DNA sequencing techniques have evolved over time. The dideoxy method developed by Sanger is useful for sequencing short DNA fragments of 500-750bp by terminating the chain with ddNTPs. Whole genome sequencing became possible using shotgun sequencing, which breaks the genome into random fragments that are sequenced and then reassembled. More recently, pyrosequencing was developed for sequencing by synthesis and allows accurate, parallel, and automated sequencing without the need for gel electrophoresis.

1. Presented by
Ena Athaide
Institute of Science, Mumbai
Msc-1,sem 2

3. Base linked to a 2-deoxy-D-ribose at 1’ carbon
Nucleosides with a phosphate at 5’ carbon
Nucleosides
Nucleotides

4. DNA Polymerase

5.  Methods:
1. Chain termination or dideoxy method
 F. Sanger
1. Shotgun sequence method
2. 2nd
generation sequence methods
 Pyrosequencing

6.  4 Steps:
1. Denaturation
2. Primer attachment and extension of bases
3. Termination
4. Gel electrophoresis

7. 1
4
3
2
Gel
electrophoresis
5

8. • ddNTP- 2’,3’-
dideoxynucleotide
• No 3’ hydroxyl
• Terminates chain
when incorporated
• Add enough so each
ddNTP is randomly
and completely
incorporated at each
base

9. • Run four separate
reactions each with
different ddNTPs
• Run on a gel in
four separate lanes
• Read the gel from
the bottom up

11.  The dideoxy method is good only for 500-
750bp reactions
 Expensive
 Takes a while
 The human genome is about 3 billion bp

12.  Began in 1990
 Why?
 Human evolution
 Nature versus nurture
 Causes of disease

13.  Used to sequence
whole genomes
 Steps:
 DNA is broken up
randomly into
smaller fragments
 Dideoxy method
produces reads
 Look for overlap of
reads
Strand Sequence
First Shotgun Sequence
AGCATGCTGCAGTCATGCT-------
-------------------TAGGCTA
Second Shotgun Sequence
AGCATG--------------------
------CTGCAGTCATGCTTAGGCTA
Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA

14.  Sequencing by synthesis
 Advantages:
 Accurate
 Parallel processing
 Easily automated
 Eliminates the need for labeled primers and
nucleotides
 No need for gel electrophoresis

15.  Basic idea:
 Visible light is generated and is proportional to the number
of incorporated nucleotides
 1pmol DNA = 6*1011
ATP = 6*109
photons at 560nm
DNA Polymerase I from E.coli.
pyrophospate
From fireflies, oxidizes luciferin and generates light

16.  1st
Method
 Solid Phase
○ Immobilized DNA
○ 3 enzymes
○ Wash step to remove nucleotides after each addition

17.  2nd
Method
 Liquid Phase
○ 3 enzymes + apyrase (nucleotide degradation enzyme)
 Eliminates need for washing step
• In the well of a microtiter
plate:
• primed DNA
template
• 4 enzymes
• Nucleotides are added
stepwise
• Nucleotide-degrading
enzyme degrade previous
nucleotides

20.  Smaller sequences
 Nonlinear light response after more than 5-6
identical nucleotides

21.  DNA sequencing is a common procedure
 Dideoxy method
 Chain termination method
 Best for small DNA segments
 Whole genome shotgun sequencing
 Sequence human genome
 Fragments larger DNA strand to manageable chunks
 Pyrosequencing
 Sequence by synthesis
 Accurate and fast

22. Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000)
Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3rd
ed. Pgs 337-340.
Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci.
74, 560-564.
Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3-11.
Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chain-terminating
inhibitors. Proc. Natl. Acad. Sci. 94, 5463-5467.
Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, 1135-
1145
Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.