Cloning of the c dna for thyroid stimulating hormone subunit and changes in activity of the pituitary–thyroid axis during silvering of the japanese eel, anguilla japonica
1) The researchers cloned the cDNA for the thyroid stimulating hormone beta subunit (TSHβ) of the Japanese eel (Anguilla japonica) and investigated changes in the pituitary-thyroid axis during silvering.
2) They found the TSHβ gene contains two introns and three exons, and the protein has a signal peptide and mature peptide. The TSHβ sequence is highly similar to other fish species.
3) In vitro, thyrotropin-releasing hormone increased while thyroxine decreased TSHβ mRNA expression in cultured pituitaries. TSHβ mRNA and serum thyroxine levels both increased during silvering in wild female eels, supporting the
This study investigated the role of peptidergic input in modulating respiratory rhythm and frequency in the preBötzinger Complex (preBötC), the hypothesized site of respiratory rhythm generation in mammals. The key findings were:
1) Application of NK1R and μ-opioid receptor agonists into the preBötC increased and decreased respiratory frequency, respectively, and these effects were independent of GABA and glycine transmission.
2) NK1R and μ-opioid receptor expression was concentrated in the preBötC region, defining its anatomical boundaries.
3) Subsets of preBötC neurons expressed both NK1Rs and μ-opioid
This study examined the effects of fluoranthene (FLA) exposure on Xenopus laevis embryos. The key findings were:
1) Exposure to FLA was associated with abnormal cardiac pacemaker and conduction activity, including tachycardia and atrioventricular block.
2) FLA exposure increased expression of the cytochrome P450 gene CYP1A, suggesting it acts as an aryl hydrocarbon receptor agonist.
3) Low doses of FLA increased expression of the cardiac transcription factors tbx5 and nkx2.5, which are essential for heart development, suggesting a potential low-dose effect.
Expression of Glutaminase and Vesicular Glutamate Transporter Type 2 Immunore...Heith Crosby
This study examined the effects of a surgical tail incision on glutaminase (GLS) and vesicular glutamate transporter type 2 (VGluT2) expression in sacral dorsal root ganglia (DRG) neurons in rats. The researchers found that sacral DRG neurons innervate the area of surgical incision using retrograde tracing. Both GLS and VGluT2 immunoreactivity were elevated in sacral DRG neurons for up to 72 hours post-incision, while GLS mRNA levels rapidly decreased and remained depressed for at least 96 hours. The rapid depletion of GLS mRNA and subsequent elevation of GLS and VGluT2 proteins in sacral DRG neurons following surgical incision
This document discusses how temperature affects lifespan and healthspan in C. elegans. Microarray analysis found that over 300 genes are differentially expressed between worms grown at 15°C vs 25°C, including several proteases that are elevated at 15°C. Knocking down one such protease, cpr-7, leads to paralysis and decreased lifespan at 15°C but increased lifespan at 25°C, showing it has opposite effects at different temperatures. Mutations in the daf-2 gene, which influences insulin signaling, also alter the worm's temperature-dependent response, with different daf-2 alleles showing varying transcriptional responses to temperature. This suggests daf-2 mutants have distinct mechanisms for responding to temperature compared
Cloning and extracellular expression of recombinant tissue plasminogen activa...bioejjournal
This document summarizes research conducted to clone and express recombinant tissue plasminogen activator (rt-PA) using the methylotrophic yeast Pichia pastoris. Specifically, the tissue plasminogen activator gene was cloned into the pICZαA expression vector. This construct was then transformed into Pichia pastoris X33 cells. One transformant, named Pichia tPA-3, showed expression of rt-PA at 66 kDa on SDS-PAGE. Size exclusion chromatography also showed a product peak at the same retention time as a reference tPA standard. Thus, the researchers were able to successfully clone and express rt-PA in the Pichia pastoris system.
Cloning and extracellular expression of recombinant tissue plasminogen activa...bioejjournal
Tissue plasminogen activator (tPA) has noteworthy application in treatment of acute myocardial
infarctions. This study focuses on expression of rt-PA using microbial systems in order to reduce cost
without compromising on quality as an alternative to commercial (rt-PA)produced by using mammalian
host systems. In the present study, Pichia pastoris X-33strain was used as a host with pICZαA expression
vector to obtain extracellular expression of full length tPA gene. Specific primers were designed in such a
way to get native tPA protein sequence in subsequent purification steps. Further, construct pICZαA-tPA
was developed and electroporated into host to achieve stablert-PA gene by achieving genome integration. The transformants were screened for phenotypic characters.Mut+
phenotypic colony named Pichia tPA-3
showed expression of rt-PA at 66 kDa on SDS PAGE. Size Exclusion Chromatography (SEC) was
performed, resulting in product peak at same RT as reference standard. (alteplase).Cloning and expression
of rt-PA was successfully achieved in microbial system. Further process optimization at larger scales will surely provide cost effective alternative to mammalian system forrt-PA production
Cloning and Extracellular Expression of Recombinant Tissue Plasminogen Activa...bioejjournal
This document summarizes research conducted to clone and express recombinant tissue plasminogen activator (rt-PA) using the methylotrophic yeast Pichia pastoris. Specifically, the full-length tPA gene was amplified by PCR and cloned into the pICZαA expression vector. This construct was then transformed into Pichia pastoris X33 cells. One transformant, named Pichia tPA-3, showed extracellular expression of rt-PA at 66 kDa on SDS-PAGE after induction with methanol over 144 hours. Size exclusion chromatography of samples from this transformant showed a product peak at the same retention time as a reference tPA standard. Thus, the researchers successfully achieved cloning and extracellular expression of
Cytokines play an important role in regulating lymphocyte development and differentiation. The authors identified a cytokine-inducible protein called Cybr that binds to and regulates the activity of cytohesin-1. Cybr expression is increased by IL-2 and IL-12 and is most abundant in hematopoietic cells and tissues. Cybr physically interacts with cytohesin-1 through their coiled-coil domains and enhances cytohesin-1's ability to catalyze guanine nucleotide exchange on ARF GTPases. As Cybr modifies the activity of cytohesin-1, the authors designate it as a cytohesin binder and regulator.
This study investigated the role of peptidergic input in modulating respiratory rhythm and frequency in the preBötzinger Complex (preBötC), the hypothesized site of respiratory rhythm generation in mammals. The key findings were:
1) Application of NK1R and μ-opioid receptor agonists into the preBötC increased and decreased respiratory frequency, respectively, and these effects were independent of GABA and glycine transmission.
2) NK1R and μ-opioid receptor expression was concentrated in the preBötC region, defining its anatomical boundaries.
3) Subsets of preBötC neurons expressed both NK1Rs and μ-opioid
This study examined the effects of fluoranthene (FLA) exposure on Xenopus laevis embryos. The key findings were:
1) Exposure to FLA was associated with abnormal cardiac pacemaker and conduction activity, including tachycardia and atrioventricular block.
2) FLA exposure increased expression of the cytochrome P450 gene CYP1A, suggesting it acts as an aryl hydrocarbon receptor agonist.
3) Low doses of FLA increased expression of the cardiac transcription factors tbx5 and nkx2.5, which are essential for heart development, suggesting a potential low-dose effect.
Expression of Glutaminase and Vesicular Glutamate Transporter Type 2 Immunore...Heith Crosby
This study examined the effects of a surgical tail incision on glutaminase (GLS) and vesicular glutamate transporter type 2 (VGluT2) expression in sacral dorsal root ganglia (DRG) neurons in rats. The researchers found that sacral DRG neurons innervate the area of surgical incision using retrograde tracing. Both GLS and VGluT2 immunoreactivity were elevated in sacral DRG neurons for up to 72 hours post-incision, while GLS mRNA levels rapidly decreased and remained depressed for at least 96 hours. The rapid depletion of GLS mRNA and subsequent elevation of GLS and VGluT2 proteins in sacral DRG neurons following surgical incision
This document discusses how temperature affects lifespan and healthspan in C. elegans. Microarray analysis found that over 300 genes are differentially expressed between worms grown at 15°C vs 25°C, including several proteases that are elevated at 15°C. Knocking down one such protease, cpr-7, leads to paralysis and decreased lifespan at 15°C but increased lifespan at 25°C, showing it has opposite effects at different temperatures. Mutations in the daf-2 gene, which influences insulin signaling, also alter the worm's temperature-dependent response, with different daf-2 alleles showing varying transcriptional responses to temperature. This suggests daf-2 mutants have distinct mechanisms for responding to temperature compared
Cloning and extracellular expression of recombinant tissue plasminogen activa...bioejjournal
This document summarizes research conducted to clone and express recombinant tissue plasminogen activator (rt-PA) using the methylotrophic yeast Pichia pastoris. Specifically, the tissue plasminogen activator gene was cloned into the pICZαA expression vector. This construct was then transformed into Pichia pastoris X33 cells. One transformant, named Pichia tPA-3, showed expression of rt-PA at 66 kDa on SDS-PAGE. Size exclusion chromatography also showed a product peak at the same retention time as a reference tPA standard. Thus, the researchers were able to successfully clone and express rt-PA in the Pichia pastoris system.
Cloning and extracellular expression of recombinant tissue plasminogen activa...bioejjournal
Tissue plasminogen activator (tPA) has noteworthy application in treatment of acute myocardial
infarctions. This study focuses on expression of rt-PA using microbial systems in order to reduce cost
without compromising on quality as an alternative to commercial (rt-PA)produced by using mammalian
host systems. In the present study, Pichia pastoris X-33strain was used as a host with pICZαA expression
vector to obtain extracellular expression of full length tPA gene. Specific primers were designed in such a
way to get native tPA protein sequence in subsequent purification steps. Further, construct pICZαA-tPA
was developed and electroporated into host to achieve stablert-PA gene by achieving genome integration. The transformants were screened for phenotypic characters.Mut+
phenotypic colony named Pichia tPA-3
showed expression of rt-PA at 66 kDa on SDS PAGE. Size Exclusion Chromatography (SEC) was
performed, resulting in product peak at same RT as reference standard. (alteplase).Cloning and expression
of rt-PA was successfully achieved in microbial system. Further process optimization at larger scales will surely provide cost effective alternative to mammalian system forrt-PA production
Cloning and Extracellular Expression of Recombinant Tissue Plasminogen Activa...bioejjournal
This document summarizes research conducted to clone and express recombinant tissue plasminogen activator (rt-PA) using the methylotrophic yeast Pichia pastoris. Specifically, the full-length tPA gene was amplified by PCR and cloned into the pICZαA expression vector. This construct was then transformed into Pichia pastoris X33 cells. One transformant, named Pichia tPA-3, showed extracellular expression of rt-PA at 66 kDa on SDS-PAGE after induction with methanol over 144 hours. Size exclusion chromatography of samples from this transformant showed a product peak at the same retention time as a reference tPA standard. Thus, the researchers successfully achieved cloning and extracellular expression of
Cytokines play an important role in regulating lymphocyte development and differentiation. The authors identified a cytokine-inducible protein called Cybr that binds to and regulates the activity of cytohesin-1. Cybr expression is increased by IL-2 and IL-12 and is most abundant in hematopoietic cells and tissues. Cybr physically interacts with cytohesin-1 through their coiled-coil domains and enhances cytohesin-1's ability to catalyze guanine nucleotide exchange on ARF GTPases. As Cybr modifies the activity of cytohesin-1, the authors designate it as a cytohesin binder and regulator.
This document summarizes Angela Sanchez's research on how temperature-regulated genes affect aging in C. elegans. Key findings include:
- Many proteostasis and protein synthesis genes are differentially expressed between 15°C and 25°C.
