistant Professor of Anatomy, this presentation covers the Gross anatomy and functional histology of the female reproductive organs. Ideal for students, educators, and anyone interested in medical science, this lecture provides clear explanations, detailed diagrams, and valuable insights into female reproductive system. Enhance your knowledge and understanding of this essential aspect of human biology.
TEST BANK For Basic and Clinical Pharmacology, 14th Edition by Bertram G. Kat...rightmanforbloodline
TEST BANK For Basic and Clinical Pharmacology, 14th Edition by Bertram G. Katzung, Verified Chapters 1 - 66, Complete Newest Version.
TEST BANK For Basic and Clinical Pharmacology, 14th Edition by Bertram G. Katzung, Verified Chapters 1 - 66, Complete Newest Version.
TEST BANK For Basic and Clinical Pharmacology, 14th Edition by Bertram G. Katzung, Verified Chapters 1 - 66, Complete Newest Version.
TEST BANK For Basic and Clinical Pharmacology, 14th Edition by Bertram G. Katzung, Verified Chapters 1 - 66, Complete Newest Version.
These lecture slides, by Dr Sidra Arshad, offer a quick overview of the physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar lead (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
6. Describe the flow of current around the heart during the cardiac cycle
7. Discuss the placement and polarity of the leads of electrocardiograph
8. Describe the normal electrocardiograms recorded from the limb leads and explain the physiological basis of the different records that are obtained
9. Define mean electrical vector (axis) of the heart and give the normal range
10. Define the mean QRS vector
11. Describe the axes of leads (hexagonal reference system)
12. Comprehend the vectorial analysis of the normal ECG
13. Determine the mean electrical axis of the ventricular QRS and appreciate the mean axis deviation
14. Explain the concepts of current of injury, J point, and their significance
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. Chapter 3, Cardiology Explained, https://www.ncbi.nlm.nih.gov/books/NBK2214/
7. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
Integrating Ayurveda into Parkinson’s Management: A Holistic ApproachAyurveda ForAll
Explore the benefits of combining Ayurveda with conventional Parkinson's treatments. Learn how a holistic approach can manage symptoms, enhance well-being, and balance body energies. Discover the steps to safely integrate Ayurvedic practices into your Parkinson’s care plan, including expert guidance on diet, herbal remedies, and lifestyle modifications.
Osteoporosis - Definition , Evaluation and Management .pdfJim Jacob Roy
Osteoporosis is an increasing cause of morbidity among the elderly.
In this document , a brief outline of osteoporosis is given , including the risk factors of osteoporosis fractures , the indications for testing bone mineral density and the management of osteoporosis
Cell Therapy Expansion and Challenges in Autoimmune DiseaseHealth Advances
There is increasing confidence that cell therapies will soon play a role in the treatment of autoimmune disorders, but the extent of this impact remains to be seen. Early readouts on autologous CAR-Ts in lupus are encouraging, but manufacturing and cost limitations are likely to restrict access to highly refractory patients. Allogeneic CAR-Ts have the potential to broaden access to earlier lines of treatment due to their inherent cost benefits, however they will need to demonstrate comparable or improved efficacy to established modalities.
In addition to infrastructure and capacity constraints, CAR-Ts face a very different risk-benefit dynamic in autoimmune compared to oncology, highlighting the need for tolerable therapies with low adverse event risk. CAR-NK and Treg-based therapies are also being developed in certain autoimmune disorders and may demonstrate favorable safety profiles. Several novel non-cell therapies such as bispecific antibodies, nanobodies, and RNAi drugs, may also offer future alternative competitive solutions with variable value propositions.
Widespread adoption of cell therapies will not only require strong efficacy and safety data, but also adapted pricing and access strategies. At oncology-based price points, CAR-Ts are unlikely to achieve broad market access in autoimmune disorders, with eligible patient populations that are potentially orders of magnitude greater than the number of currently addressable cancer patients. Developers have made strides towards reducing cell therapy COGS while improving manufacturing efficiency, but payors will inevitably restrict access until more sustainable pricing is achieved.
