The document describes the development of a LAMP method for detecting the parasite Cryptosporidium. Key points:
- LAMP amplifies DNA at a single temperature using multiple primers, allowing for simpler detection than PCR. The researcher developed LAMP primers to detect Cryptosporidium.
- Initial results found the isothermal amplification buffer was better than ThermoPol buffer at detecting a range of Cryptosporidium strains.
- Further work is needed to establish minimum detection levels and field-safe visualization methods like a portable spectrophotometer for use in detecting Cryptosporidium outside the lab.
Diseases are the primary constrains for the development of any living forms i.e., both plants and animals including humans.
Diagnosis is the critical step for effective treatment and control of infectious diseases. PCR (Polymerase Chain Reaction) has revolutionized the earlier detection of infection, tumour etc.,
However, LAMP has several pros over PCR. LAMP is used in rapid diagnosis of viral, bacterial and parasitic diseases. 2. It helps in the identification of genus and species-specific parasites
ABBREVATION: LOOP MEDIATED ISOTHERMAL AMPLIFICATION
First reported by Notomi et al in 2000 of EIKEN Chemical Co. Ltd., Japan.
It is a very sensitive, easy and time efficient method. The LAMP reaction proceeds at a constant temperature using a strand displacement reaction.
Njiru, 2012 has described that " Lack of effective point of care diagnostic tests applicable in resource-poor endemic areas is a critical barrier to effective treatment and control of infectious diseases.” Therefore, Innovations in biotechnology that combine molecular biology, microfabrication and bioinformatics are moving nucleic acid technologies from futuristic possibilities to common laboratory techniques and modes for diagnoses. In this context, LAMP (Loop Mediated Isothermal Amplification) is a highly sensitive and specific DNA/RNA amplification method. Advantage of LAMP is isothermal reaction condition and therefore, LAMP is affordable because of no need to have expensive thermal cycler.
Diseases are the primary constrains for the development of any living forms i.e., both plants and animals including humans.
Diagnosis is the critical step for effective treatment and control of infectious diseases. PCR (Polymerase Chain Reaction) has revolutionized the earlier detection of infection, tumour etc.,
However, LAMP has several pros over PCR. LAMP is used in rapid diagnosis of viral, bacterial and parasitic diseases. 2. It helps in the identification of genus and species-specific parasites
ABBREVATION: LOOP MEDIATED ISOTHERMAL AMPLIFICATION
First reported by Notomi et al in 2000 of EIKEN Chemical Co. Ltd., Japan.
It is a very sensitive, easy and time efficient method. The LAMP reaction proceeds at a constant temperature using a strand displacement reaction.
Njiru, 2012 has described that " Lack of effective point of care diagnostic tests applicable in resource-poor endemic areas is a critical barrier to effective treatment and control of infectious diseases.” Therefore, Innovations in biotechnology that combine molecular biology, microfabrication and bioinformatics are moving nucleic acid technologies from futuristic possibilities to common laboratory techniques and modes for diagnoses. In this context, LAMP (Loop Mediated Isothermal Amplification) is a highly sensitive and specific DNA/RNA amplification method. Advantage of LAMP is isothermal reaction condition and therefore, LAMP is affordable because of no need to have expensive thermal cycler.
Loop Mediated Isothermal Amplification (LAMP)MD ROBEL AHMED
Loop Mediated Isothermal Amplification (LAMP) is a kinds of PCR reaction. This technology is most reliable and convenient than conventional PCR procedure. We can call it updated version of PCR. Rapid, Easy detectable and cheap to accomplish the process.
LAMP is a DNA amplification technology which enables rapid and sensitive detection and when run on the Genie III platform enables detection of pests and diseases outside of the laboratory at any point in the agri-food chain where decisions are being made.
The target audience are researchers, agri-business and forestry experts, farmers and foresters and any other interested in being introduced to this portable molecular diagnostic tools on plant diseases.
Do not hesitate to contact EMPHASIS project through Facebook, Twitter, email (emphasisproject@gmail.com), Youtube or through our website (http://www.emphasisproject.eu/) if you want to be updated on webinars dates and content and book a ticket.
To watch on Youtube: https://youtu.be/Dg-lAjuCYuQ
A detailed description about the basic steps involved in the - PCR - Polymerase Chain Reaction, its applications,its limitations and steps to overcome it.
Loop Mediated Isothermal Amplification (LAMP)MD ROBEL AHMED
Loop Mediated Isothermal Amplification (LAMP) is a kinds of PCR reaction. This technology is most reliable and convenient than conventional PCR procedure. We can call it updated version of PCR. Rapid, Easy detectable and cheap to accomplish the process.
LAMP is a DNA amplification technology which enables rapid and sensitive detection and when run on the Genie III platform enables detection of pests and diseases outside of the laboratory at any point in the agri-food chain where decisions are being made.
The target audience are researchers, agri-business and forestry experts, farmers and foresters and any other interested in being introduced to this portable molecular diagnostic tools on plant diseases.
Do not hesitate to contact EMPHASIS project through Facebook, Twitter, email (emphasisproject@gmail.com), Youtube or through our website (http://www.emphasisproject.eu/) if you want to be updated on webinars dates and content and book a ticket.
To watch on Youtube: https://youtu.be/Dg-lAjuCYuQ
A detailed description about the basic steps involved in the - PCR - Polymerase Chain Reaction, its applications,its limitations and steps to overcome it.
MOLECULAR TOOLS IN DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES tawheedshafi
The future of the molecular diagnostics of infectious diseases will undoubtedly be focused on a marked increase in the amount of information detected with remarkably simplified, rapid platforms that will need complex software analysis to resolve the data for use in clinical decision-making.
The slides tells about the basic techniques performed in biotechnology lab. a initiator should be known with these techniques so that it become easier for the one who wants to see himself in a biotechnology field.
DNA polymerases (DNA manupliation Enzymes).pdfNetHelix
the Secrets of DNA Manipulation: A Comprehensive Exploration of DNA Polymerase and Enzymes
In this PDF presentation entitled "Enzymes that Manipulate DNA, Specially DNA Polymerase," we delve deep into the mechanisms and functions of these remarkable enzymes that play a pivotal role in the realm of molecular biology.
🧬 Key Highlights:
Introduction to DNA Polymerase:
Uncover the fundamental aspects of DNA polymerase, a key player in DNA replication and repair. Explore its structure, functions, and the indispensable role it plays in maintaining the genetic integrity of living organisms.
Types of DNA Polymerases:
Delve into the diverse landscape of DNA polymerases, ranging from prokaryotic to eukaryotic systems. Understand how different types of DNA polymerases contribute to the precision and efficiency of DNA synthesis.
Examples of polymerases:
•DNA polymerase 1
•klenow fragment
•sequenase
•Taq polymerase
•Reverse Transcriptase
DNA Replication
Take a closer look at the intricate dance of enzymes during DNA replication. Follow the step-by-step process, and gain insights into how DNA polymerase ensures the accurate transmission of genetic information from one generation to the next.
Technological Applications:
Unleash the potential of DNA polymerase in various biotechnological applications. From PCR (Polymerase Chain Reaction) to DNA sequencing, discover how these enzymes have revolutionized molecular biology and genetic research.
Emerging Trends and Future Prospects:
Stay ahead of the curve by exploring the latest advancements and emerging trends in DNA manipulation. Witness the ongoing research that promises to unlock new possibilities in the field.
🎓 Who Should Explore This Presentation?
Students and researchers in molecular biology and genetics
Biotechnologists and professionals in the field of genetic engineering
Enthusiasts curious about the molecular machinery behind DNA manipulation
The advent of the polymerase chain reaction (PCR) radically transformed biological science from the time it was first discovered (Mullis, 1990). For the first time, it allowed for specific detection and production of large amounts of DNA. PCR-based strategies have propelled huge scientific endeavors such as the Human Genome Project. The technique is currently widely used by clinicians and researchers to diagnose diseases, clone and sequence genes, and carry out sophisticated quantitative and genomic studies in a rapid and very sensitive manner. One of the most important medical applications of the classical PCR method is the detection of pathogens. In addition, the PCR assay is used in forensic medicine to identify criminals. Because of its widespread use, it is important to understand the basic principles of PCR and how its use can be modified to provide for sophisticated analysis of genes and the genome
Reverse Transcriptase PCR (RT-PCR) is a variation of the polymerase chain reaction that amplifies target RNA. Addition of reverse transcriptase (RT) enzyme prior to PCR makes it possible to amplify and detect RNA targets.
Reverse transcriptase enzyme transcribes the template RNA and forms complementary DNA (cDNA). Single-stranded cDNA is converted into double-stranded DNA using DNA polymerase. These DNA molecules can now be used as templates for a PCR reaction
2. PCR vs. LAMP
Method of Method of
amplifying amplifying DNA
DNA, using a using a uniform
change in temperature and
temperature to specialized DNA
separate and polymerase
anneal the primers It requires six
It requires one different primers
forward and one More specific
reverse primer
3. PCR vs. LAMP
Denaturation Constant
5’ 3’
5’ 3’ Temperature:
3’ 5’
3’ 5’
Annealing Looping of DNA for
5’ 3’
replication via
3’ 5’
multiple primers
Elongation
5’ 3’
3’ 5’
(see next few slides)
4. How does LAMP work?
First Primer binds
and DNA
polymerase
generates new
strand
Next Primer binds and displaces
the new DNA. DNA polymerase
generates new strand in the place
of the previously created one,
which dissociates
Note: the teal denotes the same
DNA sequence as the pink, just
another copy of it
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html
5. How does LAMP work?
Now a similar thing
happens with the backward
primers.
Note: the newly created
strand is now the template
strand
The strands then separate and the
primers that were coded on the
ends anneal to themselves,
creating the start of the
LOOP STRUCTURE.
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html
6. How does it work?
The process then repeats, generating longer
and longer chains of the target gene linked
together by the loop primers
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html
7. How does it work?
Amplified
Forward Loops Amplified
Back Loops
The process continues to repeat itself
generating longer chains of the target
gene, linked together by the loop
primer Multiple copies of
The Target Gene
Figure from EikenLAMP webpage: http://loopamp.eiken.co.jp/e/lamp/anim.html
8. Research Goal
To develop a method to detect parasites
that can be easily changed for any given
target parasite.
Initial target: Cryptosporidium
10. Primers for Target Pathogen
The 6 primers were named for the organism they they were
detecting and their position in the LAMP. They were ordered from
Invitrogen™.
primers sequences were described in Momoda et al. (2009)
CryFIP: forward initiating primer
tacttaactcattccaattagaaaacccagggaggtagtgacaag
CryBIP: back initiating primer
ataaacccctttacaagtatcaatttatacgctattggagctgg
CryF3: Forward separating primer
gcgcaaattacccaatcc
CryB3: Back separating primer
actacgagctttttaactgc
CryLF: Loop forward
ccaaaaagtcctgtattg
CryLB: Loop back
gagggoaagtctggtg
Momoda et al. Sensitive and Rapid Detection of Crypto and Giardia by LAMP.
Journal of Japanese Society on Water Environment. 32.6.(321-324)
11. Two Modifications to
ThermoPol II (TP) Published Reagents Isothermal
Amplification (IA)
Isothermal Amplification Buffer:
ThermoPol II Reaction Buffer:
Reagents were altered due to availability 20 mMTris-HCl
20 mMTris-HCl
10 mM (NH4)2SO4
10 mM (NH4)2SO4 in USA. Red denotes deviations from the 50 mMKCl
10 mMKCl
0.1% Triton X-100 Momoda et al. paper. 2 mM MgSO4
0.1% Tween-20
Momoda et al. Sensitive and Rapid Detection of Crypto and Giardia by LAMP.
Journal of Japanese Society on Water Environment. 32.6.(321-324)
12. Results
The one positive from TP is likely an unknown strain
of Cryptosporidium. The other two samples were
both C. parvum. 100 BP
Ladder
Further research TP-1
needed to determine if TP-2
TP-3
TP is useful in
detecting specific TP-4 (-)
strains of IA-1
Cryptosporidium, as IA-2
opposed to IA which IA-3
IA-4 (-)
appears to detect a 100 BP
broader spectrum. Ladder
50 BP
Ladder
13. Results: 1st Restriction Digest
Restriction Enzyme Where it Cuts Did it Cut?
Xba I Outside target region on the gene No
Rsa I Outside target region on the gene No
Alu I Within target region Yes
Bst NI Within target region Yes
A restriction digest was performed to
determine if the entire 18S RNA Gene or only
part of it was amplified.
14. Results: Restriction Digest
created by
50 BP
AluI indicates that Ladder
the entire gene 100 BP
was not amplified Ladder
500 BP
indicate an Ladder
incomplete
digest Uncut
BstNI resembles Xba I
both the
and a
Rsa I
.
Alu I
Xba I and Rsa I
both match the Bst NI
uncut banding
pattern
Future Work: Digest for longer or with a greater enzyme : DNA ratio
15. Future Work
EtBr is often used for visualization
EtBr is carcinogenic
its disposal in the field is difficult
In order to streamline LAMP for field
research, I sought out alternative
visualization methods. These methods are
the next step in establishing LAMP as a field
safe method of detection of parasites.
16. Field-Safe Visualization
SYBR® Safe via blue light (470 nm)
Safe Imager™ Poly Stylus
The Poly Stylus will be used as a small,
cost-conscious, portable alternative to the
Safe Imager™
Left Image from invitrogent.com: Right Image from newegg.com:
Safe Imager™ 2.0 Blue Light Transilluminator Item#: 9SIA06L0564887
17. Field-Safe Visualization
Field Spectrophotometer: another
detection method to test.
A field safe spectrophotometer
has the potential to detect the
turbidity of the sample in the
field, and thus is a more
expensive, but feasible
solution to field detection
Image from SelectScience.net:
DR 2800 Portable Spectrophotometer
from Hatch Company
18. Conclusions
Isothermal Amplification buffer is better for
the detection of a wide range of strains of
Cryptosoporidium than ThermoPol III buffer
Where to go from here?
Detection threshold spectrophotometer and
SYBR® Safe visualization
Concentration gradient for detection
Find minimum detection level
Attempt with fecal extraction/water recovery