- Inhibition of certain temperature-regulated proteostasis genes, like cpr-7 and egl-45, causes earlier onset of paralysis at 15°C but not 25°C.
- A neuromuscular exam showed locomotion defects, especially in backward movement, precede paralysis upon proteostasis gene inhibition. This suggests the dysfunction starts in motor neurons.
- Motor neurons innervating the posterior half have fewer synaptic connections, which
This study identifies the zinc transporter ZIP4 as mediating tissue plasminogen activator (tPA)'s ability to promote zinc uptake into neurons in a neuroprotective manner. ZIP4 expression is increased after excitotoxin stimulation in mouse hippocampus. ZIP4 physically interacts with tPA, leading to increased intracellular zinc sequestration in lysosomes. This sequestration protects neurons from the toxic effects of excessive extracellular zinc levels released during seizures or excitotoxicity.
This study examined the effect of two missense mutations in the quinonoid dihydropteridine reductase (QDPR) gene on serotonin production in the nematode C. elegans. The researcher selected two mutant C. elegans strains, each containing a single amino acid substitution in the QDPR protein. Immunofluorescence staining for serotonin was performed on the mutant strains and compared to wild-type and a serotonin-deficient cat-4 mutant strain. The results showed that both QDPR mutant strains exhibited normal serotonin staining, similar to wild-type levels, indicating the mutations do not affect serotonin synthesis. This suggests that these particular amino acid changes in the QDPR protein do not significantly impact its
1) PSF, a pre-mRNA splicing factor, was identified as a constituent of PER complexes purified from mouse tissues.
2) PSF recruits the SIN3A-HDAC complex to the Per1 promoter in a circadian manner through interactions with PER complexes.
3) Recruitment of the SIN3A-HDAC complex by the PER complex leads to histone deacetylation at the Per1 promoter, providing a molecular mechanism for circadian clock negative feedback through rhythmic repression of Per1 transcription.
1) Rainbow trout were injected with somatostatin-14 (SS-14) or saline and transferred to 20 ppt seawater to examine the effects of SS-14 on the GH-IGF-1 axis and seawater adaptation.
2) SS-14 treated fish showed slightly elevated plasma chloride levels and reduced gill Na+,K+-ATPase activity compared to controls 12 hours after transfer.
3) Transfer to seawater increased mRNA levels of GH receptor 1, GH receptor 2, and IGF-1 in the liver and gills of control fish but SS-14 abolished or attenuated these increases, indicating SS-14 reduces seawater adaptability by inhibiting the GH-
A reading report for <A Secreted Slit2 Fragment Regulates Adipose Tissue Ther...星云 王
A reading report for <A Secreted Slit2 Fragment Regulates Adipose Tissue Thermogenesis and Metabolic Function
>, only for private study use, please do not use it for profit or public.
A presentation in the IMBIM-IGP Friday seminar on Nov 27th 2015.
I wanted to highlight recent discoveries in chromatin topographic domains (or TADs). The importance of CTCFs in the organization and discuss general implications in the discovery of causative mutations.
I also highlighted some of the available protocols to assay chromatin organization, both genome-wide and locus-centered.
This document summarizes a thesis project investigating the regulation of the anaerobic responsive transcription factor TdcA in Salmonella Typhimurium. The project aims to construct Salmonella strains with deletions or tags of genes involved in regulating tdcA expression, and to analyze the effects on tdcA transcription and protein binding to its promoter region. Specifically, the project will create ∆tdcA and tdcA-FLAG strains to identify members of the TdcA regulon, and use transcriptional analysis and chromatin immunoprecipitation to study how proteins like CRP, FNR, and H-NS regulate tdcA expression in Salmonella. Understanding TdcA regulation is important because it plays a role in Salmon
This document investigates whether two Arabidopsis thaliana proteins, AtFHIT and AtHINT2, localize to peroxisomes. The authors hypothesized that these proteins may localize to peroxisomes based on other proteins in the same family being peroxisomal. They used radiolabeled protein transcription/translation assays to test for peroxisomal targeting signal processing, which would indicate peroxisomal localization, but found only minimal processing for AtFHIT and AtHINT2. They conclude the in vitro results are inconclusive and in vivo experiments are still needed to determine peroxisomal localization of these proteins.
IRJET- Silencing of hnRNP A1 and hnRNP A2/B1 Downregulates the Expression of ...IRJET Journal
The document summarizes a study that examined the effect of silencing hnRNP A1 and hnRNP A2/B1 splice factors on the expression of CD44v6 and CD44v10 exons in glioma cells. The researchers found that knockdown of hnRNP A1 and hnRNP A2/B1 led to decreased expression of CD44v6 and CD44v10 exons based on qRT-PCR analysis. Specifically, cells with silenced splice factors had lower expression of the two exons compared to non-silenced control cells. Therefore, hnRNP A1 and hnRNP A2/B1 may positively regulate the expression of
Thant Bio Symposium Poster Spring 2016Claire Thant
The study found that axonal transport defects activate the PI3K pathway in an attempt to reduce oxidative stress and neuronal cell death in neurodegenerative disease models. Expressing constitutively active PI3K decreased cell death caused by polyQ repeats and Paraquat exposure but did not affect axonal transport blockages. Dominant negative PI3K disrupted normal huntingtin motility, indicating PI3K acts downstream of transport. Motor protein mutations and disease models showed increased levels of p-GSK3β, a PI3K effector, suggesting transport defects trigger the protective PI3K response.
The DIONESUS algorithm provides a scalable and accurate method to reconstruct dynamic phosphoproteomic networks and reveal new drug targets. The document describes an experiment where the DIONESUS algorithm was applied to phosphorylation kinetics data from panels of growth factors, small molecule inhibitors, and antioxidants tested on A431 cells. Inhibition of SRC family kinases or PLCγ pathways attenuated EGF-stimulated cell death, while inhibition of PI3K, autocrine signaling pathways, or antioxidants decreased cell viability. The phosphorylation profiles informed dynamic network modeling to infer signaling pathways and potential drug targets.
This summary provides the key points from the document in 3 sentences:
The document discusses a study that conditionally deleted the GATA4 and GATA6 transcription factor genes in mouse adrenocortical cells. The researchers found that mice with double deletion of these genes lacked identifiable adrenal glands, adrenocortical cells, and steroidogenic gene expression. Additionally, deletion of GATA6 alone significantly reduced adrenal size and function in adult mice, revealing that GATA factors are required for proper adrenal development and function.
The document discusses strategies used in cell cycle research. It describes the history of cell cycle research from the 1970s discovery of MPF (Maturation Promoting Factor) to current understanding of complex regulation involving cyclins and CDKs (Cyclin-Dependent Kinases). Key developments include identifying homologs of cdc2/CDC28 genes and establishing their role in controlling the cell cycle as catalytic subunits of MPF/H1 kinase complexes with cyclins. Understanding cell cycle regulation provides insights into uncontrolled proliferation in diseases like cancer.
Translational Control of Autism Spectrum Disorders in Eif4ebp2 knockout Mouse...Rey Christian Pacis
1) NKCC1, a chloride importer implicated in autism, is upregulated in Eif4ebp2 knockout mice compared to wildtype. This may cause excitatory-inhibitory imbalances linked to autism.
2) Phosphorylated forms of eIF4E, mTOR, and ERK are also upregulated in knockouts, and may be important in translational control of NKCC1. Total eIF4E is downregulated.
3) Total levels of mTOR, ERK, and Akt, as well as phosphorylated Akt, show trends of change but are not significantly different between knockout and wildtype mice.
Bioinformatic data analysis – comparison from three human studies using diffe...Agnieszka Caruso
This document summarizes three bioinformatics studies comparing gene expression data from human samples using different Affymetrix platforms: 1) comparing periodontal ligament and gingival cells, 2) identifying genes regulated by nuclear IGFBP5 in osteoblasts, and 3) effects of LPS on osteoblasts. Key findings include identification of differentially expressed genes and biological processes between tissue types in study 1, and processes related to cell cycle, proliferation and splicing regulated by IGFBP5 in study 2. Study 3 on LPS effects found upregulation of factors stimulating osteoclasts and downregulation of processes like mitosis and cell cycle. The document discusses analysis tools and validation of array results.
1) The study investigated the role of the LAT-PLCγ1 interaction in γδ T cell development and homeostasis by crossing LATY136F mice, which lack this interaction, with TCRβ−/− mice.
2) Results showed the LATY136F mutation partially blocked γδ T cell development in the thymus. However, epithelial γδ T cells were still present in the skin and intestine.
3) Interestingly, a population of CD4+ γδ T cells in the spleen and lymph nodes of LATY136F/TCRβ−/− mice underwent rapid proliferation, producing elevated IL-4 and causing autoimmunity. This suggested LAT signaling functions differently in distinct
1. There is a pre-existing pool of miR-34 in cells that is not competent to silence gene expression. This pool is rapidly activated by ionizing radiation (IR) through a Dicer-independent mechanism several hours before p53-mediated transcription.
2. The study found that ATM is required for the early activation of miR-34 following IR, whereas p53 is required for later activation. ATM is necessary for the 5'-end phosphorylation of miR-34, which is required for its activity.
3. The activation of miR-34 by IR occurs by regulating the mature microRNA and does not require the normal microRNA biogenesis pathway. Specifically, miR-34 is loaded into
The document discusses how AP-2α induces apoptosis in cancer cells. It finds that AP-2α activates the intrinsic apoptosis pathway by binding to the Bcl-2 promoter and repressing its transcription. This allows Bax to translocate to mitochondria, disrupt membrane potential, and release cytochrome c, activating caspase-9 and caspase-3. Downregulation of anti-apoptotic Bcl-2 is important for AP-2α-induced apoptosis. Overexpressing AP-2α enhances cancer cell chemosensitivity to various drugs.
This study examined the effects of di-(2-ethylhexyl) phthalate (DEHP) exposure on the uterus of adult female rats. Rats were orally administered DEHP at doses of 0, 1, 10, and 100 mg/kg body weight daily for 30 days. Key findings include:
1) Serum estradiol levels were unchanged in the 1 and 10 mg groups but marginally increased in the 100 mg group. Progesterone levels increased in the 1 and 10 mg groups.
2) Histological examination found structural abnormalities in the uterus such as decreased diameter and thinning of layers in the 10 and 100 mg groups.
3) mRNA expression of estrogen receptor alpha decreased in the 100 mg
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
This document summarizes Angela Sanchez's research on how temperature-regulated genes affect aging in C. elegans. Key findings include:
- Many proteostasis and protein synthesis genes are differentially expressed between 15°C and 25°C.
- Inhibition of certain temperature-regulated proteostasis genes, like cpr-7 and egl-45, causes earlier onset of paralysis at 15°C but not 25°C.
- A neuromuscular exam showed locomotion defects, especially in backward movement, precede paralysis upon proteostasis gene inhibition. This suggests the dysfunction starts in motor neurons.
- Motor neurons innervating the posterior half have fewer synaptic connections, which
This study identifies the zinc transporter ZIP4 as mediating tissue plasminogen activator (tPA)'s ability to promote zinc uptake into neurons in a neuroprotective manner. ZIP4 expression is increased after excitotoxin stimulation in mouse hippocampus. ZIP4 physically interacts with tPA, leading to increased intracellular zinc sequestration in lysosomes. This sequestration protects neurons from the toxic effects of excessive extracellular zinc levels released during seizures or excitotoxicity.
