1. The document discusses receptors, neurons, and effectors in the nervous and hormonal systems. It explains how stimuli are detected by receptors and transmitted via neurons or hormones to effectors to elicit responses. 2. Neurons transmit signals as electrical impulses, while hormones act as chemical messengers that diffuse through the bloodstream to target cells. Both systems allow the body to detect changes and coordinate responses. 3. Key topics covered include action potentials, neurotransmitters, reflex arcs, muscle contraction, and control of heart rate through receptors in the nervous system.

1. 2 nd time lucky 

2. Caution massive chapter, approach
with care

3. Receptors
Receptors detect stimuli – different receptors detect diff stimuli
Effectors are cells that bring about a response to a stimulus, theses include
muscle cells and glands
Receptors and effectors communicate via the nervous system or hormonal
system

4. Neurones
The nervous system is made up of a network of neurones
1.
The sensory neurone sends electrical impulses from the receptors to
the CNS
2.
Motor neurones from the CNS to effectors
3.
Relay neurones transmits between the sensory and motor neurones

5. How a response is caused
Stimulus
I.e.. waving
Receptors
Light receptors in
eye detect the
wave
Response
Muscles contract
and you wave back
CNS
Info is processed
and a plan Is made
Effectors
Muscle cells are
stimulated by motor
neurones

6. Nervous system
The Nervous system is split
up
Peripheral system – made up to
neurones that connect the CNS to
rest of the body
Somatic system – controls
conscious activity such as
running
Sympathetic system – flight or flight
mechanism, stimulates effectors,
heightens awareness
Autonomic system –
unconscious activities, has two
divisions
Parasympathic system – inhibits
effectors, slows down responses and
calms the body

7. Communication
When a electrical impulse reaches the end of a neurone, neurotransmitters
are secreted directly into the cells, so the response is localised
The transmitters are quickly removed so the response is short lived
The impulses are very fast causing the response to be rapid, allowing for
quick reactions

8. Hormonal system
A gland is a group of cells specialised to secret hormones
Hormones are ‘chemical messengers’ normally are proteins or peptides
The glandes can be stimulated by a change in conc of a substance or by
electrical impulses

9. How it works
Stimulus
Low blood glucose
Hormones
diffuses into
blood, all over
the body but will
only bind to
specific
receptors on
target cells
Receptors on
pancreases cells detect
the change
Response
Glucose is released into the
blood
Slower response and last longer
Hormone
Glucagon
released into
blood
Effectors
Target cells in liver detect
glucagon and convert
glycogen to glucose

10. Action Potentials (AP)
When a receptor is resting there's a difference in charge, this is the potential
difference
The potential diff when a cell is resting is its resting potential
When a stimulus is detected the membrane becomes more permeable and
Na+ floods into cell
This changes the potential diff
The change of the potential diff due to a stimulus is the generator potential
The bigger the stimulus the bigger the generator potential
If its big enough (+40v) an AP will be triggered, this can only happen if the
threshold value is reached
AP are all one size so stimulus strength is measured by AP frequency

11. Pacinian Corpuscles
Detect mechanical stimuli such as pressure
Found in the skin
Contain an sensory nerve ending wrapped in lamellae
When its stimulated the lamellae deform and press on nerve ending
This in turn caused the Na+ channels to deform and open, causing an AP

12. The eyes
Light enters the eye thru the pupil, the iris controls how much light enters
Light rays are focused by the lens of the retina which contain
photoreceptors
Nerve impulses from the photoreceptors are taken to the brain by the optic
nerve, the optic nerve causes a blind spot, where no photoreceptors are
found

13. Photoreceptors
Light enters the eye, hits the photoreceptors and is absorbed by light
sensitive pigments
The light bleaches the pigments causing a chemical change and altering the
membrane permeability of the Na channels
If the threshold value is reached then a impulse is sent along the bipolar
nerve, which connects to the optic nerve and then the brain

14. Rods
Rods are a type of photoreceptor (other is cones)
They are very sensitive to light this Is due to summation many rods join to
one neurone so many weak potentials is enough to reach the threshold value
However because of this they have low visual acuity, so two very close
objects cant be told apart
Only back and white colour

15. Cones
Less sensitive as one cone is joined to one neurone, more light is needed for
a AP
High visual acuity as cones are packed close together, so when light hits two
cones two AP are sent
They can see in colour due to the fact there are three types, red, green and
blue sensitive

16. Neurones
When a neurones resting the outside of the membrane is more +ive than the
inside, as that’s where the most ions are
The membrane is polarised (diff in v)
This is called the resting potential (-70v)
This is maintained by the Na/K pump (2k is pumped in and 3Na out) this uses
ATP
This creates a electrochemical gradient
K is able to diffuse back out of cell via the permeable membrane

17. AP – what happens
1)
Stimulus – excites the cell membrane allowing Na+ channels to open,
and Na+ diffuses into the cell
2)
Depolarisation – potential diff reaches -55v and more channels open
3)
Repolarisation – at +30v Na close and K open and K diffuses of the
neurone
4)
Hyperpolarisation – K+ channels are slow to shut and there's an
overshoot
5)
Resting potential – ion channels reset, the Na/K pump returns the
membrane to its resting potential

18. 3
2
1
4
5

19. AP along a Neurone
When a AP occurs, some of the Na+ that enter the neurone diffuse sideways
This causes the Na+ channels in the next region of the neurone to open and
Na+ to diff in
This causes a wave of depolarisation along the neurone, as the wave moves
away the membrane is in its refractory period, and cant fire an AP

20. Refractory Period
During this period the ion channels are recovering and cant be opened
This acts as a time delay between one AP and the next, insuring that they
don’t overlap but are discrete impulses
Also insures that impulses are unidirectional (one way)

21. All – Or Nothing
Once the threshold value is reached the an AP will always happen
If the threshold isn't reached then there will be no AP fired
A bigger stimulus WONT cause a bigger AP but will cause them to fire MORE
FREQUENTLY

22. Myelination
Some neurones have a myelin sheath, this is an electrical insulator, made of
Schwann cells
Between the cells are bare bits called the nodes of Ranvier, Na+ are conc at
nodes
In a myelinated neurone depolarisation only occurs at the nodes, the
cytoplasm conducts enough charge to depolarise the next node (salutatory
conduction), makes everything very fast

