Downloaded 49 times
More Related Content
Dna and genes
- 1.
- 2. Things to findout: • What is DNA? • The Genetic Code • The Human Genome
- 3. Diversity of Life •All biological systems are composed of the same types of molecules • Similar organization principles are used at the cellular level
- 4. The Cell • Basiccomponent of life • Two main categories, prokarytic and eukaryotic cells • Differences in the nucleus
- 5. • Prokaryotes: no definednucleus and a simplified internal structure • Eukaryotes: membrane limited nucleus and complicated internal structure • Three branches of
- 6. • Genetic materialis located in nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA • DNA contains the information needed to build an individual
- 7. What is DNAneeded for? • Genetic information is transferred from DNA and converted to protein •RNA molecules work as messengers •Proteins are the biological workers
- 8. •Information of theDNA is copied to a RNA molecule in transcription •RNA directs the protein synthesis in a translation •Protein’s 3D structure determines it’s function •Information transfer only in one direction
- 9. DNA (Deoxyribo NucleicAcid) •a polymer of nucleotide monomers •2’-deoxyribose sugar •Four bases: •Adenine, A •Guanine, G •Thymine, T •Cytosine, C Sugar part Base part
- 10. Four bases... Purine bases •Adenine and guanine • Two carbon rings Pyrimidine bases • Thymine and cytosine • A single carbon ring
- 11. DNA chains • Nucleotidesare joined with phosphodiesteri bond • Sequence of bases vary genetic information • Extremely long chains!
- 12. DNA Molecules • Twopolynucleotide chains are joined • Double helix, twisted in right handed way • Full circle in every 10 bases
- 13. •”ladder-structure” –Bases = steps –Sugarsand phosphates = supporting pilars •Two nucleotide chains run in opposite directions chemical direction (5´-3´)
- 14. Complementary Pairing • Basespair with other bases • Space between the chains is limited Purines with two carbon rings pair only with single ring pyrimidines A + T G + C • Complementary pairing is vital for the use and storage of the genetic information! •Interaction is stabilized by hydrogen bonds
- 15. The Genetic Code •Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein)
- 16. • The fourbases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons
- 17. Frame 1 Met FP P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H •Right reading frame is obligatory! •Part of the sequence from psoriasis associated gene HCR • Three different reading frames can be used, but only one is the right one •Translate tools are found from the internet atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc The right one
- 18. DNA chromatin chromatin fibers fibers connectedto chromosome scaffold Condenced scaffold Chromosome
- 19. Genes • A gene:DNA sequence that is needed to encode amino acid sequence of a protein • Composed of exons, introns and different control elements • Exon – protein coding sequence • Intron – intervening sequence
- 20. • Genes varya lot in size: Humans: average 3000bp largest 2.4 million bp •Genes are separated by sequences with unknown function •Only one strand of the DNA carries biological information template strand •Potential to store biological information is enormous
- 21. That’s all forthis time!
- 22. The Human Genomeand Inheritance
- 23. • 3 billionbase pairs • about 22 000 genes • Only 2 % of the DNA encode proteins • Genes include exons and introns • Beside coding areas also additional secuences are found • 50 % repeated sequences (”junk DNA”) The Human genome... The different types of sequences that make up the total DNA of a human cell
- 24. • 23 chromosomepairs 46 chromosomes • 44 autosomes, 2 sex chromosomes • X and Y –chromosomes • XX female • XY Male
- 25. Chromosomes carrying the samegenes are called homologous
- 26. Mutations • Alterations inDNA sequence • Some are part of normal DNA variation • Caused by chemical and physiological agents and errors in DNA replication • Cells can repaire some mistakes • If not repaired changes in DNA sequence are made permanent by DNA replication
- 27. Point mutations: Single basemutations: 1. Missense mutation: leads to an amino acid change 2. Silent mutation: does not change the amino acid 3. Nonsense mutation: causes premature stop-codon
- 28. • Frameshift mutations: insertion/deletion dublication translocation Alteredreading frame Severe impacts on protein structure
- 29. Passing on thegenetic information: • Information passed on in the sexual reproduction • Needed for new characteristics to develop • Offspring recieve genes by inheriting chromosomes
- 30. Two important terms... Phenotype:The outlook of an organism Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTC CCACTTTCAAGCTCGGCCCC TTTCAACTCAGAGAGGCGGC TAGACACCCAGAGACCTCAA GTGACCATGTGGGAACGGGA TGTTTCCAGTGACAGGCAG GCCAAGAATGGCTCCCACC TGGCTCTCAGACATTCCCCT GGTCCAACCCCCAGGCCAT CAAGATGTCTCAGAGAGGC GGCTAGACACCCAGAGACC TCAAGTGACCATGTGGGAA CGGGATGTTTCCAGTGACA GGCA Genotype Phenotypes Genotype
- 31. All somatic cells •23 chromosome pairs (46 chromosomes) • Diploid cells, 2n Sperm cell • 23 chromosomes • Haploid cell, n Egg cell • 23 chromosomes • Haploid cell, n Fertilization: n n + Fertilized egg • 2n • 46 chromosomes
- 32. A chromosome pare: •A locus • An allele
- 33. Mitosis • Division ofsomatic cells • Products two daughter cells from one parent cell • The number of chromosomes does not change • DNA duplicates before entering the mitosis • Takes 1-2 hours
- 34. Meiosis • Only ingamete formation • One diploidic parent cell produces four haploid gametosytes • Mature gametocytes have 23 chromosomes (n)
- 35. • Chromatids changeparts between homologous chromatids during the meiosis • Causes redistribution of heridary material between the homologous chromosomes number of genes doesn’t change new allele combinations are formed Crossing over:
- 37. Inherited diseases • DNAmutations are significant in development of diseases • Inherited diseases are caused by mutations passed from a parent to a offspring • Monogenic diseases: disease is caused by one mutation in one gene • Multifactiorial diseases: disease is caused by interaction of different mutations and environmental factors • Mendelian inheritance: Presence or absence of the phenotype depends on the genotype at a single locus
- 38. • Dominant character:only one allele needed to cause the phenotype (heterozygous) • Recessive character: both allels needed to cause the phenotype (homozygous)
- 40. Autosomal dominant inheritance: Aaaa Aa Aa aa
- 41.
- 42. X-chromosome linked recessiveinheritance:
- 43. X-chromosome linked dominantinheritance: