1) Rainbow trout were injected with somatostatin-14 (SS-14) or saline and transferred to 20 ppt seawater to examine the effects of SS-14 on the GH-IGF-1 axis and seawater adaptation.
2) SS-14 treated fish showed slightly elevated plasma chloride levels and reduced gill Na+,K+-ATPase activity compared to controls 12 hours after transfer.
3) Transfer to seawater increased mRNA levels of GH receptor 1, GH receptor 2, and IGF-1 in the liver and gills of control fish but SS-14 abolished or attenuated these increases, indicating SS-14 reduces seawater adaptability by inhibiting the GH-
Brian Covello: Diabetes Research Presentation Semester 2Brian Covello
Brian Covello's diabetes research presentation for semester 2. Diabetes mellitus (or diabetes) is a chronic, lifelong condition that affects your body's ability to use the energy found in food. There are three major types of diabetes: type 1 diabetes, type 2 diabetes, and gestational diabetes.
All types of diabetes mellitus have something in common. Normally, your body breaks down the sugars and carbohydrates you eat into a special sugar called glucose. Glucose fuels the cells in your body. But the cells need insulin, a hormone, in your bloodstream in order to take in the glucose and use it for energy. With diabetes mellitus, either your body doesn't make enough insulin, it can't use the insulin it does produce, or a combination of both.
Since the cells can't take in the glucose, it builds up in your blood. High levels of blood glucose can damage the tiny blood vessels in your kidneys, heart, eyes, or nervous system. That's why diabetes -- especially if left untreated -- can eventually cause heart disease, stroke, kidney disease, blindness, and nerve damage to nerves in the feet.
Type 1 Diabetes
Type 1 diabetes is also called insulin-dependent diabetes. It used to be called juvenile-onset diabetes, because it often begins in childhood.
Type 1 diabetes is an autoimmune condition. It's caused by the body attacking its own pancreas with antibodies. In people with type 1 diabetes, the damaged pancreas doesn't make insulin.
This type of diabetes may be caused by a genetic predisposition. It could also be the result of faulty beta cells in the pancreas that normally produce insulin.
A number of medical risks are associated with type 1 diabetes. Many of them stem from damage to the tiny blood vessels in your eyes (called diabetic retinopathy), nerves (diabetic neuropathy), and kidneys (diabetic nephropathy). Even more serious is the increased risk of heart disease and stroke.
Treatment for type 1 diabetes involves taking insulin, which needs to be injected through the skin into the fatty tissue below. The methods of injecting insulin include:
Syringes
Insulin pens that use pre-filled cartridges and a fine needle
Jet injectors that use high pressure air to send a spray of insulin through the skin
Insulin pumps that dispense insulin through flexible tubing to a catheter under the skin of the abdomen
A periodic test called the A1C blood test estimates glucose levels in your blood over the previous three months. It's used to help identify overall glucose level control and the risk of complications from diabetes, including organ damage.
Having type 1 diabetes does require significant lifestyle changes that include:
Frequent testing of your blood sugar levels
Careful meal planning
Daily exercise
Taking insulin and other medications as needed
ABSTRACT- An experimental study was performed with viviparous animal Heterometrous fulvipes to access the cumulative effect of chronic heavy metals exposure on the activity levels of the enzymes aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Chronic heavy metal exposure resulted in variation in the enzymes levels with increase in AST and decreases in ALT, contributed to the stress induced by the heavy metals. These changes in enzymatic activity of the maternal and embryonic tissue of H. fulvipes under the influence of heavy metal, mercury and lead is suggestive of the specific impact of mercury and lead on the enzymatic pathway, prompting a further study to consolidate the finding in human study. It is pertinent that the heavy metal toxicity be well documented and appropriate precaution taken in mother and fetus to decrease its detrimental effects. Key-words- Heavy Metals, Animal models, Hepatic Enzymes, Viviparous
Belair National Park - Plan of ManagementPaul Boundy
This is an educational exercise on plans of management. The presi is designed to accompany a verbal presentation and thus loses it shine without my words giving the backstory.
It was interesting to note the large number of recreational uses of the park that many of us would not generally associate with a national park.
Brian Covello: Diabetes Research Presentation Semester 2Brian Covello
Brian Covello's diabetes research presentation for semester 2. Diabetes mellitus (or diabetes) is a chronic, lifelong condition that affects your body's ability to use the energy found in food. There are three major types of diabetes: type 1 diabetes, type 2 diabetes, and gestational diabetes.
All types of diabetes mellitus have something in common. Normally, your body breaks down the sugars and carbohydrates you eat into a special sugar called glucose. Glucose fuels the cells in your body. But the cells need insulin, a hormone, in your bloodstream in order to take in the glucose and use it for energy. With diabetes mellitus, either your body doesn't make enough insulin, it can't use the insulin it does produce, or a combination of both.
Since the cells can't take in the glucose, it builds up in your blood. High levels of blood glucose can damage the tiny blood vessels in your kidneys, heart, eyes, or nervous system. That's why diabetes -- especially if left untreated -- can eventually cause heart disease, stroke, kidney disease, blindness, and nerve damage to nerves in the feet.
Type 1 Diabetes
Type 1 diabetes is also called insulin-dependent diabetes. It used to be called juvenile-onset diabetes, because it often begins in childhood.
Type 1 diabetes is an autoimmune condition. It's caused by the body attacking its own pancreas with antibodies. In people with type 1 diabetes, the damaged pancreas doesn't make insulin.
This type of diabetes may be caused by a genetic predisposition. It could also be the result of faulty beta cells in the pancreas that normally produce insulin.
A number of medical risks are associated with type 1 diabetes. Many of them stem from damage to the tiny blood vessels in your eyes (called diabetic retinopathy), nerves (diabetic neuropathy), and kidneys (diabetic nephropathy). Even more serious is the increased risk of heart disease and stroke.
Treatment for type 1 diabetes involves taking insulin, which needs to be injected through the skin into the fatty tissue below. The methods of injecting insulin include:
Syringes
Insulin pens that use pre-filled cartridges and a fine needle
Jet injectors that use high pressure air to send a spray of insulin through the skin
Insulin pumps that dispense insulin through flexible tubing to a catheter under the skin of the abdomen
A periodic test called the A1C blood test estimates glucose levels in your blood over the previous three months. It's used to help identify overall glucose level control and the risk of complications from diabetes, including organ damage.
Having type 1 diabetes does require significant lifestyle changes that include:
Frequent testing of your blood sugar levels
Careful meal planning
Daily exercise
Taking insulin and other medications as needed
ABSTRACT- An experimental study was performed with viviparous animal Heterometrous fulvipes to access the cumulative effect of chronic heavy metals exposure on the activity levels of the enzymes aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Chronic heavy metal exposure resulted in variation in the enzymes levels with increase in AST and decreases in ALT, contributed to the stress induced by the heavy metals. These changes in enzymatic activity of the maternal and embryonic tissue of H. fulvipes under the influence of heavy metal, mercury and lead is suggestive of the specific impact of mercury and lead on the enzymatic pathway, prompting a further study to consolidate the finding in human study. It is pertinent that the heavy metal toxicity be well documented and appropriate precaution taken in mother and fetus to decrease its detrimental effects. Key-words- Heavy Metals, Animal models, Hepatic Enzymes, Viviparous
Belair National Park - Plan of ManagementPaul Boundy
This is an educational exercise on plans of management. The presi is designed to accompany a verbal presentation and thus loses it shine without my words giving the backstory.
It was interesting to note the large number of recreational uses of the park that many of us would not generally associate with a national park.
Linkedin est un formidable outil de référencement naturel. Vous voulez mettre en valeur vos compétences, capter des prospects pour votre business ou rechercher un point de vue d’experts ? Exploitez à fond l’outil ! En plus c’est gratuit !
Determination of acute toxicity and the effects of sub-acute concentrations o...Nanomedicine Journal (NMJ)
Abstract
Objective(s):
Copper oxidenanoparticles have different industrial applications so it is inevitable that nanoparticulate products finally find their way into aquatic ecosystems. Nevertheless there is little information available about their effects on some of edible fish. The present study aims to determine the acute toxicity and evaluate the effect of two sub-acute concentrations (50 and 70% 96 h LC50) of CuO-NPs on some hematological and biochemical parameters of R. rutilus.
Materials and Methods:
225 healthy specimen of R. rutilus (mean weight 5.52±1.2 g; mean length 6.20±0.2 cm) were transported to the laboratory. In order to prepare the stock solution, CuO-NPs was dispersed in pure water with ultrasonication (50-60 kHz) for 15 min every day before dosing. At first, R. rutilus was exposed to CuO-NPs to determine the lethal concentration (LC50) value. Following acute test, fish were treated with sub-acute concentrations of CuO-NPs (50 and 70% 96 h-LC50 at) with one control group (no CuO-NPs) for a week to determine the changes in the level of some plasma hematological and biochemical parameters.
Results:
The 96 h-LC50 values of CuO-NPs was 2.19±0.003 mg/l. R. rutilus exhibited significantly lower RBC count, Hb and Hct values and a significant increase in the WBC numbers, MCH, MCHC and MCV indices (p<0.05).><0.05).
Conclusion:
These alterations indicate R. rutilus sensitivity to CuO-NPs and changes in blood parameters would be a useful tool for measurement early exposure to CuO nanoparticles.
We investigated the effects of fish protein hydrolysate (FPH) on zootechnical performance and immune response of the Asian Seabass Lates calcarifer Bloch. Experimental fish were fed with 3 diets: a local commercial diet (control), coated or not, with 2 and 3% FPH (w/w). Twelve thousand Asian Seabass juveniles (5.88±0.56 g) were divided into three groups and two replicates reared in nursery tanks (2000 L). The remaining fish were then used for grow-out experiment in floating net cages (1m x 1 m x 3 m). Zootechnical performances were assessed at both stages with following indicators: total weight gain (TWG), % relative weight gain (% RWG), % specific growth rate (% SGR), final weight (g) and final length (cm). At the end of each trial period, fish immune status was assessed through blood sampling and the measurement of Neutrophile (%), Monocyte (%), Lymphocyte (%), Macrophage (105 cell/mL), Leukocyte (103 cell/mL) and Phagocytes activity (%). At the end of the nursery trial, an immersion bacterial challenge with Vibrio parahaemolyticus (105 cells mL-1) was implemented. The results showed that dietary FPH supplementation significantly influenced the growth and immune status of Asian Seabass when compared to the control group. Fish fed FPH supplemented diet yielded higher growth rates and survival rates than non supplemented group. Fish phagocytic activity and resistance to a bacterial challenge were also improved by dietary FPH supplementation. These results may be related to the significant changes observed in fish leukocyte profiles, when fed FPH supplemented diets. Altogether, these results show the positive contribution of FPH to the sustainability of Asian seabass farming.
Neuro-genotoxicity assessment of sublethal exposure of carbosulfan to freshwa...Open Access Research Paper
Carbosulfan, a carbamate pesticide extensively employed in rural communities, enters the aquatic environment by the proximity of agricultural lands to water bodies or through direct application in such environments. The study’s goal was to investigate the neurotoxic effects of carbosulfan using ACh and AChE levels in brain tissue, and genotoxic effects using Micronucleus (MN) assay in blood cells and Comet assay in gill cells of Cyprinus carpio. The fish was exposed to 1/5th & 1/10th sublethal concentrations of 96 h LC50 for 7, 14, and 21 days. There were significant (P<0.05) alterations in ACh and AChE content and carbosulfan was induced to show MN formation and DNA damage in concentration and time-dependent manner. The reduced ionic composition in C.carpio brain tissue may explain the inhibition of AChE and the rise of ACh concentration. The significant increase in MN and DNA damage observed in carbosulfan-exposed fishes in the current study indicates the mutagenic/genotoxic potential of carbosulfan in the freshwater fish C.carpio, as well as the potential value of the Common carp for assessing pesticide pollution of freshwater bodies. Changes in these characteristics may provide an early warning signal for determining pesticide toxicity and its impact on aquatic species. As a result, it is necessary to monitor the aquatic system and forecast the hazardous effect of carbosulfan on fish; precautions should be taken while using even low concentrations of carbosulfan, and prohibiting or restricting carbosulfan usage is preferable.
Cellular signal transduction pathways under abiotic stressSenthil Natesan
Abiotic stresses, especially cold, salinity and drought, are the primary causes of crop loss worldwide. Plant adaptation to environmental stresses is dependent upon the activation of cascades of molecular networks involved in stress perception, signal transduction, and the expression of specific stress-related genes and metabolites. Plants have stress-specific adaptive responses as well as responses which protect the plants from more than one environmental stress. There are multiple stress perception and signaling pathways, some of which are specific, but others may cross-talk at various steps (Knight & knight ,2001).Many cold induced pathways are activated to protect plants from deleterious effects of cold stress, but till date, most studied pathway is ICE-CBF-COR signaling pathway (Miura and Furumoto,2013 ) . The Salt-Overly-Sensitive (SOS) pathway, identified through isolation and study of the sos1, sos2, and sos3 mutants, is essential for maintaining favorable ion ratios in the cytoplasm and for tolerance of salt stress (shi .et al ,2002). Both ABA-dependent and -independent signaling pathways appear to be involved in osmotic stress tolerance (Nakashima and shinozaki, 2013) .ROS play a dual role in the response of plants to abiotic stresses functioning as toxic by-products of stress metabolism, as well as important signal transduction molecules and the ROS signaling networks can control growth, development, and stress response ( Mahajan,s and Tuteja, 2005) .
Renin is not completely referred to as hormone, it has a role as a enzyme it hydrolyze angiotensinogen into angiotensin 1. Mature renin having 340 amino acids and has a mass of 37KD.
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
All manuscripts are subject to rapid peer review. Those of high quality (not previously published and not under consideration for publication in another journal) will be published without delay.
DOI: 10.21276/ijlssr.2016.2.3.13
ABSTRACT- The present investigation was carried out to the effect of Fenvalerate on haematological parameters in
freshwater fish Channa marulius using standard methods. Fish was exposed to (1/4th LC50) sub lethal concentration of
Fenvalerate (0.086ppm) for 96h.The blood sample were obtained from both, control and experimental fish and assayed
haematological parameters (Total Erythrocytes count, TEC; Total Leucocytes count, TLC; Haemoglobin, Hb; Packed cell
volume, PCV; Mean corpuscular volume, MCV; Mean Corpuscular Haemoglobin and Mean Corpuscular Haemoglobin
Concentration; MCHC). The result revealed that TEC, Hb percentage, PCV and MCHC counts were significantly
decreased, whereas TLC, MCV and MCH increased slightly in experimental fish. The study has thus indicated marked
changes in blood of Channa marulius after exposure to Fenvalerate.
Key-words- Fenvalerate, Hematology, Channa marulius, Haemoglobin, Sub lethal
Biochemical Alternation In Fresh Water Fishe Labeo Rohita Exposed To The Sodi...iosrjce
Fishes are regarded as an important high grade protein containing food staple of Indian people.
Ever increasing water pollution level, especially sodium fluoride (NaF), in inland freshwater reservoir has
made significant biochemical changes in the life cycle of fishes. In view of this, the investigations on effects of
acute and chronic sodium fluoride toxicity to fish Labeo rohita have been carried out. The changes in glycogen,
protein and lipid content of selected tissues like muscle, liver, gill and kidney were examined. The study
revealed a highest loss of glycogen, protein and lipid percentage in all tissues as compared to control.
Original articleGamma radiation effect on quality changes .docxgerardkortney
Original article
Gamma radiation effect on quality changes in vacuum-packed squid
(Illex argentinus) mantle rings during refrigerated (4–5 �C) storage
Alejandra Tomac* & Marı́a Isabel Yeannes
Grupo de Investigación Preservación y Calidad de Alimentos, Facultad de Ingenierı́a, Universidad Nacional de Mar del Plata, Consejo Nacional de
Investigaciones Cientı́ficas y Técnicas (CONICET), Juan B. Justo 4302, B7608FDQ, Mar del Plata, Argentina
(Received 14 October 2011; Accepted in revised form 21 February 2012)
Summary The effect of gamma radiation (0, 1.8, 3.3 and 5.8 kGy) on microbiological, chemical and colour
characteristics of vacuum-packed squid (Illex argentinus) mantle rings was studied. Total viable counts;
psychrotrophic bacteria counts, Escherichia Coli, Staphylococcus aureus and Clostridium perfringens; total
volatile basic nitrogen (TVBN) and colour differenceDE�ab were analysed during 29 days of storage at
4–5 �C. Higher doses of gamma radiation significantly reduced Total Viable, phychrotrophic counts and
TVBN production (P < 0.05) in a dose-dependent way, delaying squid spoilage. Colour difference of non-
irradiated samples with respect to first day significantly increased while it was constant in radiated samples
during 22 days (P < 0.05). Independently from the dose, radiation avoided colour changes of squid rings.
Gamma irradiation was effective in delaying deterioration reactions, improving microbiological, chemical
and colour quality of vacuum-packed squid rings stored at 4–5 �C.
Keywords Colour, Illex argentinus, ionising radiation, microbial activity, quality, refrigeration.
Introduction
Food irradiation has been widely studied as a food
preservation method for the last five decades. It has
certainly proved its toxicological safety as well as it
efficiency in shelf life extension by decreasing microbial
counts. At present, more than 60 countries have
approved irradiation of one or more foods (WHO,
1994, 1999, Diehl, 2002; Sommers & Fan, 2006).
Nutritional adequacy of irradiated food has also been
largely investigated. Irradiation can induce changes in
proteins, lipids, carbohydrates and vitamins due mainly
to free radicals produced by water radiolysis. However,
no significant losses of the nutritional quality of lipid,
carbohydrate and protein constituents have been re-
ported at irradiation doses intended for food preservation
(£10 kGy) (Josephson et al., 1978; Kilcast, 1995; Giroux
& Lacroix, 1998; ICGFI, 1999; ADA Report, 2000).
Among lipids, polyunsaturated fatty acids (PUFAs)
are more sensitive to oxidation by free radicals. The
absence of oxygen can minimise this effect, as observed
by Kim et al. (2002) in raw beef, turkey and pork meats.
Erkan & Özden (2007) concluded that irradiation had
only marginal effects on the lipids of fishery products,
including the essential alpha-linolenic acid. Abreu et al.
(2010) found that irradiation doses up to 6 kGy did not
compromise negatively the fatty acid.
Similar to Effects of growth hormone treatment on oxygen (20)
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Lung Cancer: Artificial Intelligence, Synergetics, Complex System Analysis, S...Oleg Kshivets
RESULTS: Overall life span (LS) was 2252.1±1742.5 days and cumulative 5-year survival (5YS) reached 73.2%, 10 years – 64.8%, 20 years – 42.5%. 513 LCP lived more than 5 years (LS=3124.6±1525.6 days), 148 LCP – more than 10 years (LS=5054.4±1504.1 days).199 LCP died because of LC (LS=562.7±374.5 days). 5YS of LCP after bi/lobectomies was significantly superior in comparison with LCP after pneumonectomies (78.1% vs.63.7%, P=0.00001 by log-rank test). AT significantly improved 5YS (66.3% vs. 34.8%) (P=0.00000 by log-rank test) only for LCP with N1-2. Cox modeling displayed that 5YS of LCP significantly depended on: phase transition (PT) early-invasive LC in terms of synergetics, PT N0—N12, cell ratio factors (ratio between cancer cells- CC and blood cells subpopulations), G1-3, histology, glucose, AT, blood cell circuit, prothrombin index, heparin tolerance, recalcification time (P=0.000-0.038). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and PT early-invasive LC (rank=1), PT N0—N12 (rank=2), thrombocytes/CC (3), erythrocytes/CC (4), eosinophils/CC (5), healthy cells/CC (6), lymphocytes/CC (7), segmented neutrophils/CC (8), stick neutrophils/CC (9), monocytes/CC (10); leucocytes/CC (11). Correct prediction of 5YS was 100% by neural networks computing (area under ROC curve=1.0; error=0.0).
CONCLUSIONS: 5YS of LCP after radical procedures significantly depended on: 1) PT early-invasive cancer; 2) PT N0--N12; 3) cell ratio factors; 4) blood cell circuit; 5) biochemical factors; 6) hemostasis system; 7) AT; 8) LC characteristics; 9) LC cell dynamics; 10) surgery type: lobectomy/pneumonectomy; 11) anthropometric data. Optimal diagnosis and treatment strategies for LC are: 1) screening and early detection of LC; 2) availability of experienced thoracic surgeons because of complexity of radical procedures; 3) aggressive en block surgery and adequate lymph node dissection for completeness; 4) precise prediction; 5) adjuvant chemoimmunoradiotherapy for LCP with unfavorable prognosis.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists Saeid Safari
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
2. J. Poppinga et al. / Aquaculture 273 (2007) 312–319 313
IGF-1 mRNA production and GH was demonstrated in cold SEI buffer (250 mM sucrose, 10 mM Na2EDTA, 50 mM
the gill and kidney of trout in response to increases in imidazole) and frozen on dry ice for later assay of Na+, K+-
environmental salinity (Sakamoto and Hirano, 1993). ATPase. Liver and gill filament samples were removed and
Both GH and IGF-1 can increase salinity tolerance and placed in 2-ml microfuge tubes and immediately placed on dry
ice and stored at −80 °C until later analysis of RNA.
gill Na+, K+-ATPase activity in several teleost species
(McCormick et al., 1991; Mancera and McCormick, 2.3. Plasma chloride and Na+, K+-ATPase
1998), and a synergistic relationship between the two
hormones in controlling gill Na+, K+-ATPase activity Plasma chloride was determined by silver titration using a
has been suggested by Madsen and Bern (1993). Buchler-Cotlove Chloridometer. Gill Na+/K+-ATPase activity
Somatostatin (SS), originally discovered in 1973 was determined as described previously (McCormick, 1993).
(Brazeau et al., 1973), has numerous effects on the
growth, development, reproduction, and metabolism of 2.4. Quantitative real-time PCR
vertebrates (Sheridan, 1994; Sheridan et al., 2000;
Total RNA was extracted from frozen tissue samples by
Sheridan and Kittilson, 2004; Nelson and Sheridan, homogenization in the presence of 500 μl TRI Reagent®
2005; Klein and Sheridan, in press). Given that SS inhibits (Molecular Research Center Inc., Cincinnati, OH) based on
the release of numerous pituitary factors, including GH manufacturer's protocol. Each RNA pellet was resuspended in
and thyroid stimulating hormone, the possibility exists 100 μl RNase free deionized water and quantified by
that SS also may play a role in seawater adaptability and ultraviolet (A260) spectrophotometry.
osmoregulation. The aim of this study was to examine the RNA was reverse transcribed in 10 μl reactions using 200 ng
effects of SS on the GH–IGF-1 axis during acclimation to total RNA (2 μl) and 8 μl TaqMan® reverse transcription reagents
seawater and to provide further insight into the role of SS (which included 5.5 mM MgCl2, 500 μM each dNTP, 2.5 μM
on organismal growth and seawater adaptability. oligo d(T)16 primer, 0.4 U/μl RNase inhibitor, and 3.125 U/ml of
MultiScribe reverse transcriptase) according to the manufac-
2. Materials and methods turer's protocol (Applied Biosystems, Foster City, CA). Reac-
tions without reverse transcriptase were included as negative
2.1. Animals controls; no amplification was detected in negative controls.
mRNA levels of GH receptor 1 (GHR 1), GHR 2, IGF-1, IGF
Juvenile rainbow trout of both sexes were obtained from receptor 1a (IGFR1a), and IGFR1b were determined by real-
Dakota Trout Ranch near Carrington, ND, USA and time PCR using TaqMan® chemistry and an ABI PRISM® 7000
transported to North Dakota State University. Fish were Sequence Detection System (Applied Biosystems). Real-time
maintained in well-aerated, 800-l circular tanks supplied with reactions were carried out for samples, standards, and no-
recirculated (10% make-up volume per day) dechlorinated template controls in a 10-μl volume, containing 2 μl cDNA from
municipal water at 12 °C with 12:12 L:D photoperiod. Fish the reverse transcription reaction, 5 μl TaqMan Universal PCR
were fed twice daily to satiety with AquaMax™ pellets (PMI Master Mix, and 1 μl of each forward primer, reverse primer, and
Nutrition International, Brentwood, MO), except 24 h prior to probe at concentrations optimized for the mRNA species to be
and during experimental trials. measured. The gene-specific primer and probe sequences used
for GHR 1, GHR 2, and β-actin have been reported previously
2.2. Experimental conditions (Slagter et al., 2004; Very et al., 2005). The gene-specific
nucleotides used for IGF-1 quantification were as follows:
Fish (95.1 ± 1.5 g mean body weight) acclimated to forward 5′ GTGGACACGCTGCAGTTTGT 3′ (900 nM),
freshwater were anesthetized with 0.05% (v/v) 2-phenoxyethanol reverse 5′ CATACCCCGTTGGTTTACTGAAA 3′ (900 nM),
in 20‰ (w/v, InstantOcean®, Aquarium Systems Inc., Mentor, and probe 5′ FAM-AAAGCCTCTCTCTCCA 3′ (150 nM).
OH), weighed, and injected intraperitoneally (10 μl/g body The sequences used for IGFR1a were forward 5′ AGAGAA-
weight) with either somatostatin-14 (SS-14; 1 × 10− 11 mol/g CACATCCAGCCAGGTT 3′ (600 nM), reverse 5′ TCCTG-
body weight; Sigma, St. Louis, MO) or saline (0.75%, w/v), and CCATCTGGATCATCTT 3′ (600 nM), and probe 5′ FAM-
placed into 100-l circular experimental tanks. Experimental tanks TGCCCCCGCTGAA 3′ (150 nM), and for IGFR1b were
were supplied with 20‰ seawater (100% turnover rate per 24- forward 5′ CCTGAGGTCACTACGGGCTAAA 3′ (600 nM),
hour period) at 12 °C under a 12:12 L:D photoperiod. Fish were reverse 5′ TCAGAGGAGGGAGGTTGAGACT 3′ (600 nM),
sampled at 0, 6, 12, 24, 48, and 72 h following injection and and probe 5′ FAM-ATCCGTCCCAGTCCT 3′ (150 nM).
seawater transfer. Following anesthesia as described above, Cycling parameters were set as follows: 95 °C for 10 min and
sampled fish were weighed and measured for length. Blood was 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Cross reaction
collected from the severed caudal vessels and the plasma was was assessed by substituting alternate primer/probe sets in
separated from blood cells by centrifugation (11,000 g for 3 min) TaqMan assays for each standard; no amplification was observed
and stored at −80 °C for later analyses. One intact gill arch from under these conditions. Sample copy number was calculated
each fish was placed in 1.5-ml microfuge tubes containing ice- from the threshold cycle number (CT) and relating CT to a gene-
3. 314 J. Poppinga et al. / Aquaculture 273 (2007) 312–319
Fig. 1. Effects of somatostatin-14 (SS-14) on plasma chloride concentration and gill Na+/K+-ATPase activity in rainbow trout during acclimation to
20‰ seawater. Data are presented as mean ± SEM. Within a treatment (saline or SS-14), groups with different letters are significantly different
( p b 0.05); ⁎ indicates a significant difference ( p b 0.05) between the control- and SS-14-treated groups.
specific standard curve (Very et al., 2005) followed by (Fig. 1). While plasma chloride showed a significant transitory
normalization to β-actin levels within each time group increase compared to time 0 in both the saline- and SS-14-
(Sakamoto and Hirano, 1993). injected fish, reaching maximum levels 24 h after transfer, the
temporal profiles of the two treatment groups were somewhat
2.5. Statistical analyses different. Notably, plasma chloride levels in the SS-14-injected
fish were significantly elevated by 12 h after transfer, while
Data are expressed as mean ± SEM. Statistical differences those in the saline-injected fish were not. This significant
were analyzed by two-way ANOVA followed by post-hoc change in SS-14-injected fish corresponded to the only
Bonferoni's test (α = 0.05) to examine differences between and significant difference between the saline- and S-14-injected
among treatment groups. Statistics were performed on groups in gill Na+/K+-ATPase (Fig. 1B).
untransformed data using Sigma Stat (SPSS, Chicago, IL).
Outliers were determined using Dixon's test (α = 0.05). 3.2. GH–IGF-1 axis
3. Results The direct transfer of rainbow trout from freshwater to
seawater resulted in significant increases in the levels of
3.1. Plasma chloride and gill Na+, K+-ATPase mRNA encoding GHRs (Fig. 2) and IGF-1 in trout liver
(Fig. 3). Seawater transfer had the greatest effect on GHR 1,
Plasma chloride and gill Na+, /K+-ATPase were used as which increased 239% in control fish 24 h following seawater
indicators of the ability to osmoregulate in increased salinity transfer; afterward, GHR 1 mRNA levels declined to near
4. J. Poppinga et al. / Aquaculture 273 (2007) 312–319 315
Fig. 2. Effects of somatostatin-14 (SS-14) on the abundance of (A) growth hormone receptor 1 (GHR 1) and (B) GHR 2 mRNA in the liver of rainbow
trout during acclimation to 20‰ seawater. Data are presented as mean ± SEM. Within a treatment (saline or SS-14), groups with different letters are
significantly different ( p b 0.05); ⁎ indicates a significant difference ( p b 0.05) between the control- and SS-14-treated groups.
those in fish in the initial group (Fig. 2A). Hepatic GHR 2 transfer similarly increased hepatic IGF-1 mRNA expression,
mRNA levels also increased in control fish in a transitory where a maximum increase of 103% was observed in control
manner, increasing 48% 12 h after transfer (Fig. 2B). Seawater fish 12 h after seawater transfer (Fig. 3). SS-14 injection
Fig. 3. Effects of somatostatin-14 (SS-14) on the abundance of insulin-like growth factor-1 (IGF-1) mRNA in the liver of rainbow trout during
acclimation to 20‰ seawater. Data are presented as mean ± SEM. Within a treatment (saline or SS-14), groups with different letters are significantly
different ( p b 0.05); ⁎ indicates a significant difference ( p b 0.05) between the control- and SS-14-treated groups.
5. 316 J. Poppinga et al. / Aquaculture 273 (2007) 312–319
Fig. 4. Effects of somatostatin-14 (SS-14) on the abundance of (A) growth hormone receptor 1 (GHR 1) and (B) GHR 2 mRNA in the gill of rainbow
trout during acclimation to 20‰ seawater. Data are presented as mean ± SEM. Within a treatment (saline or SS-14), groups with different letters are
significantly different ( p b 0.05); ⁎ indicates a significant difference ( p b 0.05) between the control- and SS-14-treated groups.
significantly inhibited the normal seawater-associated increase expression occurred 12 h post-transfer for all mRNA species
of GHR 1, GHR 2, and IGF-1 mRNAs in liver. Maximum (Figs. 2 and 3). The inhibitory action of SS on hepatic GHR
attenuation of the seawater-induced increases in gene expression was not as substantial after 24 h, especially in the
Fig. 5. Effects of somatostatin-14 (SS-14) on the abundance of insulin-like growth factor-1 (IGF-1) mRNA in the gill of rainbow trout during
acclimation to 20‰ seawater. Data are presented as mean ± SEM. Within a treatment (saline or SS-14), groups with different letters are significantly
different ( p b 0.05); ⁎ indicates a significant difference ( p b 0.05) between the control- and SS-14-treated groups.
6. J. Poppinga et al. / Aquaculture 273 (2007) 312–319 317
Fig. 6. Effects of somatostatin-14 (SS-14) on the abundance of (A) insulin-like growth factor receptor 1A (IGFR1A) and (B) IGFR1B mRNA in the
gill of rainbow trout during acclimation to 20‰ seawater. Data are presented as mean ± SEM. Within a treatment (saline or SS-14), groups with
different letters are significantly different ( p b 0.05); ⁎ indicates a significant difference ( p b 0.05) between the control- and SS-14-treated groups.
case of GHR 1 (Fig. 2A), but mRNA levels remained levels of IGFR mRNAs in the gill of SS-14-injected fish
significantly lower than in control fish. Hepatic IGF-1 levels declined compared to the initial sampling.
in SS-14-injected fish remained depressed through the first
48 h, but not thereafter.
The patterns of expression of GH–IGF-1 axis components 4. Discussion
in the gill were similar to those in the liver. Seawater transfer
increased gill GHR 1 expression by 151% and GHR 2 This study indicates that transfer of rainbow trout to
expression by 121% in control fish (Fig. 4). SS-14 injection 20‰ seawater results in increased hepatic expression of
ablated seawater-associated increases in GHR expression. GHR and IGF-1 mRNAs as well as in increased
Levels of IGF-1 mRNA in the gill of control fish rose expression of GHR, IGF-1 and IGFR mRNAs in gill.
significantly after transfer to seawater (Fig. 5). SS-14 In addition, SS-14 injection abolishes or attenuates
completely abolished the seawater-associated increase in seawater-associated increases in GHR, IGF-1 and IGFR
IGF-1 mRNA levels. Two forms of IGFR were detected, mRNAs as well as retards seawater adaptability as
IGFR1A and IGFR1B. Direct transfer to seawater increased the
assessed by Na+, K+-ATPase activity. These findings
expression of both IGFRs in the gill of control fish; IGFR1A
levels rose rapidly and increased to a maximum of 62% of
extend our knowledge of the control of osmoregulation
initial levels 6 h after transfer, whereas IGFR1B levels and the role of SS in regulating the GH–IGF-1 axis.
increased to a maximum level (157%) 12 h after transfer Increases in GH, IGF-1, and cortisol have been well
(Fig. 6). As was the case with liver GHRs and IGF-1, SS-14 documented during the transition of euryhaline fish
abolished seawater-associated increases in the expression of from freshwater to seawater (Thorpe et al., 1987; Young
gill IGFR1s. By later stages of the experiment (e.g., 72 h), et al., 1989; McCormick, 2001; Evans, 2002). The
7. 318 J. Poppinga et al. / Aquaculture 273 (2007) 312–319
current findings extend our knowledge of GH–IGF-1 been documented with direct transfer to seawater (Scott
axis components in seawater adaptation in several ways. et al., 2004). The elucidation of effects of SS on the
First, increased expression of GHR mRNAs occurred at regulation of CFTR and Na+/K+/2Cl− co-transporter
the level of the liver and gill following seawater proteins would be necessary for a more complete
exposure. Such increased GHR synthesis should result understanding of the osmoregulatory role(s) of SS. It
in increased sensitivity of these tissues to GH. Second, also should be noted that the lack of pronounced effects
expression of IGF-1 in liver and gill increased following on plasma chloride in the present study, despite
seawater exposure. Seawater-associated increases in suppression of GH–IGF-1 components, may stem
hepatic IGF-1 expression similar to those observed in from the presence of other factors involved in osmo-
the current study also were reported by Sakamoto and regulation that were at least partially functional. For
Hirano (1993) and would be consistent with increased example, experimental evidence points to a synergism
plasma levels of IGF-1 observed following seawater between cortisol and GH in promoting the ability to
transfer (Shepherd et al., 2005). Third, expression of regulate gill Na+, K+-ATPase activity and co-transporter
IGFRs in the gill increased following seawater expo- function (McCormick, 2001; McCormick et al., 2003).
sure. Such alterations would increase the sensitivity of Taken together, these findings may explain why coho
this organ to IGF-1 and result in increased seawater salmon pre-smolts displayed reduced seawater adapt-
adaptability (McCormick, 2001; Evans, 2002). This ability in association with elevated plasma SS (Sheridan
pattern of seawater-induced alterations in the GH–IGF- et al., 1998).
1 axis is consistent with previous observations that GH The effects of SS on components of the GH–IGF-1
increases production of IGF-1 and IGFR mRNAs in gill axis also provide insight into the role of SSs in regulating
and liver in rainbow trout (Biga et al., 2004) and salmon growth. The present findings suggest that SS-14, in
(Pierce et al., 2005). addition to its inhibitory effects on pituitary GH release,
The current findings suggest that SS may affect also may affect other levels of the GH–IGF-1 axis (Very
hypoosmoregulatory ability through a combination of and Sheridan, 2002; Klein and Sheridan, in press). The
direct and indirect mechanisms. Foskett et al. (1983) extrapituitary actions of SS on GH sensitivity may help to
showed that SS-14 directly inhibited chloride transport explain reduced hepatic GH receptor number and
across the tilapia opercular membrane, and a direct depressed plasma IGF-1 in the face of elevated plasma
effect of SS-14 in trout is also possible. The indirect SS observed in stunting salmonids (Very and Sheridan,
pathway operates through the abolishment or attenua- 2002). Further research is necessary to provide informa-
tion of seawater-associated changes in the expression of tion on the direct effects of SS on GHR, IGF-1, and IGFR
GH–IGF-1 axis components. Previously, it was reported mRNA levels. The ability of SS to modulate the effects of
that SS-14 injection prior to seawater transfer decreased GH outside the pituitary at the level of target tissues
plasma GH levels in coho salmon (Sweeting and contributes to our understanding of the multifaceted SS
McKeown, 1987). Reduced seawater adaptability fol- signaling system and how the hormone may coordinate
lowing hypophysectomy can be partially rescued by GH osmoregulation with growth, development, reproduction,
(Bjornsson et al., 1987). Although exogenous GH and metabolism.
stimulates increased salinity tolerance and gill Na+,
K+-ATPase activity (Madsen and Bern, 1993), many of Acknowledgements
the effects of GH on osmoregulatory ability appear to be
indirect through the production of IGF-1. For example, We are grateful to Jun Yang-Gong, Laura Nelson,
GH in vitro does not affect gill Na+, K+-ATPase, but Lindsey Norbeck, Chirsty Theige, and Nicole Very for
IGF-1 does (Madsen and Bern, 1993; McCormick, their technical assistance. This work was supported by
1995). While Na+, K+-ATPase was used as an indicator NSF grant IOB 0444860 to MAS.
of hypoosmoregulatory ability, it is not the only protein
associated with gill ion transport in chloride cells. Na+/ References
K+/2Cl− co-transporter and cystic fibrosis transmem-
brane conductance regulator (CFTR) both are necessary Agustsson, T., Sundell, K., Sakamoto, T., Johansson, V., Ando, M.,
for ion excretion under the current model of gill chloride Bjornsson, B.Th., 2001. Growth hormone endocrinology of
function (McCormick, 1995, 2001; Marshall and Atlantic salmon (Salmo salar): pituitary gene expression, hormone
storage, secretion and plasma levels during parr–smolt transfor-
Bryson, 1998; Sakamoto et al., 2001; Hirose et al., mation. J. Endocrinol. 170, 227–234.
2003; McCormick et al., 2003). Increased levels of Biga, P.R., Schelling, G.T., Hardy, R.W., Cain, K.D., Overturf, K., Ott,
mRNA in gill for the above-mentioned proteins have T.L., 2004. The effects of recombinant bovine somatotropin (rbST)
8. J. Poppinga et al. / Aquaculture 273 (2007) 312–319 319
on tissue IGF-1, IGF-1 receptor, and GH mRNA levels in rainbow Pierce, A.L., Fukada, H., Dickhoff, W.W., 2005. Metabolic hormones
trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 135, modulate the effect of growth hormone (GH) on insulin-like
324–333. growth factor-I (IGF-1) mRNA level in primary culture of salmon
Bjornsson, B.Th., Yamauchi, K., Nishioka, R.S., Deftos, L.J., Bern, H.A., hepatocytes. J. Endocrinol. 184, 341–349.
1987. Effects of hypophysectomy and subsequent hormonal Sakamoto, T., Hirano, T., 1993. Expression of insulin-like growth
replacement therapy on hormonal and osmoregulatory status of factor I gene in osmoregulatory organs during seawater adaptation
coho salmon, Oncorhynchus kisutch. Gen. Comp. Endocrinol. 68, of the salmonid fish: possible mode of osmoregulatory action of
421–430. growth hormone. Proc. Natl. Acad. Sci. U. S. A. 90, 1912–1916.
Brazeau, P., Vale, W., Burgus, R., Ling, N., Butcher, M., Rivier, J., Sakamoto, T., Ogasawara, T., Hirano, T., 1990. Growth hormone
Gullemin, R., 1973. Hypothalamic polypeptide that inhibits the kinetics during adaptation to a hyperosmotic environment in
secretion of immunoreactive pituitary growth hormone. Science rainbow trout. J. Comp. Physiol., B 160, 1–6.
179, 77–79. Sakamoto, T., Uchida, K., Yokota, S., 2001. Regulation of the ion-
Evans, D.H., 2002. Cell signaling and ion transport across the fish gill transporting mitochondrion-rich cell during adaptation of teleost
epithelium. J. Exp. Biol. 293, 336–347. fishes to different salinities. Zool. Sci. 18, 1163–1174.
Foskett, J.K., Bern, H.A., Machen, T.E., Conner, M., 1983. Chloride Scott, G.R., Richards, J.G., Forbush, B., Isenring, P., Schulte, P.M.,
cells and the hormonal control of teleost fish osmoregulation. 2004. Changes in gene expression in gills of the euryhaline killifish
J. Exp. Biol. 106, 255–281. Fundulus heteroclitus after abrupt salinity transfer. Am. J. Physiol.
Hirose, S., Kaneko, T., Naito, N., Takei, Y., 2003. Molecular biology 287, C300–C309.
of major component of chloride cells. Comp. Biochem. Physiol., B Shepherd, B.S., Drennon, K., Johnson, J., Nichols, J.W., Playle, R.C.,
136, 593–620. Singer, T.D., Vijayan, M.M., 2005. Salinity acclimation affects the
Klein, S.E., Sheridan, M.A., in press. Somatostatin signaling and the somatotropic axis in rainbow trout. Amer. J. Physiol. 288,
regulation of growth and metabolism in fish. Mol. Cell. R1385–R1395.
Endocrinol. Sheridan, M.A., 1994. Regulation of lipid metabolism in poikilother-
Madsen, S.S., Bern, H.A., 1993. In vitro effects of insulin-like growth mic vertebrates. Comp. Biochem. Physiol., B 170, 495–508.
factor-I on gill Na+, K+-ATPase in coho salmon, Oncorhynchus Sheridan, M.A., Kittilson, J.D., 2004. The role of somatostatins in the
kisutch. J. Endocrinol. 138, 23–30. regulation of metabolism in fish. Comp. Biochem. Physiol., B 138,
Marshall, W.S., Bryson, S.E., 1998. Transport mechanisms of seawater 323–330.
teleost chloride cells: an inclusive model of a multifunctional cell. Sheridan, M.A., Eilertson, C.D., Kerstetter, T.H., 1998. Changes in
Comp. Biochem. Physiol., A. 119, 97–106. plasma somatostatin associated with seawater adaptation and
Mancera, J.M., McCormick, S.D., 1998. Evidence for growth hormone / stunting of coho salmon, Oncorhynchus kisutch. Aquaculture 168,
insulin-like growth factor I axis regulation of seawater acclimation in 195–203.
the euryhaline teleost Fundulus heteroclitus. Gen. Comp. Endocri- Sheridan, M.A., Kittilson, J.D., Slagter, B.J., 2000. Structure–function
nol. 11, 103–112. relationships of the signaling system for the somatostatin peptide
McCormick, S.D., 1993. Methods for non-lethal gill biopsy and hormone family. Am. Zool. 40, 269–286.
measurement of Na+, K+-ATPase activity. Can. J. Fish. Aquat. Sci. Slagter, B.J., Kittilson, J.D., Sheridan, M.A., 2004. Somatostatin
50, 656–658. receptor subtype 1 and subtype 2 mRNA expression is regulated by
McCormick, S.D., 1995. Hormonal control of gill Na+, K+-ATPase and nutritional state in rainbow trout (Oncorhynchus mykiss). Gen.
chloride cell function. In: Wood, C.M., Shuttleworh, T.J. (Eds.), Comp. Endocrinol. 139, 236–244.
Cellular and Molecular Approaches to Fish Ionic Regulation. Fish Sweeting, R.M., McKeown, B.A., 1987. Growth hormone and
Physiology, vol. 14. Academic Press, New York, pp. 285–315. seawater adaptation in coho salmon, Oncorhynchus kisutch.
McCormick, S.D., 2001. Endocrine control of osmoregulation in Comp. Biochem. Physiol., A 88, 147–151.
teleost fish. Am. Zool. 41, 781–794. Thorpe, J.E., McConway, M.G., Miles, M.S., Muir, J.S., 1987. Diel
McCormick, S.D., Kakamoto, T., Hasegawa, S., Hirano, I., 1991. and seasonal changes in resting plasma cortisol levels in juvenile
Osmoregulatory actions of insulin-like growth factor-I in rainbow Atlantic salmon, Salmo salar L. Gen. Comp. Endocrinol. 65,
trout (Oncorhynchus mykiss). J. Endocrinol. 130, 87–92. 19–22.
McCormick, S.D., Moriyama, S., Bjornsson, B.T., 2000. Low Very, N.M., Sheridan, M.A., 2002. The role of somatostatins in the
temperature limits photoperiod control of smolting in Atlantic regulation of growth in fish. Fish Physiol. Biochem. 27, 217–226.
salmon through endocrine mechanisms. Am. J. Physiol. 278, Very, N.M., Kittilson, J.D., Norbeck, L.A., Sheridan, M.A., 2005.
R1352–R1361. Isolation, characterization, and distribution of two cDNAs encod-
McCormick, S.D., Sundell, K., Bjornsson, B.T., Brown, C.L., Hiroi, J., ing for growth hormone receptor in rainbow trout (Oncorhynchus
2003. Influence of salinity on the localization of Na+, K+-ATPase, mykiss). Comp. Biochem. Physiol., B 140, 615–628.
Na+/K+2Cl− cotransporter (NKCC) and CFTR anion channel in Young, G., Bjornsson, B.T., Prunet, P., Lin, R.J., Bern, H.A., 1989.
chloride cells of the Hawaiian goby (Stenogobius hawaiiensis). Smoltification and seawater adaptation in coho salmon (Oncorhynchus
J. Exp. Biol. 206, 4575–4583. kisutch): plasma prolactin, growth hormone, thyroid hormones, and
Nelson, L.E., Sheridan, M.A., 2005. Regulation of somatostatins and cortisol. Gen. Comp. Endocrinol. 74, 335–345.
their receptors in fish. Gen. Comp. Endocrinol. 143, 117–133.