23. Axon Diameter and Temp
AP are quicker along axons with a larger diameter because there’s less
resistance to the flow of ions
With less resistance the depolarisation reaches other parts of the neurone
cell membrane quicker
The speed of condition increases with temperature, as ions diffuse faster
However at 40* the proteins denature and speed decreases

24. Synapses
A synapse is a junction between 2 neurones or an effector
Gap between them is the synaptic cleft
The presynaptic neurone has a swelling called the synaptic knob, which contains
neurotransmitters
When an AP reaches the knob it causes the neurotransmitters to be released into
the cleft and to bind to specific receptors on postsynaptic neurone
When neurotransmitters bind to receptors they can cause a AP on postsynaptic
neurone (or hormonal reactor, or muscle contraction)
Unidirectional
Neurotransmitters are then removed for cleft so response doesn't continue

25. ACh
AP reaches the knob of the presynaptic neurone, this stimulates voltage
gated Ca ion channels to open
Ca diffuse into the knob, causing the synaptic vesicles to fuse with the
presynaptic membrane
ACh is then released into the cleft (exocytosis)
ACh diffuses across the cleft to bind to specific receptors on the
postsynaptic membrane
This causes Na channels to open, resulting in an AP
ACh is removed from cleft by enzyme acetylchlolinesterase, and broken
down, the products are then reabsorbed by the prestnaptic neurone

26. Neuromuscular junctions
Synapse between a muscle cell and a motor neurone
ACh binds to nicotinic cholinergic receptors
The post synaptic has many folds (clefts) which store enzymes
Also membrane has more receptors
AP always triggers a response in muscle cell

27. Neurotransmitters
Excitatory – depolarise the postsynaptic causing AP if threshold reached
(ACh is an example)
Inhibitory – hyperpolarise the postsynaptic (potential diff more –ive)
preventing an AP, GABA is an example it opens the K gates.

28. Spatial summation and Temporal
summation
Spatial
Many neurones connect to one neurone, similar to rods in the eye
Small amount of transmitter is released and altogether a AP is reached
However if a inhibitory transmitter is released there may be no overall AP
Temporal
When two or more impulses arrive in quick succession
AP is then more likely as more transmitter is released into the synaptic cleft

29. Drugs
Some drugs are the same shape as neurotransmitters , they active receptors
so more AP (nicotine mimics ACh)
Some block receptors so they cant be activated, this can result in paralyses
(curare)
Some inhibit the enzyme that breaks down the transmitters, which can lead
to loss of muscle control (nerve gas)
Some drugs can stimulate the release of neurotransmitters from the
presynaptic so more receptors are active (amphetamines)
Some inhibit the release of neurotransmitters from the presynaptic so fewer
receptors are active (alcohol)

30. Muscles - Skeletal
Used for movement
Made up of bundles of cells called muscle fibres, cell membrane of fibres is
called the sarcolemma
Bits of the sarcolemma fold in and stick to sarcoplasm, there called
transverse tubules and they help to spread out the electrical impulses
Sarcoplasmic reticulum runs thru sarcoplasm, it stores and release Ca
Muscle fibres contain a lot of mitochondria to supply ATP
They are multinucleate (many nuclei)
Muscle fibres have lots of myofibrils, which are made of protein and highly
specialised

31. Myofibrils
Thick myofilaments are made of myosin
Shown as dark bands in pics
Thin myofilaments are made of actin
They are shown as light bands in pics

32. Con.
A myofibril is made up of many short sarcomeres
The ends are marked with a Z-line
The centre is the M-line
Around the M-line is the H-zone which contains only myosin filaments

33. Sliding Filament Theory
Myosin and actin slide over each other to make the muscles contract
The sarcomeres return to their original length after contraction
I band gets shorter as does H zone
A band doesn't change but contains more actin
The Z lines get closer together

34. Myosin and Tropomyosin
Myosin filaments have globular heads that are hinged so they can move
back and forth
Each myosin has a binding site for actin and ATP
Actin has binding sites for myosin (actin-myosin binding sites)
In a resting muscle the actin-myosin binding site is blocked by Tropomyosin
which is held in place by troponin
To myofilaments cants slide past each other as the myosin head cant bind to
the actin myosin binding site on the actin

35. Muscle contraction
When an AP from a motor neurone stimulates a muscle cell it depolarises the
sarcolemma, depolarisation spreads down the T-tubules to the sarcoplasmic
reticulum
This causes the release of Ca ions into the sarcoplasm
Ca binds to troponin causing it to change shape removing the Tropomyosin from
the actin-myosin binding site on the actin
This exposes the binding site, allowing myosin head to bind
This forms a actin-myosin cross bridge
Ca ions also activate ATPase which breaks down ATP providing energy for
contraction
This energy moves the myosin head pulling the actin filament along (think rowing)

36. Con
ATP also provides the energy to break the cross bridge, so once its moved
the myosin detaches from the actin
The head then reattaches to a different binding site further along the actin,
forming a new cross bridge
The cycle will continue as long as the Ca is present

37. Stopping contraction
When Ca ions leave their binding site and are moved back via active
transport into the sarcoplasmic reticulum
The troponin molecules return to their original shape and the Tropomyosin
with them blocking the actin-myosin binding site
And the actin filaments slide back to their original position

38. Twitch
Slow twitch muscles
Fast twitch muscles
Muscles fibres contract slowly
Muscles fibres contract quickly
Used for posture
Used for fast movement
Good for endurance activities
Good for bursts of speed and power
Work for a long time (don’t tire easily)
Tire very quickly
Energy is released slowly through
Energy is released quickly by anaerobic
aerobic respiration, lots of mitochondria respiration using glycogen
Red due to lots of myoglobin
White due to less myoglobin

39. Control of heart rate
SAN generate electrical impulses that cause the heart to contract
The rate the SAN contracts is controlled by the medulla in the brain
Animals alter their HR to respond to stimuli
Stimuli are detected by pressure receptors and chemical receptors
Pressure receptors are called baroreceptors and are found in the aorta and
the vena cava, the are stimulated by high or low blood pressure
Chemical receptors are chemoreceptors and found in the aorta, carotid
artery and medulla, they monitor CO 2 and pH levels

40. How does it work
Stimulus
Receptor
Neurone and transmitter
Effector
Response
High
blood
pressure
Baroreceptors
Impulses to medulla, along
parasympathic. ACh
released bind to SAN
Cardiac
muscles
HR slows blood
pressure drops
Low
blood
pressure
Baroreceptors
Impulses to medulla along
sympathetic, release
noradrenaline binds to SAN
Cardiac
muscles
HR increases
blood pressure
rise
High O2
and pH
Chemoreceptors
Impulses to medulla along
parasympathic, ACh binds
to SAN
Cardiac
muscles
HR slows pH
returns to norm
Low O2
and pH
Chemoreceptors
Impulses to medulla along
sympathetic, noradrenaline
binds to SAN
Cardiac
muscles
HR increases pH
returns to nom

41. Reflexes
When the body responds to a stimulus without making a conscious decision
to respond
Very fast and time isn't wasted deciding on a course of action
Helps avoid damage
Relay neurones can override the reflex arc

42. Reflex Arcs
Thermorecpetors in skin detect the heat stimulus
The sensory neurone carries impulses to the relay neurone
Relay to motor
Motor to effectors (muscle)
Muscle contracts preventing burns

43. Taxis and Kinesis
Taxes – when an organism moves away or towards a stimulus (woodlice
away from light – photo taxis)
Kinases – random movement by a non-directional stimulus (woodlice and
humidity, more movement the more humidity)

44. Chemical Mediators
A chemical messenger that acts locally
Secreted from cells
Their target cells are next to where chemical mediators are produced
Only have to travel a short distance, rapid response

45. Histamine and Prostaglandins
Histamines
Stored in mast cells and basophils
Released in response to body being injured or infected
It increases the permeability of the capillaries of the capillaries nearby to
allow more immune system cells into the area
Prostaglandins
Group of chemical mediators that are produced by most cells of the body
Involved in inflammation, fever, blood pressure regulation and clotting

46. Tropism - Plants
Tropism is a response of a plant to a directional stimulus
Plants respond by regulating their growth
+ive tropism towards stimulus and –ive away from stimulus
Phototropism is a response to light
Geotropism is a response to gravity

47. Growth factors and IAA
Chemicals that can speed up or slow down growth in the plant
Produced in the growing regions of the plant and move to where they're
needed
Auxins stimulate growth of shoots by cell elongation
High conc of Auxins inhibits root growth
Auxins that’s produced in the tips of shoots in flowering plants
IAA is moved around the plant to control tropisms, it moves by either active
transport or the phloem
Uneven amounts of IAA cause uneven growth
This means shoots can grow towards the light and up

48. Lot of new stuff, but a lot smaller
than last chapter

49. Homeostasis
Temperature and pH need to be kept constant for similar reasons mainly its
about enzymes and to high temp to pH enzymes will denature bringing
metabolic functions to a halt. Optimum pH is normally around 7 and
optimum temperature around 37*
Glucose concentration also needs to be regulated if the concentration is to
high then the water potential of blood is reduced to a point where water
molecules diffuse out of cells into the blood by osmosis causing the cells to
shrivel and die, if blood glucose is to low then cells are unable to carry out
certain functions as there isn't enough glucose to produce ATP

50. Negative Feedback
Homeostatic systems involve receptors, a communication system and
effectors
Receptors detect when a level is to high or low and the info Is communicated
via the nervous system or hormonal system to effectors, the effectors then
work to counteract the change
The mechanism that restores everything to normal is called –ive feedback
However –ive feedback only works within certain limits if the change is to
great then the effectors may not be able to correct the change
This is how people die of hypothermia

51. Multiple –ive Feedback is handy
• More than one mechanism gives more control over changes in your
internal environment than just the one mechanism
• Having multiple –ive feedback mechanisms means you can actively
increase or decrease a level returning it to normal
• Just the one feedback mechanism means all you can do is turn it ‘on’ or
‘off’ so you can only change a level in one direction. Think like slowing a
car although letting go of the accelerate helps the brake makes it happen
faster and is more effective, it gives you more control

52. Positive Feedback
Some changes trigger a +ive feedback which amplifies the change, the
effectors respond to further increase the level away from the normal, can be
used to rapidly activate something such as blood clotting in a cut. Or it can
kill you, if homeostatic system breaks down
1. Hypothermia is low body temp (below 35*)
2. It occurs when heat is lost from the body faster than it can be produced
3. As temp falls the brain doesn't work properly and shivering stops, and
temp falls further
4. +ive feedback takes the body even further away from normal and will
continue to decrease until your dead

53. Temperature Control
Ectotherms – Reptiles
Endotherms - Mammals
Cant control body temp internally, they
Control their body temp internally by
control temp by changing their behaviour homeostasis and also by behaviour
Their internal temp is dependant on the
external temp (surroundings)
Internal temp is less effected by the
external temps (within certain limits)
Their activity level depends on the
external temp – more active at higher
temp and less active a lower ones
Their activity level is largely independent
of external temp (certain limits)
Have a variable metabolic rate and
generate lil heat themselves
Have a constantly high metabolic rate
and generate a lot of heat form
metabolic reactions

54. Changing Body Temp
Heat loss
Heat production
Heat conservation
Sweating – water
evaporates off skin
removing heat
Shivering – muscles
contract in spasms, more
respiration more heat
production
Less sweating
Hairs lie flat – less air
trapped heat can be lost
easily
Hormones – adrenaline is
released increases
metabolism, more heat
Hairs stand up – erector
pili muscles contract, hairs
stand up, air becomes
trapped
Vasodilation – arterioles
near surface of the skin
dilate, more blood flows,
more heat is lost by
radiation
Vasoconstriction –
arterioles constrict blood
flow to surface less heat
lost by radiation

55. Hypothalamus
The hypothalamus is the part of the brain that maintains body temperature,
it receives both external and internal information from Thermorecpetors on
the skin and in the blood
The Thermorecpetors send impulses along a sensory neurone to the
hypothalamus which in turn sends info along the motor neurone to effectors
The neurones are part of the autonomic nervous system so its all done
unconsciously
The effectors then return the body back to normal temp (-ive feedback)

56. Maintaining Body Temp
Hypothalamus
sends info to
effectors
Vasodilation, sweating, hairs lie
flat
Heat lost, temp
drops
Thermorecpetors
detect change
Normal Temp
37*
Heat gain,
temp increases
Thermorecpetors
detect change
Hypothalamus
sends info to
effectors
Vasoconstriction,
shivering, hairs stand
up, adrenaline
released

57. Blood Glucose
• All cells need a constant energy supply to work, so blood glucose must be
carefully controlled
• The concentration is usually 90mg per 100cm3 of blood, and is monitored
in the pancreases
• The blood glucose levels rise after eating and fall after exercise
• The hormonal system controls blood glucose concentration using insulin
and glucagon, both a secreted by the islets of Langerhans
• Beta cells secret insulin
• Alpha cells secret glucagon

58. Insulin
1. Insulin binds to specific receptors on the cell membranes of liver cells and
muscle cells
2. It increase the permeability of the cell membrane to glucose, so they can
take more up
3. It also activates enzymes that convert glucose to glycogen (glycogenesis)
4. Cells are able to store glycogen in their cytoplasm as an energy source
5. The rate of respiration, so more glucose is used up

59. Glucagon
1. Glucagon binds to specific receptors on the cell membranes of liver cells
2. Glucagon activates enzymes that break down glycogen to glucose
(glycogenolysis)
3. Glucagon promotes the formation of glucose from fatty acids and amino
acids (gluconeogenesis)
4. Also decrease the rate of respiration in cells
Glycogenesis
Glycogen
Glucose
Fatty acids and a.a.
Gluconeogenesis
Glycogenolysis

60. Adrenaline
• Hormone that’s secreted from your adrenal glands, above the kidneys
• Secreted when there's a low concentration of glucose in your blood, when
stressed or exercising
• Adrenaline binds to receptors in the cell membrane of liver cells, it
activates glycogenolysis (glycogen to glucose) and inhibits glycogenesis
• It activates glucagon secretion and inhibits insulin secretion, increasing
glucose concentration
• Gets the body ready for action, by making more glucose available for
muscles to respire
• Both adrenaline and glucagon can activate to glycogenolysis inside the
cell even though they bind to the outside of the cell

61. Glycogenolysis
• Adrenaline and glucagon bind to their specific receptors and activate and
enzyme called adenylate cyclase
• Activates adenylate cyclase converts ATP into a chemical signal called a
‘second messenger’
• The second messenger cAMP
• cAMP activates a cascade that break down glycogen into glucose
(glycogenolysis)

62. Diabetes
Type 1
1. Beta cells in islets of Langerhans don’t produce any insulin
2. After eating blood glucose levels stay high, hyperglycaemia is caused can
result in death
3. It can be treated by regular injections of insulin, but needs to be
controlled or it can cause hypoglycaemia
Type 2
1. Occurs latter in life as a result of obesity
2. Beta cells don’t produce enough insulin or the body doesn't respond
properly to the insulin
3. Can be controlled by controlled eating and weight loss

63. Menstrual Cycle
Also known as the oestrous cycle lasts for around 28 days, it involves
• A follicle developing in the ovary
• Ovulation – when the egg is released
• The uterus lining becoming thicker so that the fertilised egg can be
implanted
• A structure called the corpus luteum developing in the remains of the
follicle
If there's no fertilisation the uterus lining breaks down and leaves the body
through the vagina, this the end of the cycle and being of another

64. Control of Menstrual Cycle
Four main hormones involved
1. FSH – produced by pituitary gland, stimulated the follicle to develop
2. LH – produced by pituitary gland, stimulates ovulation and corpus
luteum to develop
3. Oestrogen – stimulates the uterus lining to thicken, secreted by the
ovaries
4. Progesterone – maintains thick uterus lining, ready for embryo, secreted
by the ovaries
Each one inhibits or stimulated the other as you will see in next slide

65. Stimulation and inhibition
FSH
OESTROGEN
LH
PROGESTRONE

66. Concentration Change
1. FSH stimulates follicle development, oestrogen is released from follicle,
FSH stimulates ovaries to produce oestrogen
2. Oestrogen stimulated the uterus lining to thicken, oestrogen inhibits FSH
3. High oestrogen stimulates pituitary gland to release LH and FSH
4. Ovulation is stimulated by LH (follicle ruptures and egg is released),
ruptured follicle turns into corpus luteum, the corpus luteum releases
progesterone
5. Progesterone inhibits FSH and LH release, the uterus lining is maintained
by progesterone, if no embryo implants the corpus luteum breaks down
and stops releasing progesterone
6. FSH and LH conc increase because they are no longer inhibited, the
uterus breaks down and you bleed

67. -ive and +ive feedback
1. FSH stimulates the ovary to release oestrogen, which inhibits further
release of FSH, this prevents any more follicle development
2. LH stimulates the corpus luteum to develop, which produced
progesterone, which inhibits the release of LH. This prevents more
follicle development when corpus luteum is developing, and insures that
the uterus breaks down if no embryo implants
3. Oestrogen stimulates release of LH, LH stimulates release of oestrogen
and so on, allowing ovulation to happen

68. Bitch of a chapter, but starts of easy

69. DNA – from GCSE
• DNA is a polynucleotide, its made from a phosphate, pentose sugar, and
a nitrogenous base (ATGC)
• The sugar is called a Deoxyribosugar
• DNA nucleotides join together to form polynucleotide strands, has a
sugar phosphate backbone
• 2 DNA stands join together forming H-bonds forming a double helix
• 3 bases form a triplet code and code for a amino acid (a.a), these a.a join
together forming a protein, the sequence of DNA bases codes for
proteins
• DNA cant leave the nucleus so is copied onto RNA which are found in the
cytoplasm, this is called transcription

70. RNA the Basics
• The sugar is a ribosugar not a Deoxyribosugar
• Forms a single strand
• T is replaced with U
• Two types, mRNA and tRNA
• tRNA is a single stranded polynucleotide that’s folded into a clover due to
H-bonds, contains an anticodon (3 bases) and a a.a binding site. Found in
the cytoplasm of a cell. Carries a.a. that are used to make proteins
• mRNA is a single polynucleotide strand, is made in the nucleus during
transcription, and carries the genetic code out of the nucleus to the
cytoplasm where its used to make proteins

71. Transcription
1. RNA polymerase attaches to the DNA at the being of a gene
2. The H-bonds between the two DNA strands break and the helix unwinds
3. One of the strands is then used as a template to make an mRNA strand
4. The RNA polymerase lines up free RNA nucleotides alongside the
template strand, specific base pairing insures that the mRNA is a
complementary copy of the DNA
5. Once the nucleotides have paired up with their specific bases on the DNA
strands there joined together forming mRNA
6. Once the RNA polymerase moves on, the H-bonds reform
7. When RNA polymerase reaches a stop signal, It detaches from the DNA
8. mRNA moves out of the nucleus through the nuclear pore

72. mRNA Splicing
• Genes in eukaryotic DNA contain sections that don’t code for a.a.
• These sections of DNA are called introns and aren't needed, its only exons
that form mRNA
• mRNA with introns is called pre-mRNA
• Introns are spliced from pre-mRNA, and exons are joined together
forming mRNA
• The mRNA then leaves the nucleus for translation

73. Translation
1. mRNA attaches itself to a ribosome and tRNA molecules carry a.a to the
ribosome
2. A tRNA molecules with an anticodon that’s complementary to the first
codon on the mRNA, attaches itself to the mRNA by specific base pairing
3. A second tRNA molecule attaches itself to the next codon on the mRNA
in the same way
4. The two a.a attached to the tRNA molecules are joined by a peptide
bond, and the first tRNA molecule moves away
5. A third tRNA molecules binds to the next codon on the mRNA, it’s a.a
binds to the first two, and second tRNA molecules moves away
6. The process continues forming a polypeptide chain, until it reaches the
stop codon and protein moves away from the ribosomes

74. Genetic Code
• The genetic code is the sequence of base triplets in mRNA which code for
specific a.a
• In the genetic code each base triplet is read in sequence, separate from
the triplet before and after, the code is none overlapping
• Code is degenerate, there are more possible combinations of triplets than
a.a so AGC and ATT could code for the same a.a
• Some triplets are stop sequences which end the production of a protein
and are found at the being and end of mRNA
• The genetic code is universal ATT codes for same a.a in all organisms

75. Regulation of Transcription and
Translation
• All cells carry the same genes, but the structure and function of the cells
differs, because not all the genes in a cell are expressed therefore not all
the proteins are made,
• The transcription of genes is controlled by protein molecules called
transcription factors
1. Transcription factors move from the cytoplasm to the nucleus
2. Where they bind to specific DNA sites near the start of their target genes
3. They can control expression by controlling the rate of transcription
4. Some transcription factor (activators) increase the rate of transcription,
by aiding RNA polymerase and others (repressors) decrease the rate of
transcription, by blocking the RNA polymerase

76. Oestrogen
The expression of a gene can be controlled by other molecules like
oestrogen
• Oestrogen can bind to a transcription factor, forming a oestrogenoestrogen receptor complex
• The complex then moves from the cytoplasm into the nucleus where it
binds to specific DNA sites near the start of the target gene
• The complex can either act as an activator or as a repressor
• Whether the complex act as one or the other depends in the type of cell
and the target gene
• So the level of oestrogen in a particular cells affects the rate of
transcription of certain genes

77. siRNA
• Short, double stranded RNA molecules that can interfere with the
expression of a specific gene
• Their bases are complementary to specific sections of a target gene and
mRNA that’s formed from it
• siRNA can interfere with both the transcription and translation of genes
• It affects translation by RNA interference
1. In the cytoplasm siRNA an associated proteins bind to target mRNA
2. The proteins cut up the mRNA into sections so it can no longer be
translated
3. Preventing the expression of the gene as its protein can no longer be
made

78. Mutations
Mutations are caused by changes to the base sequence, generally during
DNA replication there's two main types
1. Substitution – ATT to AGT this isn't always bad if the sub happens in an
intron or as the genetic code is degenerate it may not affect the a.a.
2. Deletion – ATT to just AT, this is worse as the whole chain is affected, not
as bad towards end of chain as fewer a.a are affected

79. Mutagenic agents
Mutations occur spontaneously, but something's can increase the rate of
mutations these are known as mutagenic agents
UV, ionising radiation and certain chemicals are mutagenic agents, they can
increase the rate of mutation in several ways
• Acting as a base – base analogs (chemicals) can sub for a base during
replication changing the base sequence
• Altering bases – some chemicals can delete or alter bases
• Changing the structure of DNA – some radiation can change the
structural properties of DNA, making DNA replication difficult

80. Hereditary Mutations
Some mutations can cause genetic disorders such as cystic fibrosis
Some mutations can increase the likelihood of developing certain cancers
(BRCA1 increases the chances of breast cancer)
If a sex cell (gamete) containing a mutation for a genetic disorder is
fertilised, the mutation will be present in the fetes

81. Acquired Mutations
Mutations that occurs after fertilisation are called acquired mutations, if
these mutations occur in cells that control the rate of cell division then it can
cause uncontrolled cell division and therefore a tumour or cancer
There are two types of cell that control cell division
1. Tumour suppressor genes – can be inactivated if a mutation in the DNA
sequence occurs, it slows cell division by producing proteins that stop
cells or cause them to self destruct. If proteins aren't produced then the
rate of division increases
2. Proto-oncogenes – effect of the Proto-oncogenes is increased if
mutations occur, they stimulate cell division by producing proteins that
make the cells divide. If mutation occur they can become overactive and
constantly stimulate division

82. Cancer – Acquired Mutations
Prevention – Protect yourself by limiting the amount of contact you have
with mutagenic agents by wearing protective clothing, applying sun cream
and having vaccinations (HPV vaccine)
Diagnosis – Normally diagnosis occurs after systems are showing, those
who are high risk can be screened on a regular basis, which can lead to early
diagnosis and a higher chance of recovery
Diagnosis – if the specific mutation is known then more sensitive tests can
be developed which can lead to more accurate diagnosis and improved
chances of a recovery
Treatment – treatment differs depending on the mutation, certain drugs can
alter specific proteins helping supress cell division, sugary can be carried out
to remove the cancer cells followed by chemo to kill off any left, gene
therapy could treat it as long as it’s a specific mutation

83. Cancer – Hereditary
Prevention – those with hereditary mutations are already at more risk than
others so should avoid gaining any further mutations and therefore should
stay well away from any mutagenic agents, if the person is very high risk
then preventative surgery can the carried out some woman may have a
mastectomy to prevent breast cancer
Diagnosis – screening in a regular basis can catch it early increasing chances
of recovery
Treatment – similar to acquired cancers but as the cancer is normally found
earlier then the treatment isn't always as aggressive

84. Genetic Disorders
Prevention – carriers or suffers of genetic disorders can undergo preimplantation genetic diagnosis during IVF to prevent any offspring having
the disease. Embryos are produced by IVF and screened for the mutation,
only embryos without the mutation are implanted into the womb
Diagnosis – If a person has a family history of a genetic disorder they can
have their DNA analgised to see if they have the mutation or are a carrier, if
they are tested before systems develop any treatment can begin earlier
Treatment – Gene therapy can help some genetic disorders such as cystic
fibrosis, but treatment can differ depending on the mutation and many
treatments help reduce systems not stop the disease, in most cases though
early diagnosis is key and can affect treatment options

85. Stem Cells
• Multicellular organisms are made up to many different cell types that are
all specialised for their particular function (liver cells, WBC etc.)
• All specialised cells came from stem cells
• Stem cells are unspecialised cells that can develop into other types of cell,
when they divide
• Stem cells are found in the embryo and in some adult tissues (i.e.. In bone
marrow)
• Stem cells that can develop into any kind of call are totipotent cells and
are only present in early embryo development the few stem cells that
remain into adult life are calls multipotent cells and are limited to what
they can divide into

86. Specialisation
• Stem cells all contain the same genes but during development not all are
transcribed and translated (expressed)
• Under the correct conditions, some genes are ‘switched off’
• mRNA is only transcribed from specific genes, the mRNA from these
genes are then translated to proteins
• These proteins modify the cell, they determine cell structure and control
cell processes
• Changes to the cell produced by these proteins cause the cell to become
specialised, these changes are difficult to reverse so once a cell becomes
specialised they stay that way

87. Plants – Tissue Culture
• Mature plants also have stem cells, they are found in the growing regions
of the plant
• All stem cells in plants are totipotent
• This means that whole plants can be grown artificially using a process
called tissue culture
1. A single totipotent cell is taken from a growing region of a plant
2. The cell is placed in a sterile growth medium (agar jelly)
3. The plant cells will grow and divide into a mass of unspecialised cells,
given the right conditions and growth factors, these cells will mature and
specialise
4. The cells grow forming plant organs or an entire plant depending on the
growth factor used

88. Stem Cell Therapy
• Stem cells can divide into other types of cell, so could be used to replace
cells damaged by illness or injury
• Bone marrow contains stem cells that can become any BC, so a bone
marrow transplant can be used to replace faulty marrow with good stuff
producing healthy blood cells (leukaemia)
• It can also be used to treat sickle-cell anaemia and SCID

89. Other Options
Scientists are very interested to see if stem cell therapy can help treat other
diseases and are currently researching the use of stem cells in the treatment
off…
1. Spinal Cord injuries – replacing the damaged nerve tissue
2. Heart disease – replacing damaged Heart tissue
3. Bladder conditions – could grow a whole new bladder
4. Respiratory disease – donated windpipes can be stripped down to there
collagen structure and then covers In stem cell tissue
5. Organ transplants – organs could be grown for those on the organ donor
list

90. Benefits of Stem Cells Therapy
There are a many benefits to stem cell treatments
• They could save a lot of lives, those on the organ donor list wouldn’t be
waiting for donors to come forward but would have their own organ
grown for them, decreasing the number that die waiting, also many
successful transplant patients are on drugs the rest of there life to
prevent rejection, the stem cell organ wouldn’t have this issue
• Could improve the quality of life for many people, the bind would see
again as stem cells could replace damaged eye tissue

91. The Problems
Scientists have to get stem cells from somewhere, and there's only two
options
1. From Adults – the cells can be obtained from body tissue, its all very
simple and very little risk is involved, however there is limited use as cells
are multi-potent
2. From Embryos – obtained in the early stages of embryo development,
embryos are produced in IVF and once they are 4-5 days old stem cells
are removed, these can become anything there totipotent, but naturally
this causes a heap of ethical issues

92. Ethics
1. Stem cells form IVF raises a few issues because the embryo could
become implanted In a womb creating life, which can be considered as
wrong
2. Some have fewer objections to stem cells being obtained from
unfertilised embryos as they could only survive a few days anyway
3. And some think that only adult stem cells should be used as they don’t
damage any embryos, even If its currently not possible to do much with
adult stem cells

93. Quite short, quite interesting, quite
tricky
Last Part

94. Techniques
• Polymerase chain reaction – Produces a lot of identical copies of a specific
gene
• In vivo cloning – produces lots of identical copies of genes
• DNA probes – used to identify specific genes
These techniques are then used for many things such as genetic
fingerprinting, genetic engineering, diagnosing diseases and treat genetic
disorders
DNA technology uses DNA fragments, there are 3 ways these fragments can
be obtained
1. Reverse transcriptase
2. Restriction endonuclease
3. PCR

95. Reverse Transcriptase
• Many cells only contain 2 copies of each gene, making it difficult to get a
fragment containing the target gene, but there are many mRNA
molecules which are complementary to the target gene, which is easier to
get
• The mRNA molecules can be used as a template to make lots of DNA,
reverse transcriptase makes DNA from a RNA template, the DNA
produced is called cDNA
• Pancreatic cells produce insulin, they have lots of mRNA that are
complementary to the insulin gene, so reverse transcriptase could be
used to make cDNA from the mRNA
• For this to happen mRNA must first be isolated from the cells, and mixed
with free DNA nucleotides and reverse transcriptase, the mRNA is used as
a template for the cDNA

96. Restriction Endonuclease
• Some sections of DNA are palindromic (GAATTC – CTTAAG)
• Restriction endonuclease are enzymes that recognise specific palindromic
sequences and cut the DNA at these parts
• Different restriction endonuclease cut at different recognition sequences,
the base sequence of the DNA is complementary to the active site of the
enzyme
• If the recognition sequence is the same at each end of the fragment that’s
needed then the restriction endonuclease can separate it from the rest of
the gene
• The DNA sample is incubated with the specific restriction endonuclease,
which cut the fragment via hydrolysis
• The cut can leave sticky ends (preferable) or blunt ends

97. PCR
1. Reaction mixture of DNA, nucleotides, primers and DNA polymerase is
set up (primers are complementary to ends of DNA allowing polymerase
to bind, polymerase builds the new DNA strand)
2. The mix is heated to 95*C breaking the H-bonds
3. Mix is then cooled to 50* is so that primers can attached to DNA strand
4. Mix is heated to 72* allowing DNA polymerase to work
5. The DNA polymerase lines up the nucleotides along the template strand
and by specific base pairing a new complementary DNA strand is formed
6. Two new copies of the template strand are formed and first cycle is
finished
7. The cycle begins again, each cycle doubling the amount of DNA in the
mixture until adequate amounts are produced

98. Gene Cloning
Its all about making two identical copies of a gene, there are two methods
available
1. In vitro – where the gene copies are made outside out a living organism
using PCR
2. In vivo – where the gene copies are made within a living organism, and as
the organism grows, it replicates it DNA creating multiple copies of the
gene

99. In-vivo – Step 1
• The DNA is inserted into a vector (something used to transfer DNA into a
cell i.e.. Virus or plasmid)
• The vector DNA is cut open using the same restriction endonuclease that
was used to isolate the target gene, thus allows the sticky ends to be
complementary to one another
• The vector DNA and DNA fragment are mixed together with enzyme
DNA ligase. The ligase joins the sticky ends together, connecting the
vector and fragment. This process is called ligation
• The new combination of bases in the DNA vector is known as
recombinant DNA

100. In-vivo - Step 2
• The vector with the recombinant DNA is used to transfer the gene into
host cells
• If a plasmid vector is used, the cells need to be encouraged to take up the
plasmid. This is done by placing the cells into ice cold CaCl2 solution
making cell wall more preamble, and then mix is heat shocked,
encouraging plasmids to be taken in
• The bacteria vector will infect the host cells by injecting its DNA into it,
the target gene then integrates itself with the cells DNA
• Host cells that take up the vectors containing the gene are transformed

101. In-vivo – Step 3
• Marker genes are used to discover which host cells took up the
recombinant DNA, they are inserted into the vectors at the same time as
the gene to be cloned
• Host cells are grown on agar jelly, and as each cell divides it creates an
colony (army) of cloned cells
• Transformed cells will produce a colonies where all the cells contain the
target gene and the marker gene
• The marked can code for antibiotic resistance, if the agar plates contain
the antibiotic only the transformed cells will grow and survive
• The marker could be a fluorescing gene, so under UV light a transformed
cells will glow (this is how they make glow in the dark fish/rabbits)
• Identified transformed cells are allowed to continue to grow and produce
more of the cloned gene

102. In-vivo
Advantages
Disadvantages
Can produce mRNA as well as its done in
a living cell
DNA fragments have to isolated, this can
be a very slow process
Can produce modified DNA
Inserting DNA into vector wont work
every time can take several attempts
Large fragments can be cloned
Relatively cheap method

103. In-vitro (PCR)
Advantages
Disadvantages
Can produce a lot of DNA
Only works with small fragments
DNA isn't modified
Cant produce any mRNA
Only replicated fragments of
interest
Can be expensive if you need a lot
of DNA
Very fast

104. Genetic Engineering
• Also know as recombinant DNA technology
• Organisms that have their DNA altered by genetic engineering are called
transformed organisms
• These organisms have recombinant DNA
• Micro-organisms, plants and animals can be genetically engineered to
benefit humans

105. Agriculture
• Agricultural crops can be transformed so that they give a higher yield or
are more nutritious, this reduces malnutrition and famine, crops can be
made resistant to pests, reducing the amount of pesticide needed and
lowering the cost of production
• However people are concerned that monoculture (producing one type of
GM crop) could make the whole crop vulnerable to disease as all the crops
are identical
• There is a chance of super weeds, when GM plants interbreed with wild
plants

106. Industry
• Industrial processes often use biological catalysts, these can be produced
from transformed organisms in large quantities cheaply and quickly
• The production of cheese uses an enzyme found in cows, GM enzymes
save the killing of cows and is a lot cheaper
• However people are worried that if labelling is not clear they may
consume food that been made from GM organisms and could lead to
toxins in the food industry

107. Medicine
• Many drugs and vaccines are produced by transformed organisms, using
recombinant DNA technology, they can be made quickly and cheaply in
large quantities
• For example insulin used to come from cow, horse or pig pancreases
which didn’t work as well as it wasn’t human insulin, now human insulin
can be produced by cloning the human insulin gene
• However there is concern that companies who own the GM tech may be
limiting the use of technology that could be saving lives
• Others are worries that designer babies could be produced having alleles
that were specifically chosen by the parents

108. Humanitarians
• They believe that GM crops can benefit people reducing the risk of famine
and malnutrition such as drought resistance crops in areas prone to
drought
• Transformed crops could be used to produce useful pharmaceutical
products, making the drugs more accessible to people, such as places
where storage is difficult
• Medicine can be produced cheaply, making them more affordably

109. Environmentalists
• Are against GM technologies as it could damaged the environment,
monoculture will reduce biodiversity of an area, and if the transformed
crops interbreed with wild plants the consequences could be massive
• Most the GM technology rests with a handful of large companies, that
with the tech are only getting bigger, preventing smaller businesses from
moving up the corporate ladder.

110. Non-Coding DNA
• Not all of a genome codes for proteins
• Some of the genome consists of not coding repeats of base sequences
i.e. GGCCTATGGCCTATGGCCTAT etc.
• The number of times these sequences repeat is unique to each individual
person (apart from identical twins)
• The repeated sequences occur in many places in the genome, to the
position of the repeats and the number of repeats can be used to identify
people this is genetic fingerprinting

111. Electrophoresis
1. A sample of DNA is obtained from a persons blood/saliva
2. PCR is used to make copies of the fragments of repeating bases on the
DNA, primers bind to repeats so only they are copied
3. You end up with DNA fragments where the length corresponds to the
number of repeats the person has
4. A fluorescent tag is added to all DNA fragments, so they can be
identified with UV light
5. The DNA undergoes electrophoresis, the fragments are placed in wells in
gel that’s submerged in buffer sol, and electrical current is run through
the gel, as DNA has a –ive charge the fragments move to the +ive
electrode
6. The smaller fragments move the fastest so travel further down the gel
7. Alongside the sample run, a sample of known fragment sizes is also run
through and under UV light you can compare the two, and find the size
of the fragments

112. Relationships and Variability
Genetic finger printing can be use to determine genetic relationships
because we inherited our non-coding base sequences from our parents, half
from each parent, so the more bands that match on a fingerprint the more
closely related those to people are, this is how paternity tests work
Another use of fingerprinting is determining genetic variation within a
population, so the few bands that match the more genetically different
people are, this means you can compare the number of repeats in several
places to find how genetically varied a population is

113. Forensics
• Forensic science uses genetic fingerprints to compare samples of DNA
collected at crime scenes, and run them against possible suspects
• DNA is isolated at crime scene
• Each sample is replicated using PCR
• Products are run though electrophoresis
• Is the samples match it proves that person was at the crime scene at
some point, not that they did it
• Victims sample should also be included to avoid confusion

114. Medical Diagnosis
• In medical diagnosis, a genetic fingerprint can refer to a unique pattern of
alleles
• It can be used to diagnosis genetic disorders and cancers, its useful when
the specific mutation isn't known or where several mutations have caused
the disorder, because it identifies a broader, altered genetic pattern
• PGH screens embryos created by IVF for genetic disorders before they
are implanted into the uterus

115. Locating Genes
• DNA probes can be used to locate genes or to see if a person have a
mutated gene
• DNA probes are short strands of DNA, that have specific base sequences
complementary to the base sequence of the target gene
• The DNA probe will hybridise (bind) to the target gene if its present
• The probe will also have a marker attached so it can be identified, the
marker will be radioactive or fluorescent
Here's how its done
1. A sample of DNA is digested into fragments using restriction enzymes
and separated using electrophoresis
2. Separated DNA are transferred to nylon membrane and incubated with
marker
3. If gene present the DNA probe will hybridise
4. The membrane is exposed to UV and a band will appear

116. Restriction Mapping
As well as locating genes, knowing its sequence can be quite handy to, this is
done by DNA sequencing. But genes are a bit to long to sequence as a
whole, so using restriction endonuclease they are cut into smaller
fragments. The fragments are then sequenced and put back in the same
order, restriction mapping is used to do this
1. Different restriction enzymes are used to cut labelled DNA into
fragments
2. The fragments are then separated (electrophoresis)
3. The size of the fragments produced is used to determine the relative
location of the cut sites
4. A restriction map of the original DNA is made, showing all the cut sites

117. Gene Sequencing
1. Into a 4 separate tubes, single stranded DNA, DNA polymerase, primer,
nucleotides and labelled nucleotide (A in one, T in another etc..)
2. The tubes undergo PCR, which replicates the DNA strands, all strands are
of a different length due to the labelled nucleotide stopping the chain
3. For example if a modified T was used to build the new strand instead of a
normal T then the addition of any further bases is stopped i.e.. ATTGCT*
and ATTGCTACT*
4. The DNA fragments in each tube are separated by electrophoresis and
observed under UV light
5. The complementary base sequence can be read from top (furthest from
well) to bottom of the gel

118. Sickle-Cell Anaemia
• A genetic disorder caused by a mutation in the haemoglobin gene
• Causes RBCs to be sickle shaped (concave)
• The sickle RBCs block capillaries restricting blood flow causing organ
damage and pain
• Some people are carriers and have both sickle cell and normal RBCs
• Carriers are better protected against malaria, but does increase the
chances of producing a sickle celled child

119. DNA Probes
• DNA probes can be used to screen for clinically important genes, such as
mutated ones
• There are two ways this can be done
1. The probe can be labelled and used to look for a single gene in a sample
of DNA
2. The probe can be used as a DNA microarray, which can scan lots of genes
at once
Microarrays
• It’s a glass slide with spots of different DNA probes attached to it in rows
• A sample of labelled DNA is washed over the slide
• If the labelled DNA is complementary to the probes it will stick to them,
the tray is then re-washed and examined under UV light
• Any spot that florescent shows that the DNA contains that specific gene

120. Genetic Counselling
• Genetic counselling is advising patients and relatives about the risks of
genetic disorders
• It advises people about screening and explains the results, screening can
help identify the carrier of the gen, the type of mutated gene and the
most effective treatment
• If the results are +ive then the person is advised on the options available
to them, in either prevention or treatment
• For example someone with a history of breast cancer may chose to get
screened and if there is a high chance of developing breast cancer they
may choose to have a mastectomy

121. Deciding Treatment
• Cancers can be caused by mutations to proto-oncogenes and tumour
suppressor genes, different mutations cause different cancers, which
need to be treated in different ways
• Screening using DNA probes can be used to help decide the best course
of treatment
• Breast cancer can be caused by a mutation in the HER2 proto-oncogene,
if the patients cancer is caused by this gene they can be treated with
Herceptin®. This drugs binds to the altered HER2 protein and supresses
cell division, but its only affective against this type of cancer as it only
binds to receptors on the HER2 protein.

122. Gene Therapy
How it works
• Altering the defective genes inside cells to treat genetic disorders and
cancers
• The method all depends on the type of gene, if its caused by to recessive
alleles a working dominant can be added. If the disorders dominant you
can ‘silence’ the allele by adding more DNA to it so it doesn't work
anymore
Getting the new DNA in
• The allele is inserted using vectors either a virus plasmid or liposome
Somatic therapy – altering the alleles in the body cells most affected by the
disorder
Germ line therapy – altering the alleles in sex cells so all the cells will contain
altered DNA (currently illegal)

123. Pros and Cons
Advantages
Disadvantages
Could prolong the lives of people with
genetic disorders and cancers
The effects can be short lived (somatic
only)
Give people a better quality of life
Multiple treatments (somatic)
People with disorder can conceive a
healthy child
Difficult to get allele into target cell
Could decrease the frequency of
sufferers of certain genetic diseases
Vector could produce an immune
response
Allele inserted to wrong place causing
more problems
Allele could be over expressed
People fear designer or super babies

124. Yay you did it, now read until you
know it ALL