Recommended
More Related Content
What's hot
What's hot (20)
Similar to Congreso de Biotecnología Arequipa Perú June 2011
Similar to Congreso de Biotecnología Arequipa Perú June 2011 (20)
More from Mills Cbst
More from Mills Cbst (17)
Congreso de Biotecnología Arequipa Perú June 2011
- 1. Bioengineering fluorescent tags from phytochromes found in Thermosynechococcus elongatus Mills CBST Research Project 2011 Presented by Rosa Meza-Acevedo, Alexandria Magallan Tianling Ou, with support from Susan C. Spiller, PI
- 2. Mills College Center for Biophotonics, Science and Technology (CBST) Bioengineer a fluorescent tag Easy-to-detect protein marker Respond to different wavelengths of light Reporter of protein expression Photographs made at CBST – UC Davis
- 3. Bioengineering A Fluorescent Tag “DNA for fluorescent tag” can be bioengineered. In our work, we have engineered a nucleic acid sequence that will be translated into the fluorescent protein that we want. Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
- 4. Introduce the Bioengineered Fluorescent Tagged protein into a living cell Transfection Plasmid with new DNA & tag Nucleus Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
- 5. Transfected Eukaryotic Cell Containing Bioengineered Plasmid with Fluorescent tag Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
- 6. Our Research Goal Bioengineer a small, red fluorescent tag from a cyanobacteriochrome found in Thermosynechococcus elongatus Develop this tag to be useful in cellular imaging techniques in vitro and eventually in vivo
- 7. Our Research Goal Bioengineer a new red fluorescent tag Red illumination of the cytoskeleton Images modified from: cbst.ucdavis.edu
- 8. Why make a red fluorescent tag?
- 10. Limited Imaging
- 12. Longer Amino Acid Sequence
- 14. Limited Imaging
- 16. Longer Amino Acid Sequence
- 18. Brighter red, better imaging
- 19. Not subject to photobleaching
- 22. Homologous genes to classical plant phytochromes
- 23. Photoreverse
- 24. Absorb light energy Active or Non-active state
- 25. Phytochromes: Red Far-red
- 28. GAF Domain Phylogenetic Tree
- 29. Schematic model of the GAF domain and its associated chromophore Chromophore in the GAF binding pocket of protein
- 30. Procedure PCR genomic DNA Restriction enzyme and Ligation Site-Directed Mutagenesis Protein Purification Transformation Protein Expression Visualization! SDS-PAGE gel and Transblot Transfection
- 31. PCR genomic DNA: Genomic DNA from T. elongatusand primers are used in PCR to capture GAF domain only, with the appropriate restriction enzyme recognition sequences at each end. -- Genomic DNA gift from Dr. Ikeuchi, University of Tokyo, and Dr. J. Clark Lagarias, University of California, Davis
- 32. Restriction Enzyme and Ligation After we obtain the GAF domain with recognition sites at each end from PCR, it is digested with the restriction enzymes, and then ligated by annealing to the sticky ends of the pBAD plasmid, which has been prepared by digesting with the same enzyme. pBAD + inserted GAF domain (569)
- 33. Rolling Circle Site-Directed Mutagenesis: Mutating Cysteine Aspartate Absorb light in the red region Prevent photoreversibility Fluorescence Mutated plasmid
- 34. Mutation of Cysteine (C) in the GAF domain of 569T TGTGAT GGGTTGGCCACAAGCTCGAGATCAGGTAATTGATTGAGCAGGCAGCC AAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTG CGCGATCGCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGA ACTATTGGCCTGCGATCGTGTCATTGTCTATGCCTTTGATGACAACTAT GTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAAGGATCCCTGTTTCC GCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAGCCACG ACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTC CGGCCCCTCAAGGTTCGGGCAAATCTTGTCGTGCCGATGGTGATCGA CGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGTGAACCACG CCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCA CCGGCAGCCTTGTCCTGGAGCGTCTCCATTTCCTTGAGCAGCCCGGG
- 35. Site-Directed Mutagenesis: Example Absorbing in the red region makes the protein look blue! Protein Peak 660nm Red Region
- 36. Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html Transformation of E. coli with pBAD + 569TM insert
- 37. E.Coli with pPL plasmid pPL plasmid Contains genetic information to make PCB Hemoxygenase (Ho1) Reductase (PcyA)
- 38. Plasmids used to express the cyanobacteriochrome 569TM pBAD plasmid + 569TM insert pPL plasmid Produce: GAF domain Phycocyanobilin (PCB)
- 39. Protein Expression Grow E. coli with pPL + pBAD plasmid in batches in culture medium Add IPTG Add L-arabinose E. Coli
- 40. Protein Expression Centrifugation results E. coli cells are colored
- 41. Protein Purification Mechanical Cell Lysis Extract crude protein from cells Centrifuge to separate soluble protein from cells Next Step: Chitin binding www.diversified-equipment.com Microfluidizer http://www.microfluidicscorp.com/
- 42. Protein Purification Column set up
- 43. Protein Purification Protein of Interest Chitin Bead Cleave! Chitin Bead Elute Chitin binding column
- 44. SDS-PAGE The process of using an electric current to separate bands of proteins. Determine the purity of the isolated protein. Pure protein is indicated by a single band of a particular size The size of the protein can be determined
- 45. SDS – sodium dodecyl sulfate Charged groups Anionic detergent Proteins denature Negative charge on proteins Hydrophobic regions http://www.bio.davidson.edu/courses/genomics/method/SDSPAGE/SDSPAGE.html#SDS
- 46. PAGE – PolyAcrylamide Gel Electrophoresis Gel restrains large molecules from migrating as fast as smaller molecules Two gel layers 12% Resolving – pH 8.8 4% Stacking – pH 6.68
- 47. Preparing PolyAcrylimide Gel http://upload.wikimedia.org/wikipedia/commons/7/75/SDS-PAGE_Acrylamide_gel.png- Modified
- 48. Running Gel-Electrophoresis Glass gel cassettes Blue = Negative Red = Positive Protein Sample Inner chamber Outer Chamber Electrode assembly Lid Mini Tank Power Source http://upload.wikimedia.org/wikipedia/commons/4/46/SDS-PAGE_Electrophoresis.png - Modified
- 49. SDS-PAGE Gel Results Rockwell, Nathan .Biochemistry 2008.
- 50. Zinc Acetate Reveals Bilin Binding Rockwell, Nathan .Biochemistry 2008. Comassie stained gel Transblot treated with zinc acetate Rockwell, Nathan .Biochemistry 2008.
- 51. Transfection The process of introducing nucleic acids into eukaryotic cells Opening transient pores in the cell membrane to allow the uptake of material There are biochemical methods and physical methods
- 52. Physical Method of Transfection: Electroporation Use of high-voltage electric pulse to perturb the cell membrane and form transient pores, introducing DNA Highly efficient for the introduction of foreign genes in tissue culture cells, especially mammalian cells
- 53. Electroporation
- 54. Transfection to Jurkat Cells http://www.clontech.com/images/pt/PT3827-5.pdf Plasmid we currently use for transfection Jurkat Cells that are transfected by pDsRed-Monmer-Actin
- 55. Visualizing the Transfected Cells Deconvolution fluorescence microscope at CBST
- 56. A video from CBST, taken on a deconvolution microscope
Editor's Notes
- project based on a bacterium that can produce cyanobacteriochromes. The Thermosynechococcus elongatus. I will refer to this bacterium as T. elongatus as short. Thermo SIN A CO COCK uss
- We are part of a group called Mills College Center for Biophotonics, Science and Technology in Oakland, California. The main goal of this group is to bioengineer fluorescent proteins. Definition: Biophotonics = the study of the interaction of light with biological material- where “light” includes all forms of radiant energy whose quantum unit is the photonCells pic – Image to your left is Human lymphocyte cell, called a Jurkat E6-1 Cell in the middle is a Jurkat labeled with GFP, Cell on the right is a Jurkat labeled with DsRed-Monomer.Mouse picFluorescent tags are easy to detect protein markers that can be inserted into a living organism. Different fluorescent tags respond to certain excitation wavelengths of light. For example, in the image to your right there are 6 genetically engineered rats. Of the 6, 3 are fluorescing bright green under UV light because they are expressing www.teachengineering.org/view_activity.php?ur...a green fluorescent protein otherwise known as GFP. GFP was cloned from jellyfish over 30 years ago. It’s primary use is to report successful protein expression. Under UV light, we can see that the rats that are fluorescing green are the rats that have successfully synthesized the bioengineered tag. Most times these tags will include additional genetic changes, so the glow factor serves as a reporter of which rat has these changes in their DNA. GFP is a widely used fluorescent protein in bio imaging, however, each year new fluorescent proteins are being developed to improve bio imaging techniques.