This study examined the effect of two missense mutations in the quinonoid dihydropteridine reductase (QDPR) gene on serotonin production in the nematode C. elegans. The researcher selected two mutant C. elegans strains, each containing a single amino acid substitution in the QDPR protein. Immunofluorescence staining for serotonin was performed on the mutant strains and compared to wild-type and a serotonin-deficient cat-4 mutant strain. The results showed that both QDPR mutant strains exhibited normal serotonin staining, similar to wild-type levels, indicating the mutations do not affect serotonin synthesis. This suggests that these particular amino acid changes in the QDPR protein do not significantly impact its
1) PSF, a pre-mRNA splicing factor, was identified as a constituent of PER complexes purified from mouse tissues.
2) PSF recruits the SIN3A-HDAC complex to the Per1 promoter in a circadian manner through interactions with PER complexes.
3) Recruitment of the SIN3A-HDAC complex by the PER complex leads to histone deacetylation at the Per1 promoter, providing a molecular mechanism for circadian clock negative feedback through rhythmic repression of Per1 transcription.
1) Rainbow trout were injected with somatostatin-14 (SS-14) or saline and transferred to 20 ppt seawater to examine the effects of SS-14 on the GH-IGF-1 axis and seawater adaptation.
2) SS-14 treated fish showed slightly elevated plasma chloride levels and reduced gill Na+,K+-ATPase activity compared to controls 12 hours after transfer.
3) Transfer to seawater increased mRNA levels of GH receptor 1, GH receptor 2, and IGF-1 in the liver and gills of control fish but SS-14 abolished or attenuated these increases, indicating SS-14 reduces seawater adaptability by inhibiting the GH-
A reading report for <A Secreted Slit2 Fragment Regulates Adipose Tissue Ther...星云 王
A reading report for <A Secreted Slit2 Fragment Regulates Adipose Tissue Thermogenesis and Metabolic Function
>, only for private study use, please do not use it for profit or public.
A presentation in the IMBIM-IGP Friday seminar on Nov 27th 2015.
I wanted to highlight recent discoveries in chromatin topographic domains (or TADs). The importance of CTCFs in the organization and discuss general implications in the discovery of causative mutations.
I also highlighted some of the available protocols to assay chromatin organization, both genome-wide and locus-centered.
This document summarizes a thesis project investigating the regulation of the anaerobic responsive transcription factor TdcA in Salmonella Typhimurium. The project aims to construct Salmonella strains with deletions or tags of genes involved in regulating tdcA expression, and to analyze the effects on tdcA transcription and protein binding to its promoter region. Specifically, the project will create ∆tdcA and tdcA-FLAG strains to identify members of the TdcA regulon, and use transcriptional analysis and chromatin immunoprecipitation to study how proteins like CRP, FNR, and H-NS regulate tdcA expression in Salmonella. Understanding TdcA regulation is important because it plays a role in Salmon
This document investigates whether two Arabidopsis thaliana proteins, AtFHIT and AtHINT2, localize to peroxisomes. The authors hypothesized that these proteins may localize to peroxisomes based on other proteins in the same family being peroxisomal. They used radiolabeled protein transcription/translation assays to test for peroxisomal targeting signal processing, which would indicate peroxisomal localization, but found only minimal processing for AtFHIT and AtHINT2. They conclude the in vitro results are inconclusive and in vivo experiments are still needed to determine peroxisomal localization of these proteins.
IRJET- Silencing of hnRNP A1 and hnRNP A2/B1 Downregulates the Expression of ...IRJET Journal
The document summarizes a study that examined the effect of silencing hnRNP A1 and hnRNP A2/B1 splice factors on the expression of CD44v6 and CD44v10 exons in glioma cells. The researchers found that knockdown of hnRNP A1 and hnRNP A2/B1 led to decreased expression of CD44v6 and CD44v10 exons based on qRT-PCR analysis. Specifically, cells with silenced splice factors had lower expression of the two exons compared to non-silenced control cells. Therefore, hnRNP A1 and hnRNP A2/B1 may positively regulate the expression of
Thant Bio Symposium Poster Spring 2016Claire Thant
The study found that axonal transport defects activate the PI3K pathway in an attempt to reduce oxidative stress and neuronal cell death in neurodegenerative disease models. Expressing constitutively active PI3K decreased cell death caused by polyQ repeats and Paraquat exposure but did not affect axonal transport blockages. Dominant negative PI3K disrupted normal huntingtin motility, indicating PI3K acts downstream of transport. Motor protein mutations and disease models showed increased levels of p-GSK3β, a PI3K effector, suggesting transport defects trigger the protective PI3K response.
The DIONESUS algorithm provides a scalable and accurate method to reconstruct dynamic phosphoproteomic networks and reveal new drug targets. The document describes an experiment where the DIONESUS algorithm was applied to phosphorylation kinetics data from panels of growth factors, small molecule inhibitors, and antioxidants tested on A431 cells. Inhibition of SRC family kinases or PLCγ pathways attenuated EGF-stimulated cell death, while inhibition of PI3K, autocrine signaling pathways, or antioxidants decreased cell viability. The phosphorylation profiles informed dynamic network modeling to infer signaling pathways and potential drug targets.
This summary provides the key points from the document in 3 sentences:
The document discusses a study that conditionally deleted the GATA4 and GATA6 transcription factor genes in mouse adrenocortical cells. The researchers found that mice with double deletion of these genes lacked identifiable adrenal glands, adrenocortical cells, and steroidogenic gene expression. Additionally, deletion of GATA6 alone significantly reduced adrenal size and function in adult mice, revealing that GATA factors are required for proper adrenal development and function.
The document discusses strategies used in cell cycle research. It describes the history of cell cycle research from the 1970s discovery of MPF (Maturation Promoting Factor) to current understanding of complex regulation involving cyclins and CDKs (Cyclin-Dependent Kinases). Key developments include identifying homologs of cdc2/CDC28 genes and establishing their role in controlling the cell cycle as catalytic subunits of MPF/H1 kinase complexes with cyclins. Understanding cell cycle regulation provides insights into uncontrolled proliferation in diseases like cancer.
Translational Control of Autism Spectrum Disorders in Eif4ebp2 knockout Mouse...Rey Christian Pacis
1) NKCC1, a chloride importer implicated in autism, is upregulated in Eif4ebp2 knockout mice compared to wildtype. This may cause excitatory-inhibitory imbalances linked to autism.
2) Phosphorylated forms of eIF4E, mTOR, and ERK are also upregulated in knockouts, and may be important in translational control of NKCC1. Total eIF4E is downregulated.
3) Total levels of mTOR, ERK, and Akt, as well as phosphorylated Akt, show trends of change but are not significantly different between knockout and wildtype mice.
Bioinformatic data analysis – comparison from three human studies using diffe...Agnieszka Caruso
This document summarizes three bioinformatics studies comparing gene expression data from human samples using different Affymetrix platforms: 1) comparing periodontal ligament and gingival cells, 2) identifying genes regulated by nuclear IGFBP5 in osteoblasts, and 3) effects of LPS on osteoblasts. Key findings include identification of differentially expressed genes and biological processes between tissue types in study 1, and processes related to cell cycle, proliferation and splicing regulated by IGFBP5 in study 2. Study 3 on LPS effects found upregulation of factors stimulating osteoclasts and downregulation of processes like mitosis and cell cycle. The document discusses analysis tools and validation of array results.
1) The study investigated the role of the LAT-PLCγ1 interaction in γδ T cell development and homeostasis by crossing LATY136F mice, which lack this interaction, with TCRβ−/− mice.
2) Results showed the LATY136F mutation partially blocked γδ T cell development in the thymus. However, epithelial γδ T cells were still present in the skin and intestine.
3) Interestingly, a population of CD4+ γδ T cells in the spleen and lymph nodes of LATY136F/TCRβ−/− mice underwent rapid proliferation, producing elevated IL-4 and causing autoimmunity. This suggested LAT signaling functions differently in distinct
1. There is a pre-existing pool of miR-34 in cells that is not competent to silence gene expression. This pool is rapidly activated by ionizing radiation (IR) through a Dicer-independent mechanism several hours before p53-mediated transcription.
2. The study found that ATM is required for the early activation of miR-34 following IR, whereas p53 is required for later activation. ATM is necessary for the 5'-end phosphorylation of miR-34, which is required for its activity.
3. The activation of miR-34 by IR occurs by regulating the mature microRNA and does not require the normal microRNA biogenesis pathway. Specifically, miR-34 is loaded into
The document discusses how AP-2α induces apoptosis in cancer cells. It finds that AP-2α activates the intrinsic apoptosis pathway by binding to the Bcl-2 promoter and repressing its transcription. This allows Bax to translocate to mitochondria, disrupt membrane potential, and release cytochrome c, activating caspase-9 and caspase-3. Downregulation of anti-apoptotic Bcl-2 is important for AP-2α-induced apoptosis. Overexpressing AP-2α enhances cancer cell chemosensitivity to various drugs.
Similar to Cloning of the c dna for thyroid stimulating hormone subunit and changes in activity of the pituitary–thyroid axis during silvering of the japanese eel, anguilla japonica
This study examined the effects of di-(2-ethylhexyl) phthalate (DEHP) exposure on the uterus of adult female rats. Rats were orally administered DEHP at doses of 0, 1, 10, and 100 mg/kg body weight daily for 30 days. Key findings include:
1) Serum estradiol levels were unchanged in the 1 and 10 mg groups but marginally increased in the 100 mg group. Progesterone levels increased in the 1 and 10 mg groups.
2) Histological examination found structural abnormalities in the uterus such as decreased diameter and thinning of layers in the 10 and 100 mg groups.
3) mRNA expression of estrogen receptor alpha decreased in the 100 mg
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
1) Cool temperature correlates with longevity in C. elegans, calorie restricted mice, Ames dwarfs, and long-lived humans. However, the underlying mechanisms were not understood.
2) Using C. elegans, the author found that genes in the pro-aging branches of the unfolded protein response (UPR) pathway, such as pek-1 and atf-6, negatively correlate with longevity, while inhibition of these genes increases lifespan.
3) Cool temperature may promote longevity by inhibiting the pro-aging branches of the UPR pathway, similarly to genetic inhibition of these genes. Understanding how cool temperature interacts with the UPR could provide insights into mechanisms of aging.
Bay Scallop Genetic Resources and Applicationssr320
This document discusses genomic resources for the bay scallop, including its use as a fishery and aquaculture product. It summarizes research on genes involved in scallop metamorphosis and muscle growth. Specifically, it examines differentially expressed genes during metamorphosis and the role of the myostatin gene in muscle growth, finding it is highly expressed in scallop adductor muscle tissue. The document also discusses using ESTs and markers for environmental response, population genetics, and restoration.
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...Medical Education Advising
The Ciliate Protozoan Tetrahymena thermophila as an important animal model organism
Dr. R.E. Pearlman, York University
Models of Human Diseases Conference
June 29, 2010
Induced Expression of CYP1A by Triclosan in Zebra Fish to measure toxicologic...Mujtaba Qureshi
1) The study examines the effects of triclosan exposure on zebrafish by observing changes in expression of the CYP1A and TCF3A genes.
2) Using qPCR, the study found a 250% increase in CYP1A expression in triclosan-treated zebrafish compared to controls, indicating triclosan exposure induces CYP1A expression. However, a 9% increase in TCF3A expression in treated fish was not statistically significant.
3) EROD assays were also used to measure CYP1A activity, showing triclosan exposure induces CYP1A enzyme activity in zebrafish. The study suggests further research is
Temporal-Spatial Expressions of Spy1 in Rat Sciatic Nerve After CrushJiao Yang
1. The study examined the expression of the cell cycle protein Spy1 in a rat sciatic nerve crush injury model over time.
2. Spy1 expression was found to gradually increase after injury, peaking at day 3, due to increased expression in both axons and Schwann cells.
3. Spy1 expression correlated with Schwann cell proliferation after injury and Spy1 was found to localize in axons in the injured segment but did not co-localize with the growth protein GAP43.
This document summarizes a seminar presentation on the role of proteostasis and the unfolded protein response (UPR) pathway in longevity in C. elegans. Key findings include:
1) Inhibition of pro-aging branches of the UPR, including hsp-3 and hsp-4, increases lifespan in C. elegans, similarly to reduced temperature or mutation in the insulin/IGF receptor gene daf-2.
2) Both reduced temperature and daf-2 mutation promote longevity by reducing levels of hsp-3 and hsp-4, representing a shared mechanism.
3) Elements of the UPR pathway, including pek-1 and atf-6, act in a
This document describes a study that examined the effects of exogenous melatonin on thyroid hormone levels and melatonin receptor expression in the thyroid glands of male and female mice of different ages. The study found that melatonin treatment inhibited thyroid hormone (T4) levels through unchanged TSH in young male mice but increased both T4 and TSH in older males. In females, melatonin elevated T4 without changing TSH across all ages. Melatonin decreased MT1 receptor expression in both sexes but had varying effects on MT2 receptors depending on age and sex. The findings suggest melatonin differentially regulates T4 in a sex- and age-dependent manner, possibly through
1. Plasmids containing fragments of the yeast prion protein Sup35 and GFP were mutated using site-directed mutagenesis to incorporate the unnatural amino acid p-benzoyl-L-phenylalanine (pBpa) at specific tyrosine sites.
2. The plasmids were transformed into E. coli cells containing the machinery for pBpa incorporation, and protein expression was induced to produce Sup35-GFP fusions containing pBpa.
3. SDS-PAGE and fluorescence microscopy confirmed the expression of full-length and truncated fusion proteins, and that GFP fluorescence was maintained after mutagenesis, suggesting pBpa incorporation did not greatly perturb protein structure.
Improved DNA Extraction Method for Porcine ContaminantsIslamic_Finance
This document is regarding the new and improved method of Porcine detection through DNA extraction and also talks about detection in imported meat found in the some of the GCC markets
Comparison of primer sets for amplification of Major Piroplasm Surface Protei...Sudhakar Goud Karpurapu
This document compares the efficiency of two primer sets for detecting Theileria orientalis, the causative agent of oriental theileriosis, in cattle. Blood samples from 32 cattle showing clinical signs of the disease were examined microscopically and using two PCR primer sets that target the major piroplasm surface protein gene of T. orientalis. Microscopy found 22 cattle positive, while primer set 1 identified 23 positive and primer set 2 identified all 32 cattle as positive. The results suggest PCR using primer set 2 is more sensitive for detection of T. orientalis infection compared to microscopy or primer set 1.
Determining the Interaction between ssSPTa Associated Proteins and Human ORM1...George Wu
The interaction between human ORM1-3 proteins and BCAP31, PLP2, and VAMP2 proteins was tested using a split ubiquitin yeast two-hybrid system to better understand how ORM proteins regulate sphingolipid synthesis and their link to asthma. Strong interactions were found between the ORM proteins and the three candidate proteins when the Cub tag was on the C-terminus of the ORM proteins. Western blot and protein spotting showed ORM1 had the strongest interaction while ORM2 had the weakest. This suggests the candidate proteins interact with ORM proteins and may play a role in regulating sphingolipid synthesis and asthma.
This study investigated how genetic variation in the serotonin transporter gene (Slc6a4) and integrin beta 3 gene (Itgb3) interact to modulate serotonin uptake and transporter expression in mouse brain synapses. The researchers prepared synaptoneurosomes (preserved pre- and post-synaptic structures) from mouse midbrain, hippocampus and cortex with different genotypes of Slc6a4 and Itgb3. They found reduced serotonin transporter expression and uptake activity in midbrain synaptoneurosomes of mice with both genes heterozygous, revealing an interaction between the two genes. In contrast, changes were driven mostly by Slc6a4 in the hippocampus. The study provides evidence that
This study explores the wing phenotypes of crosses between male Drosophila melanogaster expressing RNAi targeting specific genes (RNAi driver lines) and female leon mutant flies. Various phenotypes were observed in the offspring wings, including rescue, deterioration, and distortion of wing veins and structures. A correlation between the wing phenotypes and physiological/metabolic functions of the targeted genes was found. Many of the genes are expressed in tissues like the brain, heart, and reproductive organs. The results provide insight into how knocking down gene expression can affect wing development and the roles of the genes studied.
The document discusses using the Burmese python as a model to study lipid homeostasis. After eating, pythons show a doubling in size of major organs and a 52-fold increase in triglycerides without signs of lipotoxicity. This suggests a more efficient mechanism of lipid homeostasis than humans. The nuclear receptor PPARα is identified as a master regulator of lipid homeostasis and is the gene of interest. Methods are described to isolate RNA from python liver, synthesize cDNA, validate and test primers for PPARα and other genes, and perform quantitative real-time PCR to analyze gene expression levels at different time points after feeding.
This study investigated the genotoxic potential of paracetamol and its reactive metabolite NAPQI. The key findings were:
1. Neither paracetamol nor NAPQI caused mutations in Salmonella typhimurium bacteria, though NAPQI was cytotoxic to the bacteria.
2. Radiolabeled paracetamol bound covalently to DNA in mouse liver microsomal incubations and hepatic DNA from mice given a hepatotoxic dose.
3. NAPQI caused DNA single-strand breaks in treated liver cells, and paracetamol induced increased DNA repair synthesis in mouse liver cells, both at cytotoxic concentrations.
Taken together, these results show that while par
This study aimed to clone homologous genes of SND1, a key regulator of secondary cell wall biosynthesis, from Populus trichocarpa. The researcher amplified four SND1 homologs from P. trichocarpa cDNA using PCR. The amplified genes were cloned into E. coli and sequenced. Two colonies were found to contain the correct SND1 sequence insert, while others were false positives. Further work will express and quantify the proteins and determine their effects on other genes and phenotypes.
Senior Thesis-Analyzing the interactions between MYOGEF and a component of er...Dougan McGrath
This document summarizes a study analyzing the interaction between MYOGEF, a guanine nucleotide exchange factor that activates RhoA, and SPTA1, a major component of the erythrocyte cytoskeleton. Previous research identified SPTA1 as an interacting partner of MYOGEF. The current study aims to characterize this interaction through constructing cDNA fragments of different regions of MYOGEF and SPTA1 and examining their interaction using yeast two-hybrid and in vitro pull-down assays. The results showed that the C-terminal region of MYOGEF interacted with the EF-hand motifs located in the C-terminal region of SPTA1. This interaction may lead to MYOGEF-mediated
This document summarizes a study that investigated the expression of melatonin receptor proteins (MT1 and MT2) in the thyroid gland of male mice at different ages, and measured levels of thyroxine (T4) and thyrotropin (TSH) hormones. The study found that aged mice had decreased levels of serum T4 but unchanged levels of serum TSH compared to young mice. Expression of both MT1 and MT2 melatonin receptor proteins in the thyroid gland decreased with age. This suggests that aging modulates the responsiveness of the thyroid gland to melatonin through changes in melatonin receptor expression, which may contribute to declining thyroid function in older organisms.
Similar to Cloning of the c dna for thyroid stimulating hormone subunit and changes in activity of the pituitary–thyroid axis during silvering of the japanese eel, anguilla japonica (20)
Cell Therapy Expansion and Challenges in Autoimmune DiseaseHealth Advances
There is increasing confidence that cell therapies will soon play a role in the treatment of autoimmune disorders, but the extent of this impact remains to be seen. Early readouts on autologous CAR-Ts in lupus are encouraging, but manufacturing and cost limitations are likely to restrict access to highly refractory patients. Allogeneic CAR-Ts have the potential to broaden access to earlier lines of treatment due to their inherent cost benefits, however they will need to demonstrate comparable or improved efficacy to established modalities.
In addition to infrastructure and capacity constraints, CAR-Ts face a very different risk-benefit dynamic in autoimmune compared to oncology, highlighting the need for tolerable therapies with low adverse event risk. CAR-NK and Treg-based therapies are also being developed in certain autoimmune disorders and may demonstrate favorable safety profiles. Several novel non-cell therapies such as bispecific antibodies, nanobodies, and RNAi drugs, may also offer future alternative competitive solutions with variable value propositions.
Widespread adoption of cell therapies will not only require strong efficacy and safety data, but also adapted pricing and access strategies. At oncology-based price points, CAR-Ts are unlikely to achieve broad market access in autoimmune disorders, with eligible patient populations that are potentially orders of magnitude greater than the number of currently addressable cancer patients. Developers have made strides towards reducing cell therapy COGS while improving manufacturing efficiency, but payors will inevitably restrict access until more sustainable pricing is achieved.
Despite these headwinds, industry leaders and investors remain confident that cell therapies are poised to address significant unmet need in patients suffering from autoimmune disorders. However, the extent of this impact on the treatment landscape remains to be seen, as the industry rapidly approaches an inflection point.
Integrating Ayurveda into Parkinson’s Management: A Holistic ApproachAyurveda ForAll
Explore the benefits of combining Ayurveda with conventional Parkinson's treatments. Learn how a holistic approach can manage symptoms, enhance well-being, and balance body energies. Discover the steps to safely integrate Ayurvedic practices into your Parkinson’s care plan, including expert guidance on diet, herbal remedies, and lifestyle modifications.
- Video recording of this lecture in English language: https://youtu.be/kqbnxVAZs-0
- Video recording of this lecture in Arabic language: https://youtu.be/SINlygW1Mpc
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Promoting Wellbeing - Applied Social Psychology - Psychology SuperNotesPsychoTech Services
A proprietary approach developed by bringing together the best of learning theories from Psychology, design principles from the world of visualization, and pedagogical methods from over a decade of training experience, that enables you to: Learn better, faster!
Histololgy of Female Reproductive System.pptxAyeshaZaid1
Dive into an in-depth exploration of the histological structure of female reproductive system with this comprehensive lecture. Presented by Dr. Ayesha Irfan, Assistant Professor of Anatomy, this presentation covers the Gross anatomy and functional histology of the female reproductive organs. Ideal for students, educators, and anyone interested in medical science, this lecture provides clear explanations, detailed diagrams, and valuable insights into female reproductive system. Enhance your knowledge and understanding of this essential aspect of human biology.
TEST BANK For Community Health Nursing A Canadian Perspective, 5th Edition by...Donc Test
TEST BANK For Community Health Nursing A Canadian Perspective, 5th Edition by Stamler, Verified Chapters 1 - 33, Complete Newest Version Community Health Nursing A Canadian Perspective, 5th Edition by Stamler, Verified Chapters 1 - 33, Complete Newest Version Community Health Nursing A Canadian Perspective, 5th Edition by Stamler Community Health Nursing A Canadian Perspective, 5th Edition TEST BANK by Stamler Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Pdf Chapters Download Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Pdf Download Stuvia Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Study Guide Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Ebook Download Stuvia Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Questions and Answers Quizlet Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Studocu Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Quizlet Test Bank For Community Health Nursing A Canadian Perspective, 5th Edition Stuvia Community Health Nursing A Canadian Perspective, 5th Edition Pdf Chapters Download Community Health Nursing A Canadian Perspective, 5th Edition Pdf Download Course Hero Community Health Nursing A Canadian Perspective, 5th Edition Answers Quizlet Community Health Nursing A Canadian Perspective, 5th Edition Ebook Download Course hero Community Health Nursing A Canadian Perspective, 5th Edition Questions and Answers Community Health Nursing A Canadian Perspective, 5th Edition Studocu Community Health Nursing A Canadian Perspective, 5th Edition Quizlet Community Health Nursing A Canadian Perspective, 5th Edition Stuvia Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Pdf Chapters Download Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Pdf Download Stuvia Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Study Guide Questions and Answers Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Ebook Download Stuvia Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Questions Quizlet Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Studocu Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Quizlet Community Health Nursing A Canadian Perspective, 5th Edition Test Bank Stuvia
8 Surprising Reasons To Meditate 40 Minutes A Day That Can Change Your Life.pptxHolistified Wellness
We’re talking about Vedic Meditation, a form of meditation that has been around for at least 5,000 years. Back then, the people who lived in the Indus Valley, now known as India and Pakistan, practised meditation as a fundamental part of daily life. This knowledge that has given us yoga and Ayurveda, was known as Veda, hence the name Vedic. And though there are some written records, the practice has been passed down verbally from generation to generation.
Clinic ^%[+27633867063*Abortion Pills For Sale In Tembisa Central19various
Clinic ^%[+27633867063*Abortion Pills For Sale In Tembisa Central Clinic ^%[+27633867063*Abortion Pills For Sale In Tembisa CentralClinic ^%[+27633867063*Abortion Pills For Sale In Tembisa CentralClinic ^%[+27633867063*Abortion Pills For Sale In Tembisa CentralClinic ^%[+27633867063*Abortion Pills For Sale In Tembisa Central
Rasamanikya is a excellent preparation in the field of Rasashastra, it is used in various Kushtha Roga, Shwasa, Vicharchika, Bhagandara, Vatarakta, and Phiranga Roga. In this article Preparation& Comparative analytical profile for both Formulationon i.e Rasamanikya prepared by Kushmanda swarasa & Churnodhaka Shodita Haratala. The study aims to provide insights into the comparative efficacy and analytical aspects of these formulations for enhanced therapeutic outcomes.
Local Advanced Lung Cancer: Artificial Intelligence, Synergetics, Complex Sys...Oleg Kshivets
Overall life span (LS) was 1671.7±1721.6 days and cumulative 5YS reached 62.4%, 10 years – 50.4%, 20 years – 44.6%. 94 LCP lived more than 5 years without cancer (LS=2958.6±1723.6 days), 22 – more than 10 years (LS=5571±1841.8 days). 67 LCP died because of LC (LS=471.9±344 days). AT significantly improved 5YS (68% vs. 53.7%) (P=0.028 by log-rank test). Cox modeling displayed that 5YS of LCP significantly depended on: N0-N12, T3-4, blood cell circuit, cell ratio factors (ratio between cancer cells-CC and blood cells subpopulations), LC cell dynamics, recalcification time, heparin tolerance, prothrombin index, protein, AT, procedure type (P=0.000-0.031). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and N0-12 (rank=1), thrombocytes/CC (rank=2), segmented neutrophils/CC (3), eosinophils/CC (4), erythrocytes/CC (5), healthy cells/CC (6), lymphocytes/CC (7), stick neutrophils/CC (8), leucocytes/CC (9), monocytes/CC (10). Correct prediction of 5YS was 100% by neural networks computing (error=0.000; area under ROC curve=1.0).
Local Advanced Lung Cancer: Artificial Intelligence, Synergetics, Complex Sys...
Cloning of the c dna for thyroid stimulating hormone subunit and changes in activity of the pituitary–thyroid axis during silvering of the japanese eel, anguilla japonica
2. have long been implicated in the migration of
anadromous salmonids. They are required for the
preparatory transformation of parr to a seawater-
tolerant smolt, and are thought to stimulate
migratory behavior (Boeuf 1994). In juvenile
salmonids, there is an indication that thyroid
hormones are involved in the body silvering process
by depositing guanine in the skin (Ikuta et al. 1985,
Ura et al. 1994). In conger eel, Conger myriaster,
thyroid hormones are important in the regulation
of metamorphosis from the leptocephalus to the
elver (Yamano et al. 1991). The HPT axis is also
closely correlated to reproduction. A significant
temporal relationship exists for most species of
teleosts between thyroid status and gonadal status
over at least certain phases of the reproductive
cycle (Cyr & Eales 1996). Based on the studies of
several teleost species, it was thought that the
thyroidal activity usually increases during early
gonadal development, is maintained or enhanced
during the period of reproduction, and commonly
decreases during or after spawning (Cyr & Eales
1996).
The Japanese eel, Anguilla japonica Temminck and
Schlegel, is a catadromous fish with a complex life
cycle that includes both marine and freshwater
habitats (Tesch 1977). After living in rivers for
years, eels undergo pronounced morphological and
physiological changes from yellow to silver eels (also
known as ‘silvering’) (Tesch 1977, Lokman &
Young 1998a,b). The modifications include skin
color changing from white/yellow to silver
on the belly and from green to black on the
back, downstream migration behavior, and rapid
development of the gonad. Accordingly, the HPT
axis may be involved in eel silvering. However, no
information is yet available with respect to the
corresponding changes in thyroid status during
silvering of Japanese eels. We therefore investigated
the changes in the pituitary–thyroid axis during
silvering of wild Japanese eels. As a direct assay of
eel TSH is unavailable as yet, the TSH transcript
levels were estimated to represent thyrotropin
expression activity from the pituitary. The circulat-
ing thyroxine levels were estimated to reflect the
thyroid status. Since the genome and peptide
sequence of TSH for Japanese eel are not known
yet, we also cloned the TSH gene for
phylogenetic analysis. We report here the cloning
of the genomic and cDNA sequences for Japanese
eel TSH and its deduced peptide sequence, the
regulation of TSH mRNA expression, and the
changes in TSH mRNA expression levels
together with circulating thyroxine levels at various
stages of ovarian development during silvering of
wild female Japanese eels.
Materials and methods
cDNA cloning of the Japanese eel TSH
subunit
Design of oligonucleotide primers
Oligonucleotides, used as PCR primers for
amplification of the TSH cDNA and genomic
DNA of the Japanese eel, are listed below and
shown in Fig. 1. The sense primer (SP: 5 <3 ) and
antisense primer (ASP: 3 <5 ) were designed from
Figure 1 Procedures of RT-PCR sequencing of TSH subunit genomic DNA
(upper) and cDNA (lower) from pituitary glands of the Japanese eel. Numbers
of primers (P) indicate the corresponding oligonucleotides listed in Materials
and methods.
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering180
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
3. the conserved coding region of the TSH cDNA
of the European eel and other teleosts. The actin
sequence of the Japanese eel was cloned in our
laboratory.
Primer 1, SP for TSH subunit: 5 -ATGAGAG
TGGTCCTGTTGGCC-3 ; primer 2, ASP for
TSH subunit: 5 -GGATGTGGTTGCTCTGT
CCCGG-3 . Primer 3, SP for 3 -rapid amplifi-
cation of cDNA ends (RACE): 5 -GATCCGGCG
CGGGACGAGTG-3 ; primer 4, ASP for 5 -
RACE: 5 -CCATGCAGATGGTGGTGTTGA-
3 . Primer 5, SP for TSH subunit: 5 -GACA
CTCGGAGAAAATTCTAC-3 ; primer 6, SP for
TSH subunit: 5 - CTTCTGCGTGGCCAT
CAACACCA-3 ; primer 7, ASP for TSH
subunit: 5 -CACTCGTCCCGCGCCGGATC-
3 . Adapter primer (AP) for 3 -RACE: 5 -
GGCCACGCGTCGACTAGTACTTTTTTTTT
TTTTTTTT-3 . Abridged universal amplification
primer (AUAP) for 3 -RACE: 5 -GGCCACGC
GTCGACTAGTAC-3 . Abridged anchor primer
(AAP) for 5 -RACE: 5 -GGCCACGCGTCGACT
AGTACGGG I IGGGI IGGG I IG-3 , where I is
the base inosine. Primer of SP for -actin subunit:
5 -GCTGTCCCTGTATGCCTCTGG-3 ; primer
of ASP for -actin subunit: 5 -GTCAGGATCTT
CATGAGGTAGTC-3 .
RT-PCR for TSH cDNA sequence and RACE
Fresh pituitary glands were collected from the
cultured Japanese eels reared in the laboratory.
Total RNA was then extracted using the total RNA
miniprep system kit (Viogene, Sunnyval, CA,
USA). The concentration and quality of the
extracted RNA were measured at A260 nm/
A280 nm (Kontron Spectrophotometer, UVIKON
810). Complementary DNA was synthesized using
oligo-d(T)18 primer (100 ng) and moloney murine
leukemia virus-reverse transcriptase (MMLV-RT)
(Stratagene, La Jolla, CA, USA) following instruc-
tions recommended by the manufacturer. Reverse
transcription was performed for 35 min at 42 C
and later at 70 C for 10 min to heat-inactivate the
MMLV-RT.
The PCR was performed in 50 µl final volume
with 2·5 U Taq DNA polymerase (Gibco BRL,
Gaithersburg, MD, USA) using primers 1 and 2
(100 ng for each). After an initial 3 min denaturing
step at 94 C, 35 cycles of amplification were
performed using a cycle profile of 94 C for 1 min,
62 C for 40 s, and 72 C for 1 min. Elongation was
extended to 10 min at 72 C after the last cycle.
The PCR products were sequenced commercially
with an ABI 377 automated sequencer (Perkin-
Elmer Applied Biosystems).
The remaining 5 and 3 untranslated region
(UTR) sequences were obtained by RACE using
the RACE kit (Gibco BRL). Briefly, 1 µg of the
pituitary total RNA was reverse-transcribed using
primer AP by 200 U Superscript II reverse
transcriptase, followed by PCR between primer 3
and the AUAP. For 5 -RACE, 1 µg of the pituitary
total RNA was first reverse-transcribed by 200 U
Superscript II reverse transcriptase with primer 2.
The acquired single strand cDNA was column
purified and then oligo-dC tailed using terminal
deoxynucleotidyl transferase. PCR was then
performed using primer 4 and the AAP.
Total DNA extraction and PCR for TSH genomic DNA
The total genomic DNA of the Japanese eel was
extracted from the liver using the total DNA
miniprep system kit (Viogene). The TSH
genomic DNA sequence was obtained by PCR
with primers 5 and 7, located in the head of the
5 -UTR and the end position of the coding region
of TSH cDNA respectively. Intron sequences
were obtained by re-amplifying the PCR product
with primers 4 and 5 for intron I and primers 6 and
7 for intron II.
Regulation of TSH mRNA expression
Cultured Japanese eels (n=27) at the yellow stage,
reared in the laboratory for 2 years, were used for
studying the regulation of TSH mRNA. Pituitary
tissue culture was carried out based on the
procedures described by Gregory and Porter (1997)
with some modifications. Pituitaries were collected
from the Japanese eels, immediately washed twice
in 1 Hanks buffer and placed in 35 mm culture
dishes. Each pituitary was sliced into 4 pieces,
incubated in 1·5 ml M-199 (Sigma) containing
25 mM HEPES, 4 mM NaHCO3, 0·1% BSA and
antibiotics (penicillin and streptomycin), and
treated with saline (control group), TRH (pGlu-
His-Pro-NH2, 10–8
M), or T4 (10–8
M). All the
dishes were kept in a CO2 incubator maintained
under 3·5% CO2 concentration at 30 C for 6 h.
After centrifugation, the total RNAs were isolated
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 181
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
4. from the tissues. The RNA was reverse transcribed
as described and the cDNA was PCR amplified
using TSH primers 1 and 7. As an internal
control in the RT-PCR reactions, actin was also
amplified simultaneously for normalization. An
optimal PCR amplification cycle (25 cycles) was
chosen to observe the different cDNA levels based
on parallelism of different PCR cycles (15, 20, 25,
and 30 cycles). PCR products were analyzed by
2·5% agarose gel electrophoresis. To validate the
mRNA levels estimated by RT-PCR analysis, two
samples of each treatment were tested for real-time
quantitative PCR using the fluorescence dye SYBR
Green 1 (Morrison et al. 1998).
Transcript levels of TSH mRNA at different
stages of ovarian development of wild female
Japanese eels
Collection of wild eels and classification of maturing
status
Wild female Japanese eels (n=46) were collected by
eel traps in the estuary of the Kaoping River in
southwest Taiwan (120 50 E and 22 40 N)
(Table 1). Males were difficult to collect because the
sex ratio was skewed to females (Tzeng et al. 2002);
thus, only females were considered in this study.
These eel samples have previously been used for
investigation of gonadotropin mRNA transcript
levels (Han et al. 2003a). The eels were stunned
by ice before morphometric measurement. Total
length (TL, 0·1 cm) and body weight (BW,
0·1 g) of the eels were measured before
decapitation for blood collection. The sex of each
eel was determined by histology of the gonad. The
gonad weight (GW, 0·01 g) and digestive tract
weight (DW, 0·01 g) were measured and the
gonadosomatic index (GSI) and digestosomatic
index (DSI) were estimated according to the
formulae, GSI=100 [GW (g)/BW (g)] and
DSI=100 [DW (g)/BW (g)] respectively. Oocyte
diameters (OD, 1 µm) were calculated according
to Yamamoto et al. (1974).
In our previous investigation, the maturity of the
wild female Japanese eels before and during
silvering were divided into three stages (yellow,
pre-silver and silver) based on skin color and
histological observations of ovarian development
(Han et al. 2003b). In the present study, the yellow
eels were further divided into juvenile and
sub-adult stages based on OD for better compari-
son (Table 1). The GSI and OD of the female
Japanese eel were significantly different among
different ovarian developmental stages (P,0·05,
Table 1). Ovaries of juvenile eels contained mainly
stage II (chromatin nucleolus stage) oocytes
(,50 µm). The ovaries of sub-adult eels also
contained stage II (chromatin nucleolus stage)
oocytes predominantly, but with larger OD
(50–90 µm) (Table 1). In the pre-silver eels, the
oocytes (90–130 µm) grew rapidly and were mainly
in stage III (peri-nucleolus stage). The initial oil
drops became apparent at the periphery of the
oocytes. In the silver eels, the oocytes (.130 µm)
continued to grow, and the oil drops accumulated
and filled the whole cytoplasm. They were mainly
in stage IV (oil-drop stage) (Han et al. 2003b).
Table 1 Morphometric characteristics of the wild Japanese eels in different stages of ovarian development
Yellow
Pre-silver Silver Tukey’s HSDJuvenile Sub-adult
Sample size 11 17 9 9
Time of collection Dec. 2000
Feb. 2003
Aug., Oct. 2000
Feb. 2001
Oct. 2000
Jun. 2001
Oct., Dec. 2000
Feb. 2001
Total length (cm) 43·4±1·0 53·7±1·3 60·7±1·6 65·1±2·0 Ju<Sa<Ps=Sv
Body weight (g) 68·4±3·0 197·2±13·5 374·3±40·0 474·0±34·9 Ju<Sa<Ps=Sv
Gonadosomatic index 0·15±0·02 0·36±0·02 0·59±0·06 1·58±0·18 Ju<Sa<Ps<Sv
Oocyte diameter ( m) 40·0±0·95 73·8±2·5 109·4±3·4 181·1±12·2 Ju<Sa<Ps<Sv
Digestosomatic index 1·81±0·09 1·71±0·10 1·35±0·08 0·47±0·08 Ju=Sa>Ps>Sv
Ju, juvenile; Sa, sub-adult; Ps, pre-silver; Sv, silver. P<0·05 for all significance differences.
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering182
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
5. Measurement of pituitary TSH mRNA levels
Total RNA (1 µg) from individual pituitaries of wild
female Japanese eels of juvenile (n=11), sub-adult
(n=17), pre-silver (n=9), and silver (n=9) stages was
reverse-transcribed using oligo-d(T)18 primer
(100 ng) and MMLV-RT (Stratagene) following
instructions recommended by the manufacturer.
PCR reactions for TSH were performed using
primers 1 and 7 with 25 cycles. As an internal
control in the RT-PCR reactions, actin was also
amplified simultaneously for normalization. To
validate the reliability of RT-PCR analysis, two
pituitaries of eels selected from each ovarian stage
were analyzed by real-time quantitative PCR as
described.
Radioimmunoassay (RIA) of serum thyroxine
levels of wild female Japanese eels at different
stages of ovarian development
Measurement of serum thyroxine (T4) was per-
formed by commercial kits (Diagnostic System
Laboratories, Texas, USA). The cross-reactivity of
the T4 antibody was measured for thyroxine
(100%), triiodothyroacetic acid (1·13%), triiodothy-
ronine (0·91%), diiodothyronine (0·03%), and other
related hormones which were not detectable. The
minimum detection limit was 4 ng/ml serum. Since
the collected blood of juvenile eels was insufficient
for RIA analysis, only the other three stages of
female Japanese eels were used for serum T4
measurement in the present study.
Statistical analysis
Differences among the eel stages of the morpho-
metric indexes or the transcript levels of TSH
mRNA were analyzed by one-way analysis of
variance (ANOVA) followed by Tukey’s HSD
(Honestly Significantly Different) test. Significance
level was considered to be at P<0·05.
Results
Sequence analysis of the Japanese eel TSH
cDNA and genomic DNA
The acquired TSH cDNA of Japanese eel was
703 bp in total length, including 81 bp of the
5 -UTR, 444 bp of the coding region, and 178 bp
of partial 3 -UTR (Fig. 2). The agarose gel analysis
of the PCR products of TSH 3 -RACE showed
multiple bands, thus the full 3 -UTR sequence was
difficult to obtain. The coding region encodes a
putative protein of 147 amino acids, which contains
Figure 2 cDNA nucleotide and deduced amino acid sequences of the Japanese eel TSH
subunit. In the right-hand column, upper numbers refer to the nucleotide sequence and
lower numbers refer to the amino acid sequence. The start (ATG) and stop (TAG,
indicated by an asterisk) codons are shown by boxes. The two arrows show, respectively,
the introns 1 and 2 insertion sites.
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 183
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
6. a signal peptide of 20 amino acids and a mature
peptide of 127 amino acids (Fig. 2).
The genomic DNA sequence of the TSH sub-
unit was PCR amplified by primers 4, 5, 6 and 7.
The acquired sequences were compared with that of
the TSH subunit cDNA for identification of the
introns (Fig. 3). Two introns were observed; intron 1
was located in the 5 -UTR (Fig. 2), which included
484 bp (Fig. 3) while intron 2 (including 860 bp, Fig.
3) was within the coding region (Fig. 2). Both introns
started with a gt base pair and ended with an ag base
pair. We only found one form of intron I and II in
the TSH genomic DNA as indicated by only one
band of PCR product of TSH genomic DNA
amplified from primers 5 and 7.
Regulation of the TSH- gene expression
The experiment on the regulation of mRNA of the
TSH showed that TRH at 10–8
M significantly
increased its expression (P,0·001), while T4 at
10–8
M significantly decreased its expression
(P,0·001) (Fig. 4). Representative real-time quan-
titative PCR for TSH mRNA expressions at
different treatments is shown in Fig. 5(A). The
calculated expression levels of TSH mRNA
estimated by real-time quantitative PCR were
comparable to the corresponding mRNA levels
estimated by the RT-PCR analysis.
Changes in TSH mRNA expression levels at
different ovarian stages of wild Japanese eel
The expression of TSH mRNA levels at different
stages of ovarian development is shown in Fig. 6.
The results were normalized with data from
densitometric scanning of a constitutively expressed
protein actin. As indicated, TSH mRNA
levels gradually increased with ovarian develop-
ment (F=3·12.F(0·05, 26)=3·03, P=0·048), and the
differences were significant between silver and
juvenile/sub-adult stages (P,0·05). Representative
Figure 3 Genomic DNA sequences of the Japanese eel TSH . The start codon
(ATG), stop codon (TAG), and the ends of introns (gt-ag) are shown by boxes.
Intron sequences are shown by the lower-case characters.
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering184
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
7. real-time quantitative PCR for TSH mRNA
expressions at different stages of ovarian devel-
opment is shown in Fig. 5(B). The calculated
mRNA levels of TSH mRNA expression at
different ovarian stages estimated by real-time
quantitative PCR were comparable to the corre-
sponding mRNA levels estimated by the RT-PCR
analysis.
Figure 4 Regulation of TSH mRNA expression of the cultured Japanese eel
pituitaries by TRH and T4. (A) Total RNA extracted from each treatment was reverse
transcribed and subjected to PCR. Amplified products were analyzed on 2·5%
agarose gel. actin was used as a control in each column. C, control. (B) The band
intensities of TSH subunits in different treatments were analyzed by Kodak Digital
Science ID image analysis software (ver 3·0). The value of the control group was
considered as 1 and the values of the other groups were calculated with respect to
the control group. N indicates the eel numbers. ***
P<0·001, significant difference
compared with control (C).
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 185
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
8. Figure 5 Representative real-time quantitative PCR of TSH mRNA expressions for
Japanese eels following (A) actin, control, TRH, or T4 treatments and (B) at different
stages of ovarian development in wild female Japanese eels.
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering186
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
9. Serum thyroxine levels at different ovarian
stages of wild Japanese eel
Mean serum T4 levels gradually increased during
eel silvering, with 9·17 0·92 ng/ml in sub-adult,
12·01 1·53 ng/ml in pre-silver, and 14·96
1·57 ng/ml in silver females respectively.
Significant differences were found among eel stages
(F=5·61.F(0·05, 34)=3·29, P,0·01), and the
Figure 6 Expression of the TSH subunit mRNA in the wild female Japanese eel
pituitaries at different stages of ovarian development. (A) Total RNA preparation and
agarose gel analysis were the same as in Fig. 4. actin was used as a control in each
column. (B) The band intensities of subunits from juvenile, sub-adult, pre-silver, and
silver stages. The value of the juvenile group was considered as 1 and values of other
stages were calculated with respect to the juvenile group. Different letters above the
bars indicate that the differences are statistically significant (P<0·05). Numbers inside
the bars represent sample size.
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 187
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
10. differences were significant between silver females
and sub-adult female eels (P,0·05) (Fig. 7).
Discussion
Comparisons of protein sequences of Japanese eel
TSH with teleosts and other vertebrates are
shown in Fig. 8. As indicated, positions of all 12
cysteine residues, forming six-disulfide bonds within
the subunits, and one asparagine-linked glyco-
sylation site between cysteine 3 and 4, are
conserved in all vertebrates. Differences of two
amino acids in the mature peptide of TSH are
observed between Japanese eel and European eel
(98·4% of identity) while a one amino acid
difference exists in the signal peptide between the
two eels (95% of identity) (Table 2 and Fig. 8). The
amino acid identities of TSH mature peptide of
Japanese eel compared with teleostean species from
other orders range from 48·4% to 61·3%, and
compared with tetrapods they range from 42·9 to
45·2% (Table 2). Such findings demonstrate that a
high degree of diversity exists in the TSH peptide
sequence among different teleostean orders, and
between teleosts and tetrapods, indicating the low
degree of conservation of the TSH amino acid
sequence in vertebrates during evolution. The
results also indicate that the intra-order homology
of TSH (ex. Japanese eel vs European eel) is
greater than the homology of inter-order (ex.
anguillids vs salmonids), which in turn is greater
than the homology of inter-animal class (ex. teleosts
vs mammals). The phylogenetic tree of amino acid
sequences of TSH mature peptides of the
vertebrates, constructed by the Neighbor-Joining
method, indicates that TSH subunits from
different species of the same animal class are
grouped together in accordance with the known
phylogenetic orders (Fig. 9). As indicated, the
Chondrostean sturgeon is closer to the tetrapods
than the teleosts; such findings are similar to the
results reported by Quérat et al. (2000).
The sequence identity of TSH signal peptide
for Japanese eel is high in comparison with
European eel (95%), but below 40% when
compared with other species (Table 2). It is
interesting to note that the percentage identities of
TSH signal peptide between Japanese eel and
other vertebrates are always lower than the
corresponding identities of TSH mature peptide
(Table 2), indicating that the signal peptide is less
conserved than the mature peptide of TSH
during evolution. On the other hand, the genetic
structure of TSH of the Japanese eel contains
Figure 7 Serum thyroxine levels at different ovarian stages of the wild female
Japanese eels. Different letters above the bars indicate that the differences are
statistically significant (P<0·05). Numbers inside the bars represent sample size.
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering188
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
11. Figure 8 A comparison of the amino acid sequence of TSH of the Japanese eel with other species. The species
and their accession numbers of the GenBank or published papers are: Japanese eel (Anguilla japonica, AY158008),
European eel (Anguilla anguilla, Paradet-Balade et al. 1998), Atlantic salmon (Salmo salar, 073824), rainbow trout
(Oncorhynchus mykiss, Ito et al. 1993), common carp (Cyprinus carpio, BAA20082), bighead carp (Aristichthys
nobilis, Chatterjee et al. 2001), goldfish (Carassius auratus, Sohn et al. 1999), Siberian sturgeon (Acipenser baerii,
Quérat et al. 2000), rat (Rattus norvegicus, Carr et al. 1987), human (Homo sapiens, Hayashizaki et al. 1985),
chicken (Gallus gallus, Gregory & Porter 1997), duck (Cairina moschata, Hsieh et al. 2000), toad (Xenopus laevis,
Buckbinder & Brown 1993). The signal peptide sequence is underlined. The dots represent amino acids that are
identical to Japanese eel, and the dashes are included to improve the alignment. The twelve conserved cysteine
residues are denoted by asterisks, and the one asparagine-linked glycosylation site is denoted by a cross.
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 189
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
12. three exons and two introns, the same as the rat
(Carr et al. 1987), goldfish (Sohn et al. 1999), and
European eel (Paradet-Balade et al. 1998). The
positions of intron I are all located in the 5 -UTR,
and the insertion sites of intron II are all located
within the coding region of the comparable
positions. The length and nucleotide sequence
of the corresponding introns are highly variable
among vertebrates. For example, the lengths of
intron II in the Japanese eel, European eel, goldfish
and rat are 860, 533/681, 299 and 377 bp
respectively, indicating their low conservation
among vertebrates.
Previous study in European eel shows that there
is only one copy of the TSH gene in each
individual but with multiple forms of alleles, and
the polymorphism of TSH occurring in the
regions of intron II and 3 -UTR is due to the
different numbers of minisatellites (Paradet-Balade
et al. 1998). Therefore, heterogeneities of TSH
mRNA in length among individual eels were
detected by Northern blot analysis (Paradet-Balade
et al. 1997, 1998). In the present study, the multiple
bands of the 3 -RACE PCR product of TSH
cDNA in the Japanese eels may be due to the
heterogeneity of 3 -UTR, as in the case of the
European eel. We also observed that the single
cDNA band amplified from the coding region of
TSH , obtained by RT-PCR analysis from the
present study, should facilitate the quantification of
TSH mRNA as compared with the single or
double bands of TSH mRNA with various
lengths obtained by Northern blot analysis.
TRH is a major hypothalamic simulating
hormone for the secretion of pituitary TSH in
mammals (Prasad 1985). In the teleosts, the
presence of immunoreactive TRH has been found
in common carp (Hamano et al. 1990), sea bass
(Batten et al. 1990), and chinook salmon (Matz &
Takahashi 1994). Recently, the stimulatory effect of
TRH on the TSH mRNA expression has been
reported in bighead carp (Chatterjee et al. 2001). In
the present study, TRH was also found to increase
the level of TSH mRNA (Fig. 4). In contrast,
thyroid hormones have been shown to directly
depress TSH mRNA levels from pituitaries under
in vitro cultured conditions of various tetrapods
(Croyl & Maurer 1984, McNabb 1992, Hsieh et al.
2000) and teleosts (Pradet-Balade et al. 1997,
Chatterjee et al. 2001). In the present study, we also
demonstrated that T4 depressed TSH mRNA
expression in the pituitary culture of Japanese eel
(Fig. 4). As indicated, a rather modest response of
the TSH mRNA expression was obtained in the
present study; incubation of the Japanese eel
pituitary fragments with TRH and T4 at 10 8
M
for 6 h at 30 C resulted in a 52% increase and a
25% decrease in TSH mRNA expression
respectively, compared with the control (Fig. 4). In
the pituitary cell culture of the European eel, it was
demonstrated that treatment with T3 or T4 at
10 8
M for 14 days at 18 C resulted in a 70%
decrease in TSH mRNA expression compared
with the control (Pradet-Balade et al. 1997). We
have also shown that after treatment of the bighead
carp pituitary fragments with TRH and T4 at
10 8
M for 36 h at 20 C, the TSH mRNA
expressions were 75% higher and 40% lower,
respectively, than the control (Chatatterjee et al.
2001). The findings of these studies demonstrated
that the in vitro response of TSH mRNA
expression to TRH or thyroid hormones varied
with different incubation conditions of the pituitary,
such as tissue or cell culture, incubation tempera-
ture and time length, and other factors. In
mammalian studies, it has been demonstrated that
TRH stimulates TRH production by effects at the
transcriptional and secretory levels. The TRH-
response regions have been identified in the TSH
subunit gene promotor (Sarapura et al. 1995). It has
also been established in mammals that TSH and
Table 2 Comparison of percentage identity of signal
and mature TSH peptides between Japanese eel and
other vertebrates
Signal peptide
(%)
Mature peptide
(%)
Species*
Japanese eel 100·0 100·0
European eel 95·0 98·4
Atlantic salmon 35·0 61·3
Rainbow trout 35·0 60·6
Common carp 21·1 56·7
Bighead carp 31·6 52·8
Goldfish 21·1 52·0
Siberian sturgeon 35·0 48·4
Toad 33·3 45·2
Chicken 30·0 44·3
Duck 30·0 44·3
Rat 40·0 43·7
Human 35·0 42·9
*The accession numbers of the GenBank and references are
indicated in the legend of Fig. 8.
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering190
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
13. TSH subunit genes contain thyroid response
elements that mediate their transcriptions by the
thyroid hormone–receptor complex (Chin et al.
1993). A thyroid-response element was also
identified in the subunit gene of Chinook salmon
(Suzuki et al. 1995). Thus, the specific mechanism
whereby TRH and thyroid hormones regulate
TSH mRNA expression in teleosts is likely to
resemble that found in mammals.
As indicated in the present study, the steady-state
TSH mRNA levels in the pituitaries were
increased with advancement of the silvering
process. Such patterns were in parallel with the
increasing levels of serum thyroxine. Since the
quantification of TSH in teleosts is not available
yet, the TSH levels in the pituitary and in the
circulation remain unknown. The steady-state TSH
mRNA levels estimated in the pituitaries may
reflect TSH formation activity. Thus, the increased
TSH formation in the pituitary during the eel
silvering process leads to increased formation and
release of thyroxine from thyroid tissues. In
mammals, regulation of TSH gene expression,
formation and secretion is well established
(Sarapura et al. 1995). The formation and secretion
of pituitary TSH is up-regulated by hypothalamic
TRH and down-regulated by thyroid hormones via
feedback mechanisms (Sarapura et al. 1995).
However, TSH is also regulated by other hormones
secreted from the hypothalamus and other tissues,
e.g. somatostatin, dopamine, glucocorticoids
(Sarapura et al. 1995, Schwartz 2000). Thus
Figure 9 A phylogenetic tree of the putative mature peptide sequences of the
TSH subunits from teleosts and selected species of tetrapods. The tree was
constructed with the Neighbor-Joining method by the MEGA 2 program. The
numbers indicate the bootstrap robustness from 1000 replicates. The top
sequence of the A. japonica was from this study, and those of other sequences
were from published papers and the accession numbers of the GenBank as
indicated in the legend to Fig. 8.
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 191
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
14. the regulation of TSH appears to be highly
complex.
In Anguilla australis, injection of androgen
(11-ketotestosterone) into females is found to induce
some silvering-related morphological changes
(Rohr et al. 2001). In the Japanese eel, the
morphological changes, such as silver skin and dark
pectoral fins, enlarged eyes, and degenerative
digestive tract, are found to be synchronous with
gonadal development during the silvering process
(Han et al. 2003b), and the mRNA expression of
both gonadotropin I and gonadotropin II is
significantly higher in the silver stage compared
with the yellow stage (Han et al. 2003a). When the
freshwater-reared yellow Japanese eels were
induced to become silver eels by repeated injection
of human chorionic gonadotropin (hCG), similar
morphological and physiological changes were
observed (YS Han, WN Tzeng and IC Lia,
unpublished data). All this evidence indicated that
the gonadotropin and sex steroids play an
important role during eel silvering. In female
rainbow trout, the increase in the gonadosomatic
index was greater when the fish were treated with
T3 and gonadotropin in combination than when
treated with gonadotropin alone (Cyr & Eales
1988). In the thecal cell culture of brook trout
ovary, treatment with gonadotropin plus T3 caused
a more significant increase in testosterone than
treatment with gonadotropin alone (Cyr & Eales
1996). Thus, thyroid hormones are undoubtedly
involved in synergizing with gonadotropin during
oocyte maturation. The existence of a thyroid
hormone receptor in the gonad has also been
proved in several teleosts such as perch
(Chakraborti et al. 1986) and medaka (Soyano et al.
1993). This permits the enhancement of thyroid
hormone on gonadotropin action. In the present
study, the silvering eels were in the early gonadal
development stage (Table 1). The higher activity of
the pituitary–thyroid axis may synergize with the
pituitary–gonad axis, as in other teleosts, to
promote ovarian development during eel silvering.
In the wild arctic char, the blood thyroxine
concentration is twice as high in upstream and
downstream migrants as in non-migrants (Høgåsen
& Prunet 1997), and the underyearling sockeye
salmon shows a natural surge in T4 before
downstream migration occurs (Boeuf 1994).
Thyroid hormone treatment could change the
swimming direction of chum salmon fry to
downstream (Boeuf 1994, Iwata 1995). Our
previous study also found that, during silvering, the
Japanese eel migrated from freshwater to seawater
(Han et al. 2003c). As indicated in the present study,
the expression of TSH mRNA was increased
significantly (Fig. 6), in parallel to that of serum T4
levels during silvering of female eels (Fig. 7).
Accordingly, the more active HPT axis in silver
female eels might also be related to the downstream
migration behavior of the silver eels.
When the freshwater-reared yellow Japanese eels
were induced to become silver eels by injection of
hCG, the appearance of the silver color seems to be
later in hCG-induced eels than in the wild eels (YS
Han, WN Tzeng and IC Lia, unpublished data).
This implies that some other factors may also be
involved in the body silvering of the eels in addition
to hormones of the hypothalamus–pituitary–gonad
(HPG) axis. In the masu salmon, thyroid hormone
treatment could promote guanine deposition in the
skin during bodily silvering in smoltification (Ikuta
et al. 1985, Ura et al. 1994). In the European eel, the
dispersal of purines in the skin was thought to cause
a silver color on the belly of silver stage eels
(Pankhurst & Lythgoe 1982). These findings suggest
that thyroid hormones may synergize with the
HPG axis in causing silver skin coloration during
the silvering process of the Japanese eel.
In conclusion, we have cloned both cDNA and
genomic DNA of the TSH subunit of Japanese
eel. The transcript levels of TSH mRNA were
increased during eel silvering, and were parallel
with the increased serum thyroxine levels. These
results suggest that the HPT axis may play a role in
the silvering process of the Japanese eel.
Acknowledgements
This study was financially supported by the Council
of Agriculture, Executive Yuan, Taiwan, ROC
(90AS -1·4·5-FA-F1-36 and 91AS -2·5·1-FA-F1-8).
The authors are grateful to Mr G H Cheng for
sample collection and to Mr J T He for gonadal
histology.
References
Batten TFC, Moons L, Cambre ML, Vandersande F, Seki T &
Suzuki M 1990 Thyrotropin-releasing hormone immunoreactive
systems in the brain and pituitary gland of the sea bass
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering192
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194
15. (Dicentrachus labrax, Teleosti). General and Comparative Endocrinology 79
385–392.
Boeuf G 1994 Salmonid smolting: a pre-adaptation to the oceanic
environment. In Fish Ecophysiology, pp 105–135. Eds JC Rankin &
FB Jensen. London: Chapman and Hall.
Buckbinder L & Brown DD 1993 Cloning and developmental
expression of Xenopus laevis prolactin and thyrotropin genes. PNAS
90 3820–3824.
Carr FE, Need LR & Chin WW 1987 Isolation and characterization
of the rat thyrotropin beta-subunit gene: differential regulation of
two transcriptional start sites by thyroid hormone. Journal of
Biological Chemistry 262 981–987.
Chakraborti P, Maitra G & Bhattacharya S 1986 Binding of thyroid
hormone to isolated ovarian nuclei from a freshwater perch,
Anabas testudineus. General and Comparative Endocrinology 62 239–246.
Chatterjee A, Hsieh YL & Yu JYL 2001 Molecular cloning of cDNA
encoding thyroid stimulating hormone subunit of bighead carp,
Aristichthys nobilis and regulation of its gene expression. Molecular
and Cellular Endocrinology 174 1–9.
Chin WW, Carr FE, Burnside J & Darling DS 1993 Thyroid
hormone regulation of thyrotropin gene expression. Recent Progress
in Hormone Research 48 393–414.
Croyl ML & Maurer RA 1984 Thyroid hormone decreases
thyrotropin subunit mRNA levels in rat anterior pituitary.
DNA 3 231–236.
Cyr DG & Eales JG 1988 The influence of thyroidal status on
ovarian function in rainbow trout, Salmo gairdneri. Journal of
Experimental Zoology 248 81–87.
Cyr DG & Eales JG 1996 Interrelationships between thyroidal and
reproductive endocrine systems in fish. Reviews in Fish Biology and
Fisheries 6 165–200.
Gorbman A, Dickhoff WW, Vigna SR, Clark NB & Ralph CL 1983
The thyroid gland. In Comparative Endocrinology, pp 185–275. Eds A
Gorbman, WW Dickhoff, SR Vigna, NB Clark & CL Ralph.
USA: John Wiley & Sons Inc.
Gregory CC & Porter TE 1997 Cloning and sequence analysis of a
cDNA for the beta subunit of chicken thyroid-stimulating
hormone. General and Comparative Endocrinology 107 182–190.
Hamano K, Inoue K & Yanagisawa T 1990 Immunohistochemical
localization of thyrotropin releasing hormone in the brain of carp,
Cyprinus carpio. General and Comparative Endocrinology 80 85–92.
Han YS, Liao IC, Huang YS, Tzeng WN & Yu JYL 2003a Profiles
of PGH- , GTH I- , and GTH II- mRNA transcript levels at
different ovarian stages in the wild female Japanese eel Anguilla
japonica. General and Comparative Endocrinology 133 8–16.
Han YS, Liao IC, Huang YS, He JT, Chang CW & Tzeng WN
2003b Synchronous changes of morphology and gonadal
development of silvering Japanese eel, Anguilla japonica. Aquaculture
219 783–796.
Han YS, Yu JYL, Liao IC & Tzeng WN 2003c Salinity preference
of the silvering Japanese eel, Anguilla japonica: evidence from the
pituitary prolactin mRNA levels and otolith strontium/calcium
ratios. Marine Ecology Progress Series 259 253–261.
Hayashizaki Y, Miyai K, Kato K & Matsubara K 1985 Molecular
cloning of the human thyrotropin-beta subunit gene. FEBS Letters
188 394–400.
Høgåsen HR & Prunet P 1997 Plasma levels of thyroxine, prolactin,
and cortisol in migrating and resident wild arctic char, Salvelinus
alpinus. Canadian Journal of Fisheries and Aquatic Sciences 54
2947–2954.
Hsieh YL, Chatterjee A, Lee G & Yu JYL 2000 Molecular cloning
and sequence analysis of the cDNA for thyroid-stimulating
hormone subunit of muscovy duck. General and Comparative
Endocrinology 120 336–344.
Ikuta K, Aida K, Okumoto N & Hanyu I 1985 Effects of thyroxine
and methyltestosterone on smoltification of masu salmon
(Oncorhynchus masou). Aquaculture 45 289–303.
Ito M, Koide Y, Takamatsu N, Kawauchi H & Shiba T 1993 cDNA
cloning of the beta subunit of teleost thyrotropin. PNAS 90
6052–6055.
Iwata M 1995 Downstream migratory behavior of salmonids and its
relationship with cortisol and thyroid hormones: a review.
Aquaculture 135 131–139.
Lokman PM & Young G 1998a Gonad histology and plasma steroid
profiles in wild New Zealand freshwater eels (Anguilla dieffenbachia
and A. australis) before and at the onset of the natural spawning
migration. I. Females. Fish Physiology and Biochemistry 19
325–338.
Lokman PM & Young G 1998b Gonad histology and plasma steroid
profiles in wild New Zealand freshwater eels (Anguilla dieffenbachia
and A. australis) before and at the onset of the natural spawning
migration. II. Males. Fish Physiology and Biochemistry 19 339–347.
Matz SP & Takahashi TT 1994 Immunohistochemical localization
of thyrotropin releasing hormone in the brain of Chinook salmon
(Oncorhynchus tshawyscha). Journal of Comparative Neurology 345
214–223.
McNabb FMA 1992 Thyroid Hormones. New Jersey: Prentice-Hall Inc,
Englewood Cliffs.
Morrison TB, Weis JJ & Wittwer CT 1998 Quantification of low
copy transcripts by continuous SYBR Green 1 monitoring during
amplification. BioTechniques 24 954–962.
Pankhurst NW & Lythgoe JN 1982 Structure and colour of the
integument of the European eel, Anguilla anguilla (L.). Journal of Fish
Biology 21 279–296.
Paradet-Balade B, Schmitz M, Salmon C, Dufour S & Quérat B
1997 Down regulation of TSH subunit mRNA levels by thyroid
hormones in the European eel. General and Comparative Endocrinology
108 191–198.
Paradet-Balade B, Salmon C, Hardy A & Quérat B 1998
Heterogeneity of eel thyrotropin ßmRNAs is due to a minisatellite
in the 3 untranslated region of the gene. Gene 215 251–257.
Pierce JG & Parsons TF 1981 Glycoprotein hormones: structure and
function. Annual Review of Biochemistry 50 465–495.
Prasad C 1985 Thyrotropin releasing hormone. In Handbook of
Neurochemistry, vol 8, pp 175–200. Ed. L Abel. New York: Plenum
Press.
Quérat B, Sellouk A & Salmon C 2000 Phylogenetic analysis of the
vertebrate glycoprotein hormone family including new sequences
of sturgeon (Acipenser baeri) beta subunits of the two gonadotropins
and the thyroid-stimulating hormone. Biology of Reproduction 63
222–228.
Rohr DH, Lokman PM, Davie PS & Young G 2001 11-Ketotestosterone
induces silvering-related changes in immature female short-finned eels,
Anguilla australis. Comparative Biochemistry and Physiology 130A 701–714.
Sarapura VD, Samuels MH & Ridgway CE 1995 Thyroid
stimulating hormone. In The Pituitary, pp 187–229. Ed. S Melmed.
Malden. Massachusetts: Blackwell Science Inc.
Schwartz J 2000 Intercellular communication in the anterior
pituitary. Endocrine Reviews 21 488–513.
Sohn YC, Yoshiura Y, Suetake H, Kobayashi M & Aida K 1999
Isolation and characterization of the goldfish thyrotropin beta
subunit gene including the 5 -flanking region. General and
Comparative Endocrinology 115 463–473.
Soyano K, Saito T, Nagae M & Yamauchi K 1993 Effects of thyroid
hormone on gonadotropin-induced steroid production in medaka,
Oryzias latipes, ovarian follicles. Fish Physiology and Biochemistry 11
265–272.
Suzuki K, Dong L & Hew CL 1995 A gene encoding Chinook
salmon (Oncorhynchus tshawytscha) gonadotropin subunit: gene
structure and promotor analysis in primary pituitary cells.
Molecular Marine Biology and Biotechnology 4 10–19.
Tesch FW 1977 The Eel. Biology and Management of Anguillid Eels.
London: Chapman and Hall.
TSH cDNA cloning and expression during eel silvering · Y-S HAN and others 193
www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 179–194
16. Tzeng WN, Han YS & He JT 2002 The sex ratios and growth
strategies of wild and captive Japanese eels, Anguilla japonica. In
Developments in Understanding Fish Growth. International Congress on the
Biology of Fish, pp 25–42. Eds B Small & D MacKinlay.
Vancouver: University of British Columbia.
Ura K, Hara A & Yamauchi K 1994 Serum thyroid hormone,
guanine and protein profiles during smoltification and after
thyroxine treatment in the masu salmon, Oncorhynchus masou.
Comparative Biochemistry and Physiology 107A 607–612.
Yamamoto K, Oomori M & Yamauchi K 1974 Oogenesis of the
Japanese eel. Bulletin of the Japanese Society of Scientific Fisheries 40 9–15.
Yamano K, Tagawa M, de-Jesus EG, Hirano T, Miwa S & Inui Y
1991 Changes in whole body concentrations of thyroid hormones
and cortisol in metamorphosing conger eel. Journal of Comparative
Physiology 161B 371–375.
Received in final form 15 August 2003
Accepted 17 September 2003
Y-S HAN and others · TSH cDNA cloning and expression during eel silvering194
www.endocrinology.orgJournal of Molecular Endocrinology (2004) 32, 179–194