The Social Inequalities And The Biosocial Ecology

The Social Inequalities And The Biosocial Ecology
Viral hemorrhagic fevers (VHFs) are found around the world that is one group of illness caused by virus of five distinct families: Arenaviridae,
Bunyaviridae, Filoviridae, Flaviviridae, and Paramyxoviridae (Center for Disease Control and Prevention, 2013). These include the Ebola and
Marburg, Lassa fever, and yellow fever virus (U.S National Library of Medicine, 2016). Garrett point out that less than a decade ago, one of the
biggest problem in the world was the lack of resources available to combat the multiple scourges ravaging the world's poor and sick. (Garrett, p.
171). Today, thanks to private donations, more money is being assigned toward pressing health challenges. But because the efforts of this money is
paying for a largely uncoordinated and directed mostly at specific high profile diseases resulting a problem because the world is poised to spend
enormous resources to conquer the diseases of the poor (Garrett, p. 171). This paper will discuss the epidemiology of VHFs., the social inequalities
and the biosocial ecology. The five families of viruses that causeviral hemorrhagic fever are most found over the world. The Arenaviridae are a family
of virus whose members are generally associated with rodent– transmitted disease in humans causing severe illnesses (Center for Disease Control and
Prevention, 2013). Flaviviridae are a family of positive, single stranded, enveloped RNA virus. They are found in arthropods, primarily ticks and
mosquitoes, and can infect
... Get more on HelpWriting.net ...

Ebola Hemorrhagic Fever
Ebola, once transmitted to a human is referred as Ebola hemorrhagic fever, is an uncommon viral infection that deliberately targets every part of the
human body with the exception of the skeletal system. When this lethal disease enters the host, it will first cause pain throughout the body and
dramatically increase the body's temperature. Next, internal and external bleeding tends to occur, specifically form the face. After that, it will simply
destroy the bodily tissue that holds the host's organs together. Aside from this, what the virus actually does and how it is transmitted, little to nothing is
known due to the complex structure of the infectious disease, as there are five identified Ebola virus species. Four of the five affect humans ... Show
more content on Helpwriting.net ...
However, that is more than likely the reason they are having these outbreaks. The use proper technology plays a key role in containing and ending
of the any disease and since these areas lack severely in these field it males for the perfect breeding ground for terribly disease, such as Ebola. This
will ultimately stunt the technological grow of countries that have been heavily hit with the epidemic. Also, the lack of general medical knowledge,
such as common hygiene, in these states only severed as a catalyst for the virus to spread. Another factor for those lives in these palaces is that
unless one live in close proximity to his or her family the chances that they will be able to see one another are very slim. These restrains have lead to
geographical issues as well. For instance, the land in each of the differences areas must be used year–round for corps as farmers are restricted to their
own district to grow crop. This as resulted in some farmer having been forced to over use their land and not allow for proper crop rotations as well
trying hard to grow certain heathery crops in more harsh

Ebola Research Paper
I think that Ebola is one of the worst diseases of all time. Ebola is responsible for hundreds of thousands of deaths. That is why I think Ebola is one
of the absolute worst diseases of all time. Ebola was first identified in 1976. It first appeared in central Africa. Ebola then died off then it somehow
returned in 1989 in the town of Yambuku. Since then there has been separate occurrences of Ebola min many other places. Humans and guinea pigs
and humans were first vaccine. The guinea pigs were injected with Ebola, and then were vaccinated to see if the vaccine worked. Not surprising the
guinea pigs were first thing tested on. The people that were first vaccinated were as followed, Nancy Sullivan, Anthony Sanchez, Pierre E. Rollin,
Zhi–Yong... Show more content on Helpwriting.net ...
Ebola is almost both bacterial and viral, but it is mostly a viral disease. In the early two thousands a group of security let a young nurse infected with
Ebola on a plane to America which led to America with Ebola on our hands. The nurse and the people that she infected were put in complete
isolation in a Texas motel. The motel had plastic wrapped around it so that the disease could not get out and harm people. The infected people
were isolated in the area for twenty one days before they were let go, turns out that only 2 were infected. There are many ways that Ebola can
spread, including blood, saliva, and all other bodily fluids. There were not as many drugs or treatments for the Ebola virus when it first arrived. The
very few ways to try to control it are, an IV, making sure that blood pressure stays normal, and treat all other infections with antibiotics, aspirin,
Tylenol, and prescriptions. Also a few fun facts about Ebola that I think people should know. Ebola is formally known as Ebola hemorrhagic fever.
Ebola is not airborne, or water borne, it is transmitted. Ebola is treated by keeping bodily fluids maintained and under

Essay about Ebola Hemorrhagic Fever
Ebola Hemorrhagic Fever
Ebola hemorrhagic fever (Ebola HF) is a severe, often–fatal disease in humans and nonhuman primates (monkeys and chimpanzees) that has appeared
sporadically since its initial recognition in 1976.
The disease is caused by infection with Ebola virus, named after a river in the Democratic Republic of the Congo (formerly Zaire) in Africa, where it
was first recognized. The virus is one of two members of a family of RNA viruses called the Filoviridae. Three of the four subtypes of Ebola virus
identified so far have caused disease in humans: Ebola–Zaire, Ebola–Sudan, and
Ebola–Ivory Coast. The fourth, Ebola–Reston, has caused disease in nonhuman primates, but not in humans.
Where is Ebola virus ... Show more content on Helpwriting.net ...
Ebola HF typically appears in sporadic outbreaks, usually spread within a health–care setting (a situation known as amplification). It is likely that
sporadic, isolated cases occur as well, but go unrecognized.
How is Ebola virus spread?
Infection with Ebola virus in humans is incidental –– humans do not "carry" the virus. Because the natural reservoir of the virus is unknown, the
manner in which the virus first appears in a human at the start of an outbreak has not been determined. However, researchers have hypothesized that the
first patient becomes infected through contact with an infected animal. After the first case–patient in an outbreak setting (often called the index case) is
infected, the virus can be transmitted in several ways. People can be exposed to Ebola virus from direct contact with the blood and/or secretions of an
infected person. This is why the virus has often been spread through the families and friends of infected persons: in the course of feeding, holding, or
otherwise caring for them, family members and friends would come into close contact with such secretions. People can also be exposed to Ebola virus
through contact with objects, such as needles, that have been contaminated with

Emerging Infectious Diseases Essay
Emerging Infectious Diseases
Emerging infectious diseases (EIDs) are the third leading cause of death in the United States and the first leading cause of death worldwide (3). Thus,
should EID's be considered an oncoming threat to human existence or is it God's response to our unbiblical stewardship of the Earth or is it nature's
practical solution to overpopulation.
Past EIDs
Since the beginning of time, human existence has been overwhelmed by threatening diseases. To begin with,leprosy and other highly contagious skin
diseases affected humanity as early as in the days of the Old Testament. Due to its rapidly infectious manner and its degrading and dehumanizing
results, skin–diseased victims were often ostracized ... Show more content on Helpwriting.net ...
In 1994, Gloucestershire, England was assailed by the infamous and unstoppable "flesh–eating bacteria" or Necrotizing Fasciitis, which virtually
devoured its victims to death (2). In March of 1996, 2.6 million cows were slaughtered in the United Kingdom in an effort to rid themselves of the
invasion of the Mad Cow disease. Another term for Mad Cow disease is Bovine Spongiform Encephalopathy (BSE), which is a disease observed
solely in cattle. Mad Cow disease or BSE is transmitted to humans via the consumption of infected beef resulting in a fatal human brain disorder known
as Creutzfeldt–Jacob (CJD). As a result of this "British beef scare" 32 people died of CJD, of whose deaths were linked to Mad Cow disease (10.e).
Similarly, 1 million chickens were gassed to death in Hong Kong in 1997 in order to prevent the already undertaking spread of Influenza A (H5N1) or
"Bird Flu". The worst Influenza A epidemic occurred in the United States killing 20 million people in 1918 (10.b). In New York last month, five
people died of a rare encephalitis disease caused by a West Nile–like virus, which is believed to have been transmitted from birds, who researchers
found to have died from the West Nile virus (8). Finally, and probably the most menacing disease ever in human history would have to be HIV and
AIDS, which is still infecting the human population worldwide in gross amounts.

The Ebola Virus
The Ebola Virus
A virus is an ultramicroscopic infectious organism that, having no independent metabolic activity, can replicate only within a cell of another host
organism. A virus consists of a core of nucleic acid, either RNA or DNA, surrounded by a coating of antigenic protein and sometimes a lipid layer
surrounds it as well. The virus provides the genetic code for replication, and the host cell provides the necessary energy and raw materials. There are
more than 200 viruses that are know to cause disease in humans. The Ebola virus, which dates back to 1976, has four strains each from a different
geographic area, but all give their victims the same painful, often lethal symptoms. The Ebola virus is a member of a family of ... Show more content on
Helpwriting.net ...
Close contact and dirty needles spread the Ebola virus. The center of the epidemic in Zaire involved a missionary hospital where they reused needles
and syringes without sterilization. Most of the staff of the hospital got sick and died. This outbreak infected 318 with a death rate of 93% (Le
Guenno et al. 1271). Another fatal case was reported one year later in Zaire but nothing major ever became of it. The most recent case recorded was
the infamous breakout in Kikwit, Zaire. This breakout had the world in an uproar about the possibility of this virus spreading out globally. This
outbreak appeared to have started with a patient who had surgery in Kikwit on April 10,
1995. Members of the surgical team then developed symptoms similar to those of a viral hemorrhagic fever disease (Ebola Info. from the CDC 2).
From there, the disease spread to more than 300 others. The most frequent symptoms at the onset were fever (94%), diarrhea (80%), and server
weakness (74%); other symptoms included dysphagia (41%) and hiccups (15%). Clinical signs of bleeding occurred in 38% of cases (JAMA 274:
373). The World Heath Organization declared on
August 24, 1995 that the outbreak of Ebola Zaire in Kikwit was officially over after killing 244 of its 315 known victims ("Ebola Outbreak Officially
Over" 1).
This outbreak had a rate of death over 75%. Ebola Sudan also occurred in 1976 about the same time as Ebola Zaire.
The number of cases was 284 with a death rate of 53% (Le

Informative Speech Outline On Ebola
Ashton Nicholas
SPC 205
Informative Speech Outline
Ebola Virus
General Purpose: To inform.
Specific Purpose: To explain to my audience research and facts about what Ebola is, what the symptoms and treatments are, how Ebola is spread, and
where Ebola is in the world today.
Central Idea: Research is helping us to discover and learn all the facts about Ebola.
Introduction
I.Attention–Getter: Over 2,000 people have died since the first discovery of Ebola.
II.Other: According to Wen Zhiyuan, the Ebola Virus causes a fatality rate of up to 90%. (Verbal Citation)
III.Central Idea: Research today is helping us to discover and learn more about the Ebola Virus.
IV.Credibility: In preparation for this speech, I have read four articles to... Show more content on Helpwriting.net ...
As of right now, patients are being given fluids, antibiotics, and blood transfusions to help increase their immune system.
E.The World Health Organization, or WHO, said that although half of the people infected have died, those that have survived carry blood that is in
demand. (Verbal Citation)
1.The blood contains antibodies that have already fought off the virus.
(Internal Transition: Since we know that the virus is not highly contagious, let's see how the virus can be contracted.
III.Because Ebola is not highly contagious, we should know how the virus is spread.
A.It is believed that fruit bats may be the natural host of the virus in Africa.
B.The virus was passed from the bat to other animals.
C.Humans contract the virus through contact with bodily fluids of infected animals or infected humans.
(Internal Transition: Now that we know what Ebola is, let's finally look at where the virus is in the world.
IV.The Ebola Virus, today, is worldwide.
A.In the article by Susannah Cullinane it is said that there have been more than 3,000 cases of the virus and more than 2,000 deaths since 1976.
(Verbal Citation)

B.The region of GueВґckeВґdou in Guinea is where the virus started in its recent

The Ebola virus is the causative agent of Ebola Hemorrhagic Fever (Ebola HF).
Ebola is severe and often fatal among both humans and animals with mortality rates reaching as high as 90% in some outbreaks. Ebola was named for
the river in the
Democratic Republic of Congo (Zaire) in Africa where it was first recognized in 1976. Four strains of Ebola have since been identified: Ebola–Zaire,
Ebola–Sudan, Ebola–Ivory Coast, and Ebola–Reston. All but Ebola–Reston are known to cause disease in humans. ( https://web.stanford.edu/group
/virus/filo/2005/profiles.html) When an infection occurs in humans, the virus can be spread to others through direct contact through broken skin or
mucous. Also in the blood or body fluids of a person who is sick
with ... Show more content on Helpwriting.net ...
Samples from the patient can then be collected and tested to confirm infection. Ebola virus is detected in blood only after onset of symptoms, most
notably fever, which accompany the rise in circulating virus within the patient's body. It may take up to three days after symptoms start for the virus to
reach detectable levels. (https://www.cdc.gov/vhf/ebola/diagnosis/)
There is no vaccine available to prevent Ebola infection. The point of all prevention techniques is to avoid contact with the blood or body fluids of
infected persons. This includes avoiding travel to areas where Ebola outbreaks are occurring, and taking precautions when providing health care for
potentially infectious persons. Precautions may include wearing protective clothing (such as masks, gloves, gowns, and goggles), using
infection–control measures (such as complete equipment sterilization and routine use of disinfectant), and isolating patients with Ebola from contact
with unprotected persons.
(http://www.sfcdcp.org/ebola.html)
Currently, no specific therapy is available that has demonstrated consistency in the treatment

Ebola Virus Disease ( Ebv )
Ebola virus disease (EBV), or just Ebola, is an acute, often fatal illness, with a case fatality rate of up to 90%. It is one of a number of haemorrhagic
fever diseases. Ebola is a single–stranded RNA virus with an unusual, variable–length, branched morphology. The helical capsid is enclosed inside a
membrane.. It is one of the world's most virulent diseases. The Ebola virus is a member of the Filoviridae family. There are 5 known subtypes of Ebola.
The infection is transmitted by direct contact with the blood, body fluids and tissues of infected animals or people. The current hypothesis is that fruit
bats are the original host of the virus. Ebola was introduced into the human population through close contact with the blood, secretions, ... Show more
content on Helpwriting.net ...
The virus also inhibits interferon which is a molecule that cells make use of to further retard viral reproduction.
The exact process what happens next is not fully known but the virus attacks the connective tissue and reproduces at an extremely fast rate in the
collagen, digesting the tissue as it goes. The virus can ultimately cause viral hemorrhagic fever. When the macrophages in our body register the virus
and consume it, they end up becoming infected and are manipulated to release proteins that trigger coagulation – create small clots in the blood. This
leads to the blood slowly thickening and therefore a decreased blood flow. As the clots begin to get stuck in the blood vessels, the patient begins to
exhibit red spots on the skin–the rash. As the disease progresses, these clots and their spots increase in size. Another more serious effect of the Ebola
virus's clotting factor is the decreased blood supply to the vital areas of the body such as the liver, brain, kidneys, lungs, intestines, testicles and
extremities ultimately causing a multi–organ failure or septic shock.
The macrophages also produce other inflammatory signalling proteins and nitric oxide, which damage the lining of blood vessels, causing them to leak
and sometimes burst. The content leaks out, and the damage and presence of the virus particles activates

Ebola Virus Research Paper
NAME: DANIEL DANAE
STUDENT NUMBER: 101420/1419102
MAJOR: LIFE SCIENCES (BIOMEDICAL SCIENCE) COURSE: MICROBIOLOGY
TOPIC: MECHANISM OF TRANSMISSION OF INFECTIOUS DISEASES (EBOLA VIRUS DISEASE)
INTRODUCTION:
A disease is a change of functioning in the body that makes it not to function properly. It is a disorder in the normal function of the body. There are
different types of diseases such as Ebola virus disease, cholera as well as other types.
Infection is the incursion of a microorganism to a cell or a body to cause harm or disable the body from functioning properly. Infectious diseases are
disorders from microorganisms such as bacteria and pathogens that can be harmful to the human health that can be passed from one person to another
through ... Show more content on Helpwriting.net ...
FAVIPIRAVIR: Currently, neither a vaccine nor an effective antiviral treatment is available for use in humans. The efficacy of pyrazine carboxamides
derivative T–705(favipiravir) against Zaire Ebola virus (EBOV) in vitro and in vivo (Oestereich et al., 2014). Its other name is Avigan which is an
experimental antiviral drug for the treatment of many RNA viruses such as yellow fever virus and west Nile virus.
3. BRINCIDOFOVIR: Brincidofovir is an oral antiviral drug being developed as a potential prevention or treatment for life–threatening viral diseases.
It works by keeping viruses from creating additional copies of themselves. Patients in the United States have been treated with Brincidofovir for Ebola
virus disease at the request of treating physicians (Bolt and Garza, 2014). Emergency investigational new drugs applications have been approved by the
United States food and drug administration for the use of brincidofovir in patients with confirmed Ebola Disease.
Others include Triazavirin which is used for the treatment of Lassa fever and influenza, TKM–EBOLA, BCX4430 and the ReEBOV test that is
conducted on suspected patients to know the viability of the virus in the blood stream. However, other experimental vaccines are still undergoing
medical procedures and testing.
PREVENTIVE MEASURES OF EBOLA VIRUS

Comparison Of The Ebola Virus
Essay 1;2014 Comparison of the Ebola outbreak and the CDC study module for "Gastroenteritis at a University in Texas"
1) Ebola Virus– Belongs to the family Filoviridae. It has a single–stranded –sRNA genome, so it uses a RNA polymerase to create the +sRNA
template, which acts as mRNA inside the host cell. The envelope is made up of peptidoglycan; the structure is made up of 7 structural proteins and 1
non–structural protein. This means it is an enveloped and susceptible to the outside environment. The Ebola virus replicates in Monocytes,
Macrophages and Dendritic Cells. When the Ebola virus is ready to leave the host cell it buds out and takes part of the cell membrane with it. Ebola
has an incubation period of 8–10 days. (CDC) Norovirus– ... Show more content on Helpwriting.net ...
These symptoms are also similar to the symptoms caused by the common cold or the flu. Most people are not going to be running to the
emergency room if they have a slight fever, headache, or nausea. This can make it difficult to contain these viruses once an initial infection
happens in the host. An infected person may travel to another area unaware that they are carrying one of these diseases. Both of these viruses do
not have a vaccine or real treatment. The best ways to "treat" these are to let them pass and allow the immune system to fight the virus off.
Norovirus is not as serious as the Ebola and most of the persons infected can fight it off in a few days. Getting rest and keeping the body healthy.
The Ebola is more serious, the fatality rate according to WHO is 50%. The best way to handle this is to isolate the person and give them IVs and
hope their immune system is strong enough to fight off the virus. If they can fight off the virus they will recover, but if not then the virus kills the
host. Since Ebola has no cure this plays to the advantage of controlling the virus. When someone has contracted the virus action is taken very quickly
to isolate and quarantine. The source of the virus is put as top priority to stop the spread. Because it is so serious controlling it when it arises is the
number one objective. The Norovirus is foodborne virus. So tracking the source and removing it in

Ebola is a rare but deadly virus that causes bleeding inside and outside the body. In 1976, Ebola was first spotted in Sudan and Zaire. The first
outbreak of Ebola infected over 284 people. A few months later, the second Ebola virus was found in patients from Yambuku, Zaire, Ebola
–Zaire
(EBOZ), which infected 318 people. Despite the tremendous effort of experienced and dedicated researchers, Ebola's natural reservoir was never
identified. The third strain of Ebola, Ebola Reston (EBOR), was first identified in 1989 when infected monkeys were imported into Reston, Virginia,
from Mindanao in the Philippines. Fortunately, the few people who were infected with EBOR (seroconverted) never developed Ebola hemorrhagic
fever (EHF). The last known strain ... Show more content on Helpwriting.net ...
At first it may be hard to differiantie beteen Ebola and many other diseases. Early symptoms of Ebola are similar to influenza, malaria, typhoid fever,
fulminant hepatitis, sepsis, nontyphoidal salmonellosis, and various forms of encephalitis, dengue fever, yellow fever, Lassa fever, Marburg, and
other hemorrhagic diseases. Since it is quite difficult to diagnosis Ebola the only way to correctly diagnosis is to have laboratory confirmation of
Ebola virus. Usually symptoms of Ebola is sudden, with patients showing symptoms within 5 to 12 days Early symptoms can include acute fever,
chills, myalgia, head– ache, arthralgia, and anorexia. Nausea, vomiting, abdominal pain, hypotension, tachypnea, relative bradycardia, conjunctivitis,
conjunctival injection, pharyngitis, and diarrhea, which may be bloody, are other evolving signs. Cutaneous flushing or rashes are also common
(World Health Organization 1997). Many women infected with Ebola decide to get abortions because the virus can be passed down to the child.
During the later stage of Ebola the illness may become a hemorrhagic issue that consists of epistaxis, hematuria, hematemesis, petechiae, melena, and
mucous membrane and conjunctival hemorrhage (World Health Organization 1997). Hemorrhaging usually occurs from the gastrointestinal tract,
lungs, and gingiva. Patients who have a strong immune system, their body response to the virus will begin in 7 to 10 days and start a period of slow
recovery involving complications such as weakness, fatigue, hepatitis, uveitis, and other clinical sequelae (Borio and others 2002). Patients who do not
improve by the 1st week usually experience multiorgan failure and die from hypovolemic shock, with or without blood loss (World Health Organization

The Ebola Virus In Today's Society
IEbola is one of the most common viruses that is highly contagious and it is still a major threat in today's society. Ebola was one of the extremely
deadly viruses that was first found in Africa. It took hundreds of lives when the victims was left disoriented, exhausted, and collapsed in a fever. The
Ebola virus is well known that causes hemorrhagic fever in humans, which is distinguished by massive bleeding in internal and external and
destruction of internal tissues and organs. People were lying on their deathbed, craving and sobbing for a miracle to happen, but eventually their
bodies were slowly lead into the grave in peace. In this essay, it will contain information on the following questions: What is Ebola and what causes it?
What are... Show more content on Helpwriting.net ...
The virus is covered by a diameter enveloped in a cell ,which is about 80nm and the size can expand to about 100nm x 300–1500nm. The virus has a
variety of structures such as a branch–shaped, U–shaped, ring–shaped or 6–shaped.The membrane contains a long spike that is formed with a helical
ribosome and has four structural proteins in the virion. Ebola from different countries has diverse biological characteristics. The nucleocapsid protein
in virus particles derives from the center of the spiral winding structure in genomic RNA. The viral protein score–shell protein contains the virus
glycoprotein depth from the surface of virus particles, its 10nm long. The other 10nm set out to highlight the membrane surface, and the layer of the
host cell membrane is from the region between the mantle and the nucleocapsid protein,which is called

Essay about Bioterrorism
Bioterrorism – Viral Hemorrhagic Fever
Abstract
Viral hemorrhagic fever is one of the most feared diseases of today's time. Although most people have heard of anthrax, smallpox and the plague, viral
hemorrhagic fever has become a potent weapon used for bioterrorism, silently killing its victims and instilling fear in the rest of the population. Viral
hemorrhagic fever can be divided into 4 families. Although each family of viral hemorrhagic fever may have some of its own unique characteristics,
the four families are generally fairly similar regarding the high fevers and hemorrhages they cause. Because of past outbreaks of viral hemorrhagic
fever, scientists have reason to believe that terrorists have easier access to the deadly viruses ... Show more content on Helpwriting.net ...
The reason why the Ebola and Marburg viruses are grouped together is because they have similar symptoms. The incubation period is about 1 week,
which means it takes about 1 2 week for symptoms to occur (Wener n.p.). The symptoms can range from something as mild as headaches and sore
throats to disseminated intravascular coagulation (DIC), which means clotting of the blood. Other symptoms include fevers, arthritis, prostration,
bleeding diathesis, thrombocytopenia and platelet dysfunction. Some nonspecific clinical effects include nausea, pain in the stomach, diarrhea,
encephalitis and rashes (Schlossberg 53). Furthermore, viral hemorrhagic fever can potentially lead to neurologic, hepatic, pulmonary, and renal
disorders (Wener n.p.).
What makes Ebola such a serious disease is that fact that 90% of the people who are diagnosed with this disease die, and the few surviving patients
suffer from hair loss and sensory problems (Wener n.p.). On the other hand, Marburg hemorrhagic fever has a 23–70% mortality rate. The history
behind the Marburg hemorrhagic fever helps explain why VHF is so dangerous to the public and can easily be spread all across the globe. Marburg
hemorrhagic fever was first discovered in 1967 in Marburg, Germany when lab workers were contracted with the disease after handling imported
monkeys from Africa (Center for Disease Control n.p.). Because Ebola and Marburg hemorrhagic fever are both zoonotic, they can be transmitted from

Ebola Virus Disease And Its Effects
Ebola Virus Disease is often referred to as a virus that causes severe bleeding, organ failure, and can lead to death. It was formally known as Ebola
hemorrhagic fever. Ebola can cause disease in humans and also in non–human species, such as monkeys, gorillas, and chimpanzees. Altogether,
information about Ebola Virus Disease will include: the background, transmission, symptoms and diagnosis, and treatment and prevention.
Ebola Virus Disease was given it 's name from the Ebola River in the Democratic Republic of the Congo. The disease first appeared in 1976 in two
outbreaks occurring simultaneously. One occurred in South Sudan and the other in the Democratic Republic of the Congo. In the Democratic
Republic of Congo it took place in a village near the Ebola River, hence its name. The most current outbreak in occurring in West Africa. Reports say
that it is the most complex and largest outbreak since it first appeared. This current outbreak of the Ebola Virus Disease has had more deaths than all
other appearances of the disease combined. The most effected countries include Guinea, Liberia and Sierra Leone. These countries have weakened
health systems and very limited resources. With limited resources it makes it extremely difficult to stop the spread of such diseases. Therefore, Ebola
appears in mainly in underdeveloped counties with limited resources and weak health systems.
The transmission of the Ebola Virus Disease occurs in many different ways. Transmission of

The Ebola Virus: History, Occurrences, and Effects Essay
"The only sound is a choking in his throat as he continues to vomit while unconscious. Then comes a sound like a bed sheet being torn in half, which
is the sound of his bowels opening at the sphincter and venting blood. The blood is mixed with his intestinal lining. He has sloughed off his gut. The
lining of his intestines have come off and are being expelled along with huge amounts of blood" (Preston 17).
Ebola, a virus which acquires its name from the Ebola River (located in Zaire, Africa), first emerged in September 1976, when it erupted
simultaneously in 55 villages near the headwaters of the river. It seemed to come out of nowhere, and resulted in the deaths of nine out of every ten
victims. Although it originated over 20 years ... Show more content on Helpwriting.net ...
Because Ebola was unknown and never seen before, doctors and citizens in Ebola–infected cities did not know what kind of precautions to take when
handling an Ebola–exposed person. As a direct effect to this, the virus spread tremendously fast through the city of Zaire, and eventually spread to
many other countries due to the lack of knowledge of the infectious disease. Hospital workers dealing with Ebola–exposed patients took few
precautions when handling blood and test tubes. Family members held funerals to those who died from the virus, which spread the disease among the
family members. In fact, an article was published in the Houston Chronicle on October 19, 2000, stating that the 9 month child of Esther Awete, who
died from infection of the Ebola virus, came down with the infection himself, just days after attending her funeral. Her other son, however, did not
attend her funeral and ironically did not come down with Ebola. It is believed that if the virus can find a host quickly, then it can still survive after it's
previous host dies.
Ebola is classified as a type of viral hemorrhagic fever, filivirus. The natural host for Ebola is still yet to be defined, but in most cases of a viral
hemorrhagic fever, arthropods and rodents, such as ticks and mosquitoes, are the common hosts.
Symptoms– there are 2 main

Ebola Virus Disease : History, Transmission & Pathogenesis
Ebola Virus Disease: History, Transmission & Pathogenesis
The Ebola virus disease (EVD) was initially discovered in 1976; which originated from the Ebola River Valley in the Democratic Republic of Congo
(DRC). EVD is a severe, often fatal disease affecting humans, and nonhuman primates. Outbreaks occur in Africa affecting mostly the central and
western portions of the continent. Formerly known as Ebola hemorrhagic fever, but the recent outbreak illustrates viruses' ability to manifest itself
without hemorrhaging. While EVD can be a deadly disease, its spread can be stymied rather quickly with properly trained, and well equipped
personnel, effective disposal of dead bodies, and changes in burial practice.
History
During the 70's, the DRC and Sudan were affected by Ebola viruses causing 637 human cases and 454 deaths. The first two major epidemics occurred
in Africa in 1976. There were no EVD outbreaks reported within a 15–year period. (Galan–Huerta, 2014)
When a new epidemic was detected in the DRC in the spring of 1995, it was widely perceived as a threat to the West. The amount of public attention
was intense. A massive intervention, led by UN and US agencies, followed and put an end to the epidemic within less than two months. (Benini, 1996)
In April 1995, members of a rapid response team, handling a patient mis–diagnosed for typhoid, were infected. Rapid infection of unprotected health
workers and of other hospital patients ensued, eventually prompting most patients

EBOLA
WHAT IS EBOLA
Ebolavirus is a member of the Filoviridae virus family and there are five strains known. Zaire ebolavirus (EBOV) is the virus currently being battled in
west africa and across the world. Ebola is a deadly and rare disease that is caused by infection with one of the five Ebola Virus strains. Ebola is
considered a viral disease that can be highly contractible when in contact with bodily fluids of the infected. EBOV is the most deadly of the five strains
with a mortality rate between fifty and ninety percent. Ebolavirus is a zoonosis, which is an innocuous agent that lives in animals, only infecting
humans on rare occasions. The disease originated in Africa, but has effected many areas around the world.
Origin
Ebola was ... Show more content on Helpwriting.net ...
Although there are no known treatments, treating the side effects are crucial in patient survival. Also, in diagnosing the disease is important in
controlling the spread by limiting contact between the healthy and those infected. While early symptoms can strongly resemble flu like effects, the
later effects have a much more drastic effect. The later symptoms of ebola can be confused with signs of Malaria, Typhoid fever, or meningitis. Those
showing signs should seek immediate attention from an Ebola assigned treatment center and refrain from contact with any other

The Ebola Virus Essay
Disease name Ebola hemorrhagic fever (Ebola HF)
Four identified subtypes of Ebola: (4)
В· Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast (cause disease in humans)
В· Ebola–Reston (cause disease in non–human primates only) Means of Transmission Person–to–person transmission
Direct contact of blood, secretions, semen, vomit, diarrhea (1) or organs of infected person
Sexually transmitted – "Transmission through semen may occur up to 7 weeks after clinical recovery, as with Marburg haemorrhagic fever." (2)
Direct contact of deceased body at burial ceremonies (3)
Indirect Contact: touching contaminated objects such as needles
Aerosol transmission:
"Not implicated in human outbreaks, although transmission in ... Show more content on Helpwriting.net ...
They, like humans, are believed to be infected directly from the natural reservoir or through a chain of transmission from the natural reservoir." (3)
Etiological agent: Filoviridae
"Together with Marburgvirus, Ebola makes up the family Filoviridae, of the order Mononegavirales ( the non–segmented, negative–sense,
single–stranded RNA viruses" (5)
Four identified subtypes of Ebola: (4)
В· Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast (cause disease in humans)
В· Ebola–Reston (cause disease in non–human primates only) General Characteristics: Appearance: thin and filamentous; comma shaped or branched
(1)
"Both Ebola and Lassa virus exhibit the following characteristics: (5)
В· insensitivity to antiviral effects of INF
В· dominant role of cellular immunity in recovery
В· highly glycosylated proteins affecting immune recognition
В· moderate cytopathic effects after isolation in mammalian cell culture
В· proclivity for infecting macrophages
В· immunosuppressive effects following infection

Lassa Fever: An Old World Arenavirus Essay
Lassa Fever: An Old World Arenavirus
ABSTRACT
A brief summary of lassa fever, its history, pathology and effects on the indigenous populations. Also, lassa fever in the context of newly emerging
diseases. LASSA FEVER
On January 12, 1969, a missionary nun, working in the small town of
Lassa, Nigeria, began complaining of a backache. Thinking she had merely pulled a muscle, she ignored the pain and went on about her business.
After a week, however, the nurse had a throat so sore and so filled with ulcers, she couldn't swallow. Thinking she was suffering from one of the many
bacterial diseases endemic to the area, her sisters administered every antibiotic they had on store in the town's Church of the ... Show more content on
Helpwriting.net ...
These viruses, long hidden in the deepest recesses of rain forests, are making their presence felt as much of the rain forest and other isolated areas
become more and more accessible. Lassa fever is mostly on the rise as its main vector, the rodent Mastomys natalensis, is increasing in numbers due
(indirectly) to an increase in poverty and scarcity of food.(Garrett, 1994) To be specific, when the endemic region has a scarcity of food, the villagers
kill and eat the larger rat, Rattus ra ttus, which is a main competitor of the Mastomys natalensis, thereby allowing the smaller Mastomys to flourish. The
disease mainly effects the areas of western Africa, from Senegal to, of course, Zaire, although it has been exported to the United States (about 115
cases). (Southern, 1996)
Lassa fever consists of two single strands of RNA enclosed within a spherical protein coat. The RNA exists as two strands designated L (for long)
and S (for short). The S segment is the more abundant of the two as it codes for the major structural components such as the internal proteins and the
glycoproteins, while the L segment codes for RNA polymerase and perhaps a few structural proteins. The protein coat has a number of T–shaped
glycoproteins protruding from it, composed of GP (glycoprotein)2 which is the base and GP1 which is the T–bar. (Southern, 1996) This structure is
what inserts itself into the receptors on the host cell. When the virus first gains entry into

Ebola Virus Disease
Ebola Virus Disease
Richard Wakeland
St. Petersburg College
Ebola Virus Disease
Ebola virus disease (EVD) formerly known as Ebola hemorrhagic fever is an often fatal disease caused by a virus. This virus can cause severe
hemorrhagic fever in humans (Occupational Safety & Health Administration [OSHA], N.D.). With world worldwide attention for its high mortality
rate, lack of effective treatment or vaccination EVD has become an important public health pathogen (Feldmann & Geisbert, 2011).
Since 1976, there have been 26 outbreaks of EVD resulting in an estimated 18,000 cases that has led to mortality rate of approximately 7100
individuals (Centers for Disease Control and Prevention [CDC], 2014a). Cases of EVD have been sporadic and limited ... Show more content on
Helpwriting.net ...
(2014a). Outbreaks chronology: Ebola virus disease. Retrieved November 25, 2014, from http://www.cdc.gov/vhf/ebola/outbreaks/history
/chronology.html#modalIdString_outbreaks
Centers for Disease Control and Prevention. (2014b). Guidelines for Evaluation of US Patients Suspected of Having Ebola Virus Disease. Retrieved
November 27, 2014, from http://emergency.cdc.gov/han/han00364.asp
Centers for Disease Control and Prevention. (2014c). Guidance on Personal Protective Equipment To Be Used by Healthcare Workers During
Management of Patients with Ebola Virus Disease in U.S. Hospitals, Including Procedures for Putting On (Donning) and Removing (Doffing).
Retrieved November 27, 2014, from http://www.cdc.gov/vhf/ebola/hcp/procedures–for–ppe.html
Chertow, D., Kleine, C., Edwards, J., Scaini, R., Giuliani, R., & Sprecher, A. (2014). Ebola virus disease in WestAfrica – Clinical manifestations and
management. Retrieved November 25, 2014, from http://www.nejm.org/doi/pdf/10.1056/NEJMp1413084
Dowell, S., Mukunu, R., Ksiazek, T., Khan, A., Rollins, P., & Peters, C. J. (1999). Transmission of Ebola hemorrhagic fever: A study of risk factors in
family members, Kikwit, Democratic Republic of the Congo, 1995. The Journal of Infectious Diseases, 179(Supplement 1), S87–S91. Retrieved from

Ebola is the better–known member of a small family of viruses known as Filoviridae. The other lesser–known member is Marburg. The Ebola virus has
five known subtypes, four of which are highly pathogenic to humans. The fifth, Ebola Reston Virus was first isolated in a group of primates that had
been imported from the Philippines to a research laboratory in Reston, Virginia. According to the Centers for Disease Control and Prevention, within
weeks, the same virus was isolated during similar outbreaks in labs in Pennsylvania, Texas and Siena, Italy. In each case, the affected animals had been
imported from a facility in the Philippines. (CDC, 2008) The four species that are pathogenic to humans are Zaire, Sudan, Tai Forest and Bundibugyo....
Show more content on Helpwriting.net ...
After confirmation of samples tested by the United States National Reference Laboratories and the CDC, the World Health Organization confirmed the
presence of a new species. An epidemiological study conducted by WHO and Uganda Ministry of Health scientists determined there were 116
confirmed and probable cases of the new Ebola species, and that the outbreak had a mortality rate of 34% (39 deaths). In 2012, there was an outbreak
of Bundibugyo ebolavirus in a northeastern province of the Democratic Republic of the Congo (DR Congo). There were 15 confirmed cases and ten
fatalities. (Wamala, 2010)
HISTORY
Many medical researchers speculate the Plague of Athens, which wiped out about a third of its inhabitants during the Peloponnesian War, may have
been caused by Ebola. As noted earlier, the Ebola virus was first isolated in 1976 during an outbreak of the disease along the border of Zaire and
Sudan. (CDC, 2014) Of all the outbreaks since 1976 this initial outbreak carried the worst mortality rate, roughly ninety percent of those affected did
not survive. (CDC, 2014) Ebola was named after a river in the Yambuku district of Democratic Republic of the Congo, which was then known as Zaire.
2007 to

Ebola Spread
Every time you turn on the news or pick up a newspaper, there is something being reported about the spread of Ebola. The Ebola outbreaks
occurring in Guinea, Sierra Leone and Liberia are growing larger and larger. This is the largest outbreak with more cases and deaths since Ebola
was first discovered nearly four decades ago. United States doctors and missionaries have traveled to these countries to help treat infected people.
However, there have now been cases where U.S. citizens have contracted the disease and have been brought back to the United States to be treated.
This has caused raised concerns about the disease spreading in the U.S. as well. The physical, cultural, economic, political and religious geography of
Africa have all played ... Show more content on Helpwriting.net ...
Now that Ebola patients are being treated in the U.S. and missionary doctors are returning from Africa, new procedures and guidelines are being
developed.
Kaci Hickox is a nurse who recently returned to the U.S. from treating Ebola patients in Sierra Leone. She was quarantined for 21 days because she
had a slight fever, which is one of the symptoms of Ebola. Ms. Hickox stated that she is "scared about how health care workers will be treated at
airports when they declare that they have been fighting Ebola in West Africa. I am scared that, like me, they will arrive and see a frenzy of
disorganization, fear and, most frightening, quarantine." It is essential that we balance helping those in need in Africa with how we protect the health
and well being of those in

Essay about The Ebola Virus
"You have to admire its simplicity. It's one billionth our size and it's beating us."– – Spoken by Colonel Sam Daniels, a character in the fictional movie
about Ebola, Outbreak.
The Ebola virus is the most feared virus of our time. What exactly is Ebola? Ebola is a viral hemorrhagic fever actually named after the River Ebola in
Zaire, Africa, where it was first discovered. It belongs to a genus of ribonucleic viruses called filoviruses, under the family Filofiridae, which are
characterized by their filament–like (thread–like) appearance with a little hook or loop at the end. Only five viruses exist in this family: the
not–as–deadly Marburg, and the four Ebola strains: Ebola Zaire, Ebola Sudan, Ebola Tai and Ebola Reston. The latter... Show more content on
Helpwriting.net ...
(Tables I and II)
The viruses in this family range from 800 to 1000 nanometers in length. Marburg and Ebola are distinguished by their length after purification.
Infectivity depends on particular lengths: the longer, the more infectious. All Ebola viruses measure up to about the same length. Each virus particle
consists of a helical–coiled tube made of four virally encoded proteins. This strand of RNA is found in an envelope formed from the host's plasma cell
membrane, which is now spiked with another carbohydrate–coated viral protein. Differences in gene sequence and very small differences in serological
nature are what make each Ebola virus unique from each other, with its own antigenic and biological properties.
The time needed for Ebola virus replication in infected body cells takes less than eight hours. Hundreds to thousands of new viral particles can be
produced and released from the host cell within days or even hours before the host cell dies. This replication process is repeated several times in an
Ebola patient before symptoms begin to show.
The diagnosis of Ebola is made by the detection of Ebola antibodies, antigens or genetic material, or by the culture of the virus, in blood or other
bodily fluid specimens that are examined in specialized laboratory tests. Such tests present a very extreme biohazard, so they are conducted in special
high–containment laboratories to ensure maximum protection for scientists.

The World's Fight Against Microbes Essay
The World's Fight Against Microbes
Many infectious diseases that were nearly eradicated from the industrialized world, and newly emerging diseases are now breaking out all over the
world due to the misuse of medicines, such as antibiotics and antivirals, the destruction of our environment, and shortsighted political action and/or
inaction. Viral hemorrhagic fevers are a group of diseases caused by viruses from four distinct families of viruses: filoviruses, arenaviruses,
flaviviruses, and bunyaviruses. The usual hosts for most of these viruses are rodents or arthropods, and in some viruses, such as the Ebola virus, the
natural host is not known. All forms of viral hemorrhagic fever begin with fever and muscle ... Show more content on Helpwriting.net ...
The patient develops chills, fever, headaches, muscle aches, and a loss of appetite. As the disease progresses vomiting, diarrhea, abdominal pain, sore
throat, and chest pain can occur. The blood fails to clot and patients may bleed from injection sites as well as into the gastrointestinal tract, skin, and
internal organs (CDC I).
The Ebola virus is spread through close personal contact with a person who is very ill with the disease, such as hospital care workers and family
members. Transmisson of the virus can also occur from the reuse of hypodermic needles in the treatment of patients. This practice is common in
developing countries where the health care system is underfinanced (CDC I).
Until recently, only three outbreaks of Ebola among people had been reported. The first two outbreaks occurred in 1976. One was in western Sudan,
and the other in Zaire. These outbreaks were very large and resulted in more than 550 total cases and 340 deaths. The third outbreak occurred in Sudan
in
1979. It was smaller with only 34 cases and 22 deaths. Three additional outbreaks were identified and reported between 1994 and 1996: a large
outbreak in Kikwit, Zaire with 316 cases and 244 deaths; and two smaller outbreaks in the
Ivory Coast and Gabon. Each one of these outbreaks occurred under the challenging conditions of the developing world. These conditions including a
lack of adequate medical

Outbreak of Ebola
Ebola was first recognized in 1976 as the cause of outbreaks of disease in the Democratic Republic of the Congo (then known as Zaire) and in Sudan.
About three hundred people in each of the two nations were infected with the virus, resulting in a mortality rate of 88% in Zaire, and 53% in Sudan
(Bulletin of the WHO 1978). The disease as it was discovered spread through direct contact of unmans to humans, and then thought, from non–human
primates to humans. The epidemic was a result of unsafe and unsanitary hospital practices, and non–sterilized medical equipment. The disease was then
contained, however sporadic outbreaks of the Zaire and Sudan Ebola subtypes have risen in the Democratic Republic of the Congo, Gabon, Uganda,
and Sudan; one of the latest outbreaks was in the Democratic Republic of the Congo in September of 2007. Therefore we ask ourselves, why is it
important to discuss the Ebola virus? The answer is simple; because we need to know how the disease infects humans, and how researchers and medical
professionals can prevent the virus from entering the organism. It is important to know that humans are not the host organism, or Ebola's natural
reservoir; humans simply become infected when they come in contact with the infected host, such as non–human primate, pigs, or even insects. In
2005, it was reported that fruit bats may serve as the natural reservoir of Ebola. Fruit bats live in regions of Africa that include areas where Ebola
outbreaks have occurred and

Ebola Essay
Ebola Impact on Human Health & Hygiene Essay
Historically Ebola has had a serious impact on human health and hygiene and still does due to the fact of no vaccine or treatment being discovered, but
thanks to improvements in scientific and medical knowledge the virus itself is now controllable.
Ebola is the virus Ebolavirus (EBOV), a viral genus, and the disease Ebola hemorrhagic fever (EHF), a viral hemorrhagic fever (VHF). The virus is
named after the Ebola River Valley in the Democratic Republic of the Congo (formerly Zaire), which is near the site of the first recognized outbreak
in 1976 at a mission hospital run by Flemish nuns. It has remained largely obscure until 1989 when several widely publicized outbreaks occurred among
... Show more content on Helpwriting.net ...
In 2003 a vaccine using an adenoviral vector carrying the Ebola spike protein was tested on crab–eating macaques. The monkeys were challenged with
the virus twenty–eight days later, and remained resistant.
Outbreaks of Ebola, with the exception of Reston Ebolavirus, have mainly been restricted to Africa. * The Zaire virus, formerly named Zaire
Ebolavirus, has the highest case–fatality rate, up to 90% in some epidemics, with an average case fatality rate of approximately 83% over 27 years.
The first outbreak took place on 26 August 1976 in Yambuku. * The Sudan Ebolavirus was the second species of Ebola emerging simultaneously
with the Zaire virus. It was believed to have originated amongst cotton factory workers in Nzara, Sudan. The most recent outbreak occurred in May
2004 in Yambio County, Sudan. The average fatality rates for SEBOV were 54% in 1976, 68% in 1979, and 53% in 2000 and 2001. * The Reston
Ebolavirus was discovered during an outbreak of Simian hemorrhagic fever virus (SHFV) in crab–eating macaques from Hazleton Laboratories (now
Covance) in 1989. Since the initial outbreak in Reston, Virginia, it has emerged in Siