DNA carries genetic instructions in all living things and is found in chromosomes within cells. DNA is made up of genes, which are segments that hold instructions to build proteins. Chromosomes contain many genes and hold the DNA. The DNA double helix structure allows genes and instructions to be copied and passed to new cells when cells divide.

1. DNA, Genes, and
Chromosomes

2. 2
Why do we study DNA?
We study DNA for
many reasons,
e.g.,
• its central
importance to all
life on Earth,
• medical benefits
such as cures for
diseases,
• better food crops.

3. Cells and DNA
• All organisms are made of
one or more cells
• With few exceptions, all
cells contain DNA
• All organisms have DNA

4. What is the relationship between
DNA, genes, and chromosomes?
1.DNA is found in all
living things and
carries the
instructions to make
proteins – A single
DNA strand holds
the information to
build many different
proteins

5. What is the relationship between
DNA, genes, and chromosomes?
2.Chromosomes are
strands of DNA
that are coiled up –
A chromosome
holds the
information to
build many
different proteins

6. Why does DNA exist in two
forms?
The DNA instructions can only be
“read” and copied when the strand is
unwound
During cell division, the copied DNA
must be sorted and separated into
two new cells - In order to prevent
the strands from getting tangled and
damaged during cell division, they are
wound into chromosomes

7. What is the relationship between
DNA, genes, and chromosomes?
3. Genes are pieces of DNA that hold the
information to build 1 type of protein – A
chromosome has many genes

8. What is the relationship
between DNA, genes, and
chromosomes?

9. Analogy
Chromosomes
are like phone
books because
chromosomes
have many genes
just like phone
books have many
phone numbers

10. Analogy
Genes are like phone
numbers because
genes hold the
information to build 1
specific protein just
like phone numbers
hold the information
to call 1 specific place
283-7411 Calls
Bansud
National
High School

11. The Structure of the
DNA Molecule
The finger print that is
inside your body!

12. Discovering the structure of DNA
 DNA = Deoxyribose nucleic acid
 Made out of sugars
(deoxyribose), phosphates and
nitrogen bases

13. Discovering the structure of DNA
 Structure was discovered in 1953 by
James Watson and Francis Crick

14. Discovering the structure of DNA
Rosalind Franklin’s DNA image
“Chargoff’s rule”
A = T & C = G

15. DNA stands for:
D: Deoxyribose
N: Nucleic
A: Acid
DNA is too small
to see, but under a
microscope it looks
like a twisted up
ladder!

16. DNA
DNA carries the genetic information in
the cell – i.e. it carries the instructions
for making all the structures and
materials the body needs to function.
DNA is capable of self-replication.
Most of the cell’s DNA is carried in the
nucleus – a small amount is contained in
the mitochondria.

18. DNA - the double
helix

19. Every living
thing has DNA.
That means that
you have something
in common with a
zebra, a tree, a
mushroom and a
beetle!!!!

20. DNA is made up of steps and rails of a ladder.
This is a
rail
This is a step
Green can only go with Red
Purple can only go with Yellow

21. Deciphering DNA's
structure.
1. DNA is made up of subunits
which scientists called
nucleotides.

22. Nucleotides
A nucleotide is a
chemical compound
that consists of 3
portions: a
nitrogenous base, a
sugar, and one or
more phosphate
groups.

23. Deciphering DNA's
structure.
2. Each nucleotide is made up of a
sugar, a phosphate and a base.
3. There are 4 different bases in a
DNA molecule:
a. adenine (a purine)
b.cytosine (a pyrimidine)
c. guanine (a purine)
d.thymine (a pyrimidine

24. 4. The number of purine bases equals
the number of pyrimidine bases
5. The number of adenine bases equals
the number of thymine bases
6. The number of guanine bases equals
the number of cytosine bases
7. The basic structure of the DNA
molecule is helical, with the bases
being stacked on top of each other
Deciphering DNA's
structure.

25. The base pairing rule
Each “rung” of the DNA ladder is
formed from two nitrogen bases.
There are four bases – adenine (A),
thymine (T), cytosine (C), and
guanine (G).
The base adenine always bonds with
thymine (A-T), and cytosine always
bonds with guanine (C-G).

26. The base pairs
The binding of two
nucleotides forms a
base pair. In DNA,
cytosine and guanine
are bound together
by 3 hydrogen
bonds, whereas
adenine and thymine
are bound by 2
hydrogen bonds.

27. Location of DNA
Most of the DNA occurs in the cell
nucleus; however, each mitochondrion
contains 37 genes – this is referred to as
mitochondrial DNA.
Genomic DNA is located in the cell nucleus
of eukaryotes, as well as small amounts in
mitochondria and chloroplasts. In
prokaryotes, the DNA is held within an
irregularly shaped body in the cytoplasm
called the nucleoid.

28. The function of DNA
Genes
A chromosome consists of segments
of DNA known as genes.
Genes contain the instructions for
the construction of a particular
protein, or RNA.
It is estimated that there are about
20,000–25,000 genes in the human
genome (i.e. about 3 billion base
pairs).

29. The genetic
information in a
genome is held within
genes, and the
complete set of this
information in an
organism is called its
genotype.
DNA Molecule
A gene is a unit of heredity and is a region of DNA
that influences a particular characteristic in an
organism.

30. DNA is like a fingerprint because
everyone’s is a little different!
You can tell people apart
by their fingerprints………
and their DNA!

31. Introns and exons
Genes consist of introns and exons
Exons are sections of coding DNA –
i.e. they contain instructions for
making proteins.
 Introns are sections of non-coding
DNA (once called "junk DNA") – i.e.
they do not contain instructions for
making proteins but are now
believed to serve other important
functions.

32. How DNA
works

33. The genetic code
The sequence of bases in a gene is
a code instructing the cell how to
construct a particular protein –
i.e. the number of amino acids and
the order in which they are to be
assembled.

34. Proteins are long chains of
amino acids
The sequence of bases in a gene is a code
instructing the cell how to construct a
particular protein – i.e. the number of
amino acids and the order in which they
are to be assembled.
His
Met
Phe
His
Glu
Pro
Cys
Cys
M
A
Glu K

35. Reading the code
The sequence of bases is read in groups
of three called codons.
Thus the sequence:
AGCCGTTTAGAGAGATTCCTT
Is read as:
AGC CGT TTA GAG AGA TTC CCT
Each codon represents one of the 20
different amino acids.

36. QUIZ
1. A nucleotide consists of:
a. a phosphate and a base
b. a phosphate, and a sugar
c. a base and an amino acid
d. a phosphate, a sugar, and a base

37. 2. In the ladder anology of the DNA
molecule, the "rungs" of the ladder are:
• a. sugars
• b. phosphates
• c. paired nitrogenous bases
• d. joined sugar and phosphate

38. 3. In DNA guanine always pairs with
a. adenine b. cytosine
c. guanine d. thymine

39. 4. In DNA, thymine always pairs with
a. adenine c. cytosine
b. guanine d. thymine
5. Each unit of a nucleic acid consisting
of a sugar, attached phosphate group,
and base is a
a. nucleolus c. nucleotide
b. nucleosomed. histone

40. 6. A DNA molecule has the same amount
of adenine and thymine.
a. True b. False
7. DNA is made up of a phosphate group,
an organic base, and:
a. a protein
b. a sugar
c. a molecule of ATP
d. a fat

41. 8. If one side of a DNA molecule contains
the following sequence of nucleotides,
AGTCCG, the complementary sequence
on the other side would be:
a. GCCTGA
b. AGTCCG
c. TCAGGC
d. CTGAAT

42. 9. During your summer job at Virotech,
you isolate a previously unknown virus.
Analysis of its genome reveals that it is
composed of a double stranded DNA
molecule containing 14% T (thymine).
Based on this information, what would
you predict the %C (cytosine) to be?
• a. 14% c. 28%
b. 36% d. 72%

43. 10. DNA stands for…