- DNA RNA ProteinSite directed mutagenesis is used to make a specific amino acid change by altering DNA at the appropriate location on the geneThe changed codon results in a changed protein after transcription and translationRestriction enzyme digestion---we cut the plasmid open and the ends of our PCR product so that the sticky ends match and orientation of our insert will be correct.Here (below, in the box) we need to show one of our genescut out the GAF domainmutate it to achieve flourescence. Then in the next slide this piece of DNA is added to the protein of interest. Make the tag look red to make our point later about our goalem out of plasmids and then reinsert them into dna.WORK ON THIS
- DNA RNA ProteinSite directed mutagenesis is used to make a specific amino acid change by altering DNA at the appropriate location on the geneThe changed codon results in a changed protein after transcription and translationRestriction enzyme digestion---we cut them out of plasmids and then reinsert them into dna.WORK ON THIS
- DNA RNA ProteinSite directed mutagenesis is used to make a specific amino acid change by altering DNA at the appropriate location on the geneThe changed codon results in a changed protein after transcription and translationRestriction enzyme digestion---we cut them out of plasmids and then reinsert them into dna.WORK ON THIS
- Add a red fluorescent tag to the cytoskeleton of a lymphocyte to … traffic controlIlluminating features of traffic control…maybe add an image
- Add a red fluorescent tag to the cytoskeleton of a lymphocyte to … traffic controlIlluminating features of traffic control…maybe add an image
- These truncated cyanobacteriochromes have much shorter amino acids sequence than previously characterized Infrared Fluorescent Proteins (IFPs). For instance, 569 has a sequence of 174 amino acids, while the GFP has over 200 amino acids.Red wavelengths will panatrate through tissues farther than green wavelength. SmuRF:SmuRF stands for small unexpected red fluorescent tag, which is our goal of protein tag.Red wavelengths will panatrate through tissues farther than green wavelength.
- Currently, scientists use market fluorescent tags such as GFP for their imaging protocols. These tags have an emission spectrum that is close to UV light. This limits the capacity to work in vivo however, as UV light damages living cells. In addition, these fluorescent tags are subject to photobleaching. Because most scientific experiments using fluorescent tags require a specific amount of time under light in order to excite these molecules into fluorescence. However, prolonged exposure eventually results in the destruction of these same cells. This presents a major issue in visualization.Modifications have been made to GFP and the family of jellyfish proteins to lengthen its wavelength of emission up to about orange. Also, market fluorescent tags have a longer amino acid sequence. The longer the amino acid sequence, the more obstruction=more chances of structural damage to the cellProduce Reactive oxygen molecule which causes chemical damage to the cell
- One of the major goals in new fluorescent tag development is to construct a fluorescent protein that has better imaging properties than those found in marketed fluorescent tags. Currently, we are working with fluorescent tags found in proteins from cyanobacteria. These proteins fluoresce a brighter red color which is better for bio imaging. Bright red fluorescent tags can be seen under a wider range of microscopes for cellular AND subcellular views which means there is an increased capacity to image the entire animal travels through tissue (red light). Also, these tags are not subject to photobleaching, and with a shorter amino acid sequence they are less obstructive to the proteinsModifications have been made to GFP and the family of jellyfish proteins to lengthen its wavelength of emission up to about orange.
- T.Elongatus is a cyano bacteria. Cyanobacteria makes cyanobacteriochromes. These cyanobacteriochromes are homologous to plant phytochromes. They also show photoreversibility. Photoreversibility is the ability for the chromophore to absorb light energy and convert the protein to which it is covalently bound into inactive and active forms in response to different wavelengthsModel organism for investigating photosynthesis. Thermophilic unicellular rod shaped cyanobacterium that lives in hot sprinfs Define the importance of a “stable” protein: easier to work with in the lab and to replicate and also bc they have to exist under higher temperatures.Plants use phytochromes as sensors to modify their growth and development, constituting “shade avoidance syndrome”---for example, when a plant is shaded by another plant in a canopy, the phytochrome species will interconvert between red and far red, thus initiating transcriptional signaling cascades. This signaling cascade will then cause the plant to elongate and project its leaves into regions of sunlight.
- There are 5 cyanobacteriochromes but over the summer we focused our experiments on 2: 569 and 899. Both of these exhibit multiple protein domains, which are units of protein structure. We are only interested in the GAF domainEach of these phytochrome-like proteins consist of a protein + bilin chromophore. Protein domain consists of several different domains but we are interested in the GAF domain because it is known to bind to the chromophore.Each of these phytochrome-like proteins consist of a protein + bilin chromophore. Protein domain consists of several different domains but we are interested in the GAF domain because it is known to bind to the chromophore. (CHROMPHORE ABSORBS THE PHOTONS TO GIVE IT LIGHT SENSING CAPABILITIES SO PROTEIN CAN BECOME REACTIVE) (ENERGY CAUSES CHROMOPHORE TO ROTATE THUS CHANGING SHAPE OF PROTEIN MAKING IT CATALYTICALLY ACTIVE---SAS)So, now that I have explained what site directed mutagenesis is, we can talk more about our cyanobacteriochromes of interest which are 569 and 899. Both of them have undergone what we call a truncation, which will be represented later with a T, and a truncation mutation, represented as TM. The important thing to remember is that we are only working with the GAF domain which is why we need a truncation to shorten the DNA sequence of the cyanobacteriochromeAdd the phylogentic tree of cyanobacteriochrome.We decided to use the GAF domain only because it is the smallest part/within the protein that could bind the chromophore. The chromophore is absolutely essential for sensitivity to photons. Our project engineers regions of the GAF domain in order to choose the particular wavelength we wish to capture. For example, we wish to absorb red photons in order to fluorescent longer red photons.
- class II Phr proteins. or cyanobacteriochromes, all contain the six Amino Acid identifying motif = XDXCFX (green). This means - any nucleic acid (X), aspartate, X, cysteine, phenylalanine, X.
- Here is the schematic model of the GAF domain of cyanobacteriochrome. You can see that the GAF domain folds the binding pocket of protein (purple ribbons), within which the bilin (chromophore) binds covalently, making the cyanobacteriochrome.
- The next few slides are going to show you the procedures that we used to extract proteins from these cyanobacteriochromes. First, we would go over a procedure call protein expression and then we will follow that with a procedure call protein purification. PCR genomic DNA with primers to capture the GAF domain DNA sequence Insert our PCR product into a transformation vector built upon pBAD by doing restriction enzyme digest and ligation Site directed mutagenesis to change amino acid cysteine in the class II GAF motif to aspartate to make it fluorescence Transform E. coli bacteria with two plasmids pBAD + insert and pPL from Lagarias protein expression in the E. coli system using the plasmids we constructed protein purification to confirm the fluorescence (Wavelength, brightness) SDS-PAGE gel to see the purity and size of the protein Dry the gel for records Transblotting to nitrocellulose paper to demonstrate if the chromophore is covalently attached to the binding pocket Construct another plasmid in which we are going to put our tag next to actin or tubulin and the plasmid will be appropiate for transfecting jurkat cells.\\ Transfection Restriction Enzyme digest to construct the plasmid vector for transforming E. coli or transfecting jurkat cells
- Since we know that the GAF domain binds to the chromophore, in order to induce a conformational change in the structure of the protein, we have a to do a procedure called site directed mutagenesis. Here, site directed mutagenesis is used to make a specific amino acid change by altering DNA at the appropriate location on the gene. In this image, you can see the sequence of the GAF domain, boxed in red is the specific location in that we are interested in. It is at this location where we make a mutation of the cysteine base to a aspartate base. The change of this codon result in a conformational change in the protein, thus preventing photoreversibility. This worked was publish in Biochemistry 2008.
- Restriction Enzyme:Restriction enzymes are DNA-cutting enzymes found in bacteria.Recognition site for the enzyme at either end of the
- We use PCR in this procedure as well.Our designed primers are going to start PCR, making a new plasmid that contains our mutation, and then another restriction enzyme will degrade our old plasmid.Sited directed mutagenesis is used to change cysteine to aspartate in the class II motif of the GAF domain. This particular cysteine is required for the blue/green photoreversibility of native cyanobacteriochromes, but results in bright red fluorescence when changed to aspartate. Since all class II Phr proteins. or cyanobacteriochromes, contain the six Amino Acid identifying motif = XDXCFX (green). This means - X, aspartate, X, cysteine, phenylalanine, X is mutated to - X, asparate, X, aspartate, phenylalanine, X.
- Since we know that the GAF domain binds to the chromophore, in order to induce a conformational change in the structure of the protein, we have a to do a procedure called site directed mutagenesis. Here, site directed mutagenesis is used to make a specific amino acid change by altering DNA at the appropriate location on the gene. In this image, you can see the sequence of the GAF domain, boxed in red is the specific location in that we are interested in. It is at this location where we make a mutation of the cysteine base to a aspartate base. The change of this codon result in a conformational change in the protein, thus preventing photoreversibility. This worked was publish in Biochemistry 2008. The mutation in the published work was Cysteine 499 in the tlr0924 gene, the cysteine in tll0569 is homologous, but in a different position in the nucleic acid sequence. It is, however, part of the same motif that is present in all Class II GAF domains, class II Phr proteins or cyanobacteriochromes, XDXCFX (green)This is the sequence of 569
- this image is an example of another cyanobacteriochrome that has undergone site directed mutagenesis. The protein, Tlr0924, is described in our paper Biochemistry, June 2008In the tube, the mutation made changed the cyanobacteriochrome’s conformation causing it to appear this turquoise (blue green) color. In addition of being turquoise to the naked eye, it also absorbs red wavelengths as you can see it by this spectrophotometer graph.
- If you remember earlier in this presentation, we went over how transfection is used to insert a bioengineered plasmid into a eukaryotic cell. Now, we are inserting a bioengineered plasmid with a red fluorescent tag instead of a green fluorescent tag into a E. coli cell. The process is the same in an eukaryotic cell but because we are using E. coli is called transformation instead of transfection. We are going to use E. coli as our protein manufacturer. The E.coli strain that we use in the laboratory is not pathogenic, like the strains you may hear about in the news recently
- We have the stock of E.coli (LMG194) that contains pPL-PCB plasmids. The pPL plasmids contain two enzymes that will make our bilin chromophore in the E.coli, from the E.coli’s own supply of HEME, After the second transformation, E.coli has two plasmids, pBAD and pPL. They are under the control of chemicals IPTG and L-arabinose, LMG194 will express from both plasmids when these chemicals are added. As the protein that we engineered is expressed, it will covalently bind the bilin, which is made from the E.coli’s HEME. When the protein binds to the bilin, it becomes sensitive/reactive to the photons.
- This is how is it done. We use E.coli as our protein manufacturer because its genome is known and it is easy to work with in a lab. After transforming E.coli with our plasmid that has our red fluorescent tag, we grow our bacteria in a flask. This culture is allowed to grow overnight in order to have the optimal amount of bacteria. After this, we will induce protein expression by adding two chemicasl that would turn on the promoter within both of our plasmids, thus causing the expression of our protein of interest. If protein expression is successful, we should expect to see the non-mutated protein as a yellow color, while our mutated protein should be a bright blue color because it is absorbing red light.Using Escherichia coli (E. coli) as our Protein ManufacturerWhen expression of both plasmids has been initiated with IPTG and L-arabonse, the E.coli cells are incubated with shaking at 37 celcius degree for 18 – 24 hours. After expression for 18 -24 hours, E.coli cells are collected by centrifuging.
- These are results of a recent protein expression completed this summer. Here we can see that 569T and 899T, our non-mutated protein, does show a bright yellow color while our mutated protein, 569TM shows bright blue color. If these pellets were exposed to red exciting light, we would expect to see our 569TM fluoresce red in longer wavelengths. T stands for truncated, and TM stands for truncated and mutated. Add a new pic for this
- After protein expression, we have to lyse the cells open in order to purify the protein. This image to your right is called Microfluidizer which is used to mechanically lyse the cells. There are several steps to this process but to overview once the cell is properly lyse, it will be centrifuge to further extract parts of the cell that we are not interested in. This leads us to one of the final steps in protein purification called column chitin binding.
- The supernatant from centrifugation is dripped over the chitin beads in the column.As we can see in this image, the chitin beads that have been successfully bound to the protein are now blue. The next step is to completely cleave this bound protein from our chitin beads which is a step that we are currently working on.
- Here is a closer image of how the beads binds to the protein. We can see that the protein expressed by E. coli has a chitin binding domain. This domain will attach to the chitin bead. Other proteins and cellular components from E. coli are washed away from the column after the chitin beads grasp onto our engineered protein. After they are washed successfully, then we can then cleave the chitin binding domain from our protein of interest so the only part we are left with is our most purified form of the protein.
- First we will look at SDS, an anionic detergent, that is able to denature a protein to its primary structure without breaking the amino acid chain.With the presence of negatively charged sulfate ions, the entire linearized protein is covered with a net negative charge. This charge ensures that proteins of similar size are able to migrate at about the same rate. It also allows for the proteins to travel from the negative anode pole to the positive cathode pole when an electric current is applied to the gel.
- The polyacrylamide gel is meant to provide obstacles for the migrating protein. Smaller proteins can move through the gel faster because they are able to maneuver through the polymer easier than large proteins.The gel is SDS-PAGE is composed of two layers. When making the gel, the resolving gel, or stacking gel, is added first. It is composed of 12% acrylamide and has a pH of 8.8. It is in this bottom layer of the gel where we will see more separation between the bands. The increase amount of acrylamide provides narrow channels in which the proteins can travel, here is where we will see smaller bands move further down the gel.The stacking gel is added last and forms the upper layer. It is composed of 4% acrylamide and has a pH of 6.68. This gel is more porous, allowing for the proteins of different size to become “stacked” against each other when the come to the interface of the resolving gel. As they are stacked, the proteins are then able to start their migration through the resolving gel at the same time.
- Here are the general steps in preparing the acrylamide gel. Using gel glass plates and a casting frame. The two plates will be place on top of one another.The resolving gel will be added first to the small space between the plates. Water will soon be added to prevent mixture with the air and create a flat surface at the top of the gel.After polymerizing for 45 minutes the stacking gel is added.Immediately after the stacking gel is poured the comb, which forms the gel into wells, is inserted between the plates. This is where the proteins will be loaded.Once polymerization has occurred, the gel is ready to use.
- We place the gel plates facing toward each other in the electrode assembly, which is then lowered into the mini tank.Running buffer is added to the inner chamber between the two plates, as well as in the outer chamber. Buffer in these two regions allows for an electric current to flow through the gels.Now that the buffer is added, the samples can be loaded into the wells. Once this is complete. The mini tank is covered with a lid that is attached to the power source. An electric current travels through the negative anode end, into the inner chamber, down the gels, out through the outer chamber, and back through the positive anode end to the power source.We would like to visually show you this process through a short video.**show video
- Here is a sample of one of our results after drying the gel. You can see the ladders which show the relative sizes of the proteins.We can determine the purity of the protein by the one band position that is seen across the gel. Each protein is relatively the same size. We also compare the our proteins to our control chp1. chp1 is a protein that is slightly smaller than the sample proteins used in this gel.In our lab we want to know if bilin chromophore is covalently bound to our protien, therefore we perform one more test based on the polyacrylamide gel.(Information on hand….do not state in presentation)12/27Lane 1: Ladder used to relate compartative sizes of proteinsLane 2: Cph1 – bacterial phytochrome that we use as a control. We compare protein size. What you see here are the proteins before truncation (shortened) to GAF only domain of the 924 gene.Lane 3: Full length 924 without mutationLane 4: Full length with mutation (924) of cystine to aspartateLane 5: LadderLane 6: Full length protein with cystine mutated to alanineLane 7: BlankLane 8: 924 with cystine to aspartate mutation, but with no chromophore (apoprotein)
- To determine the presence of the chromophore, we transfer the proteins from the gel to nitrocellulose using Bio-Rad transblotting equipment.The nitrocellulose is incubated overnight in zinc acetate causing proteins which bind the bilin chromophore to fluoresce in ultraviolet light.After SDS-PAGE has linearized the proteins and positioned them on the gel, only covalently bound bilins will have travelled with those proteins during electrophoresis.Zinc acetate – determines if the chromophore is still present. In this particular transblot you can see that the chromphore is present in three of the proteins - the control and two of the cyanobacteriochromes.Now that we know have confirmed that our proteins have bilin covalently bound to them, we can then transfect our plasmids into the mammalian system.
- Transfection: The process of introducing nucleic acids into eukaryotic cells by nonviral methods. Transfection of animal cells typically involves opening transient pores or "holes" in the cell membrane, to allow the uptake of genetic material. There are two methods for transfectionbiochemical methods, such as using calcium phosphatephysical methods, such as electroporation
- The mechanism is based on the use of an electrical pulse to perturb the cell membrane and form transient pores that allow passage of nucleic acids into the cell (Shigekawa and Dower, 1988). This procedure is highly efficient for the introduction of foreign genes in tissue culture cells, especially mammalian cells. In addition, electroporation often requires more cells than chemical methods because of substantial cell death, and extensive optimization often is required to balance transfection efficiency and cell viability.
- General Process of Transfection:Plasmid combines with Tranfection ReagentCombined plasmid and reagent complex enter the cellDNA released in the cellNucleofector:The Nucleofector™ Technology is a novel transfection technology especially designed for the needs of primary cells and difficult-to-transfect cell lines. It is a non-viral method which is based on a unique combination of electrical parameters and cell-type specific solutions.It allows transfected DNA to directly enter the nucleus. Transfection reagentEppendorf tubesDropperSpecial Cuvette
- pDsRed-Monomer-Actin Vector: This plasmid encodes DsRed-Monomer, a monomeric mutant of the Discosoma sp. red fluorescent protein DsRed. The pDsRed-Monomer-Actin fusion protein incorporates into growing actin filaments, allowing visualization of the actin cytoskeleton in living or fixed cells.This plasmid contains all the correct origins of replication and promoter regions to be active in both e.coli and mammalian cells. G418- antibiotic mixture – Neo, allowing the selection of Jurkat cells that actually incorporated the plasmids.Jurkat Cell: Jurkat Cells are an immortalized line of T lymphocyte cells that are used to study acute T cell leukemia, T cell signaling, and the expression of various chemokine receptors susceptible to viral entry, particularly HIV. Jurkat cells are also useful in science because of their ability to produce interleukin 2. Their primary use, however, is to determine the mechanism of differential susceptibility of cancers to drugs and radiation.The cells are Jurkat cells, which are cancerous white blood cells.Graph:The Jurkat cells are expressing DsRed-Monomer actin in its cytoskeleton. Goal:We will test our cyanobacteriochrome sequence by replacing DsRed-Monomer with our bioengineered red fluorescent tag (???)
- The Deconvolution fluorescence microscope at CBST is used for rapid live and fixed cell fluorescence microscopy. It can capture time elapse images showing the red fluorescent cytoskeleton in 2 to 3 dimensions.