Despite these headwinds, industry leaders and investors remain confident that cell therapies are poised to address significant unmet need in patients suffering from autoimmune disorders. However, the extent of this impact on the treatment landscape remains to be seen, as the industry rapidly approaches an inflection point.
Here is the updated list of Top Best Ayurvedic medicine for Gas and Indigestion and those are Gas-O-Go Syp for Dyspepsia | Lavizyme Syrup for Acidity | Yumzyme Hepatoprotective Capsules etc
1. Genomic insight of sperm motility
Subodh Kumar
Senior Scientist
Division of Animal Genetics
Indian Veterinary Research Institute
Izatnagar (Bareilly) UP
1st
Feb 2013
2. Introduction
May 12, 2014
2003 2007
Cattle 185.181 199.075
Buffalo 97.922 105.343
Total
Bovine 283.446 304.765BAHS, 2010
Livestock Population in Million
5. Milk Production (MT)
BAHS, 2010
% of Cattle contribution
CB
46.98
IND
53.02
IND
81
CB
19
Indigenous Cross Bred
Population (Million) 52.13 12.5
Milk production (MT) 25.357 22.468
Crossbred Contribution
% of Milch cattle Population
May 12, 2014
6. Quality of crossbred semen as compared to exotic and zebu
counterparts in the same environment
Parameter B.
indicus
B.
taurus
B.Indicus x
B. taurus
References
Initial motility(%) 61.00 59.00
79.41
82.19
51.00
67.49
68.13
Singh and Pangawkar (1990)
Shrivastava and Kumar (2006)
Chacon et al.,(1999)
Head + mid piece
Abnormalities (%)
9.4% 15.1 19.0 Chacon et al.,(1999)
Tail Abnormalities +
cytoplasmic droplets(%)
14.0 13.7 18.0
Bull disqualifying rate(%) 54
48
Tyagi et al., (2006)
Chacon et al.,1999
Mass activity 4.00 3.06 Shrivastava and Kumar (2006)
SPD-CMPT (mm) 45.06 39.94
HOST(%) 49.38 42.06
Post Thaw Motility (%) 40.31 28.13 May 12, 2014
7. ∗ Higher diseases incidence
∗ Requires intense managemental conditions
∗ Non-availability of superior crossbred germ plasms
(Mathew et al., 1982)
∗ Poor quality semen
(Rao and Rao, 1991)
∗ Poor freezability of semen and cryo-injuries
(Ghosh et al., 2007)
∗ Poor motility and viability of sperms
(Dhanju et al., 2006)
∗ High percentage of dead and abnormal sperms
(Ghosh et al., 2007)
Problems in crossbreds
May 12, 2014
8. Introduction
Sperm motility - a complex process
Parameters of semen quality
Root cause of asthenzoospermia –
poorly understood
Understanding of genetic mechanism
Most knowledge based on human and
laboratory animals
Sperm motility genes are highly conserved
10. Freshly ejaculated sperm
Flagellum generates a symmetrical lower
amplitude wave
Move in a straight line in non viscous
media - seminal plasma or semen
extender
Activated motility
11. Hyperactivated motility
Present in sperm after reaching Oviduct of
female reproductive tract
Flagellar beats asymmetric and of higher
amplitude
Move in circular or figure 8 trajectory
Helps to penetrate egg vestment
Seen in association with onset of
capacitation but are not dependent on each
other
14. Encodes a member of the AKAP family.
Alternative splicing of this gene results in two transcript
variants encoding different isoforms.
Nearly half of the protein in fibrous sheaths isolated
from mouse sperm is AKAP4.
This protein and two others, AKAP3 and AKAP-80, have
anchoring sites for cAMP-dependent protein kinase and
helps the cAMP/PKA signaling pathway
Targeted disruption- causes defects in sperm flagellum
and motility.
AKAP4 (A Kinase Anchor Protein 4)
15. Map Location
Human Xp11.2
Mouse:XA1.6
Start : 49,842,146 bp
End : 49,852,404 bp
Size : 10,259 bases
ORF : 2565bp
Exons : 6
Translation : 854 amino acid
AKAP4 – Map location in Human
20. SPAG6 (Sperm Associated Antigen6)
Encodes an axonemal protein containing eight armadillo repeats
Expressed in Male reproductive tissues particularly Epididymis
and Testis tissues
SPAG6-deficient males were infertile.
motility defects,
morphologically abnormal (loss of the sperm head)
disorganization of flagellar structures,
Important for the maintenance of the axonemal central
apparatus and structural integrity of mature sperm.
Essential for sperm flagellar motility
25. Encodes androgen-dependent, epididymis -specific
secretory proteins. The specific functions not been
determined.
Single gene derived from two ancestrally independent
β-defensin genes joined by read-through transcription
Some isoforms contain regions similar to beta-
defensins.
Rat epididymal cells or human colonic epithelial cells
transfected with rat SPAG11 could induce sperm
motility in immotile immature sperm. ( Zhou et al.
2004)
Important for the acquisition of sperm motility and the
initiation of sperm maturation.
SPAG 11 (Sperm Associated Antigen 11)
26. SPAG11- gene summary
Start : 7,292,686 bp from pter
End : 7,308,602 bp from pter
Size : 15,917 bases
Exons : 8
ORF : 327 nt
Translation : 108 aa
Map location
Human : 8p23.1
Cattle : 27q1.2
Mouse : 8A1.1
27. Genomic organization of SPAG11
P1
A A A
98 153 151 107 76 259 104 279
PROMOTER
3’UTR
A- Poly adenylation sites
5’ UTR
INTRONS
EXONS
I II III IV V VI VII VIII
29. Encodes a protein belongs to GAPDS family of enzymes
that play an important role in carbohydrate metabolism.
Functions in a NAD-dependent manner to remove hydrogen
and add phosphate to glyceraldehyde 3-phosphate to form
1,3-diphosphoglycerate.
During spermiogenesis, play an important role in regulating
the switch between different energy-producing pathways,
and it is required for sperm motility and male fertility
GAPDS (Glyceraldehyde 3, phosphate Dehydrogenase
Sperm specific
30. GAPDS gene summary
Start : 40,716,154 bp from pter
End : 40,728,061 bp from pter
Size : 11,908 bases
Exons : 11
ORF : 1227 nt
Translation : 408 amino acid
MAP LOCATION
Human : 19q13.1
Mouse : 7B1
Cattle : 18
31. Organization of GAPDS
I II VIII IXIII IV V VI VII X XI
67 178 97 107 91 119 82 152 163 98 73
5’UTR 3’UTR
EXONS (1227 bp)
INTRONS
32. Orthologs for GAPDS gene
Organism
Human
Similarity
Dog
(Canis familiaris)
84.49(n)
86.07(a)
Chimpanzee
(Pan troglodytes)
99.18(n)
98.77(a)
Cow
(Bos taurus)
85.57(n)
86.84(a)
Rat
(Rattus norvegicus)
79.49(n)
83.33(a)
Mouse
(Mus musculus)
79.41(n)
82.6(a)
34. GAPDS Protein
68% identical with somatic cell GAPD.
GAPDs has a 72-amino acid proline-rich segment at the amino terminal
end that is not present in somatic cell GAPD.
Exists in sperms as the tetrameric molecule bound to the fibrous sheath of
the flagellum
Cysteine residues (C21, C94, and C150) are specific for the sperm
isoenzyme
Residue C21 involved in the formation of the disulfide bond between the
N-terminal domain of GAPDs and fibrous sheath proteins.
Localised in the principal piece of the flagellum
35. Encoded protein localised in Cytoplasm,
Mitochondrion membrane.
Becomes associated with the mitochondrial outer
membranes at spermatogenesis
Function:
Organization and stabilization of the helical structure
of the sperm & mitochondrial sheath
Absence is associated with male infertility,
Reduced sperm motility in female reproductive tract
Inability to penetrate the oocyte zona pellucida
SMCP (Mitochondria Associated Cystein Sperm
rich Protein)
36. SMCP Gene summary
MAP LOCATION
Human : 1q21
Mouse : 3F1
Cattle : 3
Start : 151,117,422 bp from pter
End : 151,124,147 bp from pter
Size : 6,726 bases
Exon : One
ORF : 351 bp length
Translation : 116 amino acid
37. SMCP
The 5’ & 3’ UTR are more conserved (71%) than the coding
sequences (59%).
The open reading frame encodes a 116-amino acid protein and lacks
the UGA codons.
The MCSP gene in human, baboon, and bovine is more conserved
than its counterparts in mouse and rat.
Expression is restricted to haploid spermatids in humans (Aho et al.
1996).
The 5’ UTR of mouse, rat, and human SMCP also has a predicted
stem loop that is involved in regulation of SMCP expression.
(Hawthorne et al. 2006).
39. Discovery of a New Protein/Gene
• A new ion channel protein discovered (Clapham 2001).
• This was found to be expressed in testis (Ren et al., 2001).
• Expressed on the principal piece of sperm tail.
• Normal sperm (having this protein) showed faster progressive
movements.
• Those lacking it (gene disrupted), swim with 1/3rd
speed and move
more randomly.
(Clapham and Garbers, 2005)
40. More about the New Protein/Gene
• Mutants were 100% ineffective at impregnating females though they
displayed normal mating behavior.
• CASA = mutant sperm’s main motility parameters of path velocity,
progressive velocity and track speed were impaired significantly.
• Most notable, mutant sperm lacked the vigourous beating and bending
of the tail region.
• Thus disrupting this gene resulted in marked reduction in sperm motility
(Clapham and Garbers,
2005)
41. This gene/protein was called as
(Cation channel of Sperm)
CatSper is an Voltage gated Calcium selective ion channel
protein that plays a central role in sperm motility.
This newly discovered protein ‘controls flow of Calcium ions in to tail of
sperm’ which cause fibre like contractile proteins (motor proteins) to
produce forceful lashings of sperm tail.
42. Other researches on CatSper
• In human, subfertile men with defficient sperm cell motility had
significantly reduced (3.5 times) expression of CatSper (Nikpoor et al.,
2004).
• Sperm with Null CatSper (CatSper -/-
) were not able ascend the oviduct
whereas sperm from heterozygote (CatSper +/-
) were able to (Suarez et
al., 2005).
• Tiny electric currents generated by Ca+2
moving into sperm have also
been recorded which were called as CatSper dependent current (iCatSper
)
and shown to be an alkaline potentiated, voltage activated, calcium
selective channel (Kirichok et al., 2006).
• CatSper are highly specialized flageller protein and could be expressed
in HEK 293 cell line (Quill et al., 2007).
43. CatSper Characterization
• The mouse CatSper gene is predicated to have a primary
structures of 686 amino acids with six putative transmembrane
domains (S1-S6) and the pore region (P) which exists between
S5 and S6 (Jin et al., 2005).
• Out of six transmembrane domains, the fourth is a voltage
sensor (Jhang et al., 2006).
• Alternative forms of CatSper and conserved pore region (T X D
x W) motif reported in human (Asadi et al., 2006).
44. CatSper channel
5 different genes encoding CatSper
1,2,3 ,4 & β
Expressed in the plasma membrane
of principal piece of sperm tail
Catsper protein is a single 6 TM
spanning repeat – closest to Cav
channels
S4 segment acts as a voltage
sensor, abundance of histidine and
arginine residues
49. CatSpers 1,2,3 & 4 may interact directly or indirectly and form a
functional tetramer
CatSper1 and CatSper2 can associate with and modulate the
function of the Ca(v)3.3 channel, which might be important in
the regulation of sperm function.
Controls calcium entry to mediate the hyperactivated motility,
CatSper3 - has role in acrosome reaction and male fertility
Catsper3 and Catsper4 knockout male mice were completely
infertile due to a quick loss of motility and a lack of
hyperactivated motility under capacitating conditions
CatSper is therefore implicated as a potential target to explore
the molecular mechanisms of male infertility.
CatSper genes -Function
50. MAP Location
Mouse: 19 A
Human: 11q13.1
Cattle: 29
CatSper 1 gene summary
Start : 65,540,799 bp from pter
End : 65,550,564 bp from pter
Size : 9,766 bases
ORF : 2343 Nucleotide
Protein : 780 aminoacid
51. CatSper 1 gene organisation
VIIV XIII XIX XII
27 115 76 61 73 64 144 92 148 114 213 1216
5’UTR 3’UTR
EXONS (12) 2443 bp
INTRONS
52. Orthologs for CatSper1 gene
Organism
Human
Similarity
Dog
(Canis familiaris)
82.98(n)
77.67(a)
Cow
(Bos taurus)
75.06(n)
62.88(a)
Rat
(Rattus norvegicus)
63.84(n)
53.94(a)
Mouse
(Mus musculus)
67.48(n)
57.67(a)
53. CatSper2 gene summary
Start : 41,707,993 bp from pter
End : 41,728,338 bp from pter
Size : 20,346 bases
Exons : 12
ORF : 1593 nt
Translation : 530 aa
Map location
Human : 15p15.3
Cattle : 21
Mouse : 2E5
54. CatSper2 gene organisation
I II V VII XIIII VI VIII XIIXIX
32 165 218 57 100 179 125 156 173 69 174 145
5’UTR 3’ UTR
EXONS (12) 1593 nt
INTRONS
55. Orthologs for CatSper2 gene
Organism
Human
Similarity
Dog
(Canis familiaris)
84.91(n)
79.36(a)
Chimpanzee
(Pan troglodytes)
99.37(n)
98.86(a)
Cow
(Bos taurus)
82.32(n)
76.52(a)
Rat
(Rattus norvegicus)
74.86(n)
70.06(a)
Mouse
(Mus musculus)
74.49(n)
69.47(a)
56. CatSper3 gene summary
Start : 134,331,495 bp from pter
End : 134,375,291 bp from pter
Size : 43,797 bases
ORF : 1197 nt
Translation : 398 aa
Map location
Human : 5q31.1
Mouse : 13B2
58. Orthologs of CatSper3
Organism
Human
Similarity
Dog
(Canis familiaris)
82.89(n)
76.06(a)
Chimpanzee
(Pan troglodytes)
99.66(n)
99.25(a)
Cow
(Bos taurus)
82.65(n)
75.89(a)
Rat
(Rattus norvegicus)
73.72(n)
67.83(a)
Mouse
(Mus musculus)
74.43(n)
66.67(a)
59. CatSper4 gene summary
MAP LOCATION
Human : 1p35.3
Mouse : 4D3
Rat : 5q36
Start : 26,389,706 bp from pter
End : 26,401,620 bp from pter
Size : 11,915 bases
EXONS : 10
ORF : 1419 nt
Protein : 472 amino acids
63. Project executed in our lab
Title : Identification of SNPs in CatSper gene and their
association with sperm motility in cattle
64. 65
Diagram of Exon1-5 for Catsper1 gene on cattle
E-5E-3E-2 E-4E-1 E-15
10 kb
376bp 237bp
282bp385bp299bp
65. 66
Primers Designed (NC_007330) for SSCP analysis of
CatSper1 Gene in Cattle
Sl No Primer Name Primer Sequence Primer Length
(mer)
Product Length
(bp)
1. Cat1-E1F 5'AGTGGAAGCGCACAGTCCTA3' 20 mer 299 bp
Cat1-E1R 5'AGGGATGGACCCTAATGGAG3' 20 mer
2. Cat1-E2F 5'GGCCCATGTGTTAAGCTTTC 3' 20 mer 376 bp
Cat1-E2R 5'ATCCTGGGAAAGGGATGTG 3' 19 mer
3. Cat1-E3F 5'CAGAAGGCCTACCTCCATGA3' 20 mer 237 bp
Cat1-E3R 5'AAGACCGCTGGACGAGAATA3' 20 mer
4.
Cat1-E4F 5'GGGGAGTACCGTCATGGAAG3' 20 mer
385 bp
Cat1-E4R 5'GACTACACCAGCAGGGGAGA3' 20 mer
5.
Cat1E5F 5'CCTTTCTGGCCCCCTTACA3' 19 mer
282 bpCat1E5R 5'ACCAACATCAACGGCCTTCTCTAC3
'
24 mer
66. 67
Optimized Conditions for PCR-SSCP Analysis
Gel Conc. : 12%
Time : 100bp/hr.
Temp. : 150
C
Voltage : 350 Volts
Band patterns were resolved by Silver staining of
the gel (Bassam et al., 1991)
67. 68
• Identification of SSCP band patterns
• Sequencing of SSCP patterns
• SNP identification by Nucleotide sequence analysis using MEGALIGN module
of DNA Star (Lasergene , USA) software.
• Estimation of Gene and Genotype frequency
Falconer and Mackey (2009)
• Haplotyping for SNPs data of each bull
• Anova using SAS programme (GLM, SAS 9.2) for ascertaining effect of
haplotype and its association with seminal parameters
• Statistical Model:
Yij = µ+Hi+eij
Where Hi is the effect of ith haplotype
µ = mean, eij =error effect
SNPs Identification and Association Study
68. 69
Cattle Genomic DNA isolation
Conditions: Agarose gel 0.8%, 50 Volts for 1hr.
OD Ratio at 280/260: 1.6 to 1.9
Working DNA Concentration: 50-100ng/µl
69. 70
PCR-Amplification for Catsper1 exon1
299bp
100bp ladder
S. No. Steps Temp. Time
1. Initial denaturation 95 °C 4min
2.
35 cycles
Cyclic denaturation 94 °C 45 sec
Cyclic annealing 64°C 45 sec
Cyclic extension 72 °C 45 sec
3. Final extension 72 °C 10min
4. Storage 4°C 10min
71. 72
PCR-Amplification for CatSper1 exon2
376bp
100bp ladder
S. No. Steps Temp. Time
1. Initial denaturation 95 °C 4min
2.
35 cycles
Cyclic denaturation 94 °C 45 sec
Cyclic annealing 62.5°C 45 sec
Cyclic extension 72 °C 45 sec
3. Final extension 72 °C 10min
4. Storage 4°C 10min
72. 73
SSCP patterns in Cat1 Exon2
AA (97)70.30 %, AB (16)18.10%, BB(25)11.60%
AA AA AB AA BB AB AAAA AA AB AA BB AB AA
73. 74
PCR-Amplification for Catsper1 exon3
237bp
100bp ladder
S. No. Steps Temp. Time
1. Initial denaturation 95 °C 4min
2.
35 cycles
Cyclic denaturation 94 °C 45 sec
Cyclic annealing 63°C 45 sec
Cyclic extension 72 °C 45 sec
3. Final extension 72 °C 10min
4. Storage 4°C 10min
74. 75
SSCP patterns in CatSper1 Exon3
DD DD EE FF EE GG GG HH
DD(58)42.03%, EE(34)24.64%, FF(25)18.12%, GG(9)6.52%, HH(12)8.69%
75. 76
PCR-Amplification for Catsper1 exon4
385 bp
100bp ladder
S. No. Steps Temp. Time
1. Initial denaturation 95 °C 4min
2. 35 cycles
Cyclic
denaturation
94 °C 45 sec
Cyclic annealing 64°C 45 sec
Cyclic extension 72 °C 45 sec
3. Final extension 72 °C 10min
4. Storage 4°C 10min
76. 77
SSCP patterns Cat1 Exon 4
II X JJ JJ KK KK JJ LL
II(4)2.89%, JJ(101)73.19 %, KK(10)7.25%, LL(23)16.67%
77. 78
PCR-Amplification for Catsper1 exon5
282bp
100bp ladder
S. No. Steps Temp. Time
1. Initial denaturation 95 °C 4min
2. 35 cycles
Cyclic
denaturation
94 °C 45 sec
Cyclic annealing 55°C 45 sec
Cyclic extension 72 °C 45 sec
3. Final extension 72 °C 10min
4. Storage 4°C 10min
78. 79
SSCP Patterns Cat1 Exon5
MM MM MN MN MN MN MN NN X NN NN NN NN NN
MM(21)15.22% MN(55)39.85% NN(62)44.93%
79. 80
Total 10 novel SNPs identified in CatSper1 gene in cattle
Fragment
1
Fragment 2 Fragment 3 Fragment 4 Fragment 5
NO SNP T C,
199*(exon2)
C G
37(Intro1)
A G,
52
(Intron3)
G C
32 (exon5)
Val TO Leu
G A, 272
(exon2)
Gly TO Ser
C T, 94
(exon3)
Thr TO Met
A G,
160
(exon4)
Thr TO Ala
T G,
165
(Intron3)
T C,
345
(Intron4)
G
A,188
(Intron3)
* Silent mutation
80. 81
Table: Fragment wise Gene and Genotype frequency for catsper1 gene in cattle
Fragment No. Genotype Frequency % Allele Frequency %
Fragment 1 ZZ (138) 100 Z 100
Fragment 2 AA (97) 70.30 A 79.35
AB (16) 18.10 B 20.65
BB(25) 11.60
Total 3 (138) 100 2 100
Fragment 3 DD(58) 42.03 D 42.03
EE(34) 24.64 E 24.64
FF(25) 18.12 F 18.12
GG(9) 6.52 G 6.52
HH(12) 8.69 H 8.69
Total 5 (138) 100 5 100
Fragment 4 II(4) 2.89 I 2.89
JJ(101) 73.19 J 73.19
KK(10) 7.25 K 7.25
LL(23) 16.67 L 16.67
Total 4 (138) 100 4 100
Fragment 5 MM(21) 15.22 M 35.14
MN(55) 39.85 N 64.86
NN(62) 44.93
Total 3 (138) 100 2 100
*Figuresinparenthesisindicatingnumberofanimals
81. 82
Haplotype analysis covering five exons of Catsper1 gene
in crossbred bulls
Sl.No. Bull
No.
Exon1 Exon2 Exon3 Exon4 Exon5 Haplotype
Pattern Patte
rn
Gen Patte
rn
Gen Patter
n
Gen Patter
n
Gen
1 67 ZZ AA G/G FF C/C JJ A/A MM C/C I-GC
2 70 ZZ AB G/A DD T/T JJ A/A MM C/C II-(G/A)T
3 89 ZZ AA G/G FF C/C JJ A/A MM C/C I-GC
4 402 ZZ AA G/G FF C/C JJ A/A MM C/C I-GC
5 969 ZZ BB A/A FF C/C JJ A/A MM C/C III-AC
6 992 ZZ AA G/G FF C/C JJ A/A MM C/C I-GC
7 1034 ZZ AA G/G FF C/C JJ A/A MM C/C I-GC
83. 84
ANOVA for Mass Motility
Source DF Sum of
Squares
Mean Square F
Value
Pr > F
Haplotype 2 52.5557429 26.2778715 35.07** <.0001
Error 94 70.4339478 0.7492973
Corrected
Total
96 122.989690
84. 85
ANOVA for Initial Progressive Motility
Source DF Sum of
Squares
Mean
Square
F
Value
Pr >
F
Haplotype 2 19904.24545 9952.12273 75.88** <.0001
Error 94 12328.74424 131.15685
Corrected
Total
96 32232.98969
85. 86
ANOVA for Post Thaw Motility
Source DF Sum of
Squares
Mean
Square
F
Value
Pr > F
Haplotype 2 11329.65442 5664.82721 79.97** <.0001
Error 94 6659.00538 70.84048
Corrected
Total
96 17988.65979
86. 87
Association of bull fertility traits with
possible haplotypes
Haplotype
Seminal parameters
MM IPM PTM
I-GC 3.22a
± 0.10
67.66a
±1.45
43.22a
±1.06
II-(G/A)T 3.47a
± 0.18
68.57a
± 2.49
43.33a
±1.83
III-AC 1.21b
± 0.23
27.14b
± 3.06
12.50b
± 2.24
87. 88
CONCLUSIONSCONCLUSIONS
Five exons of catsper1 gene were PCR amplified in
cattle
A total of 15 SSCP patterns were found
10 novel SNPs were identified
3 haplotypes in bulls
Haplotype 1 and 2 significantly contributed to high
sperm motility
88. 89
FUTURE PROSPECTS
The association of Identified haplotypes with sperm
quality traits still need to be validated with large
number of bulls and that could be ultimately used for
Marker Assisted Selection (MAS).
Genetic Effects of the identified DNA alteration at the
genomic level need to be confirmed at the
transcriptional or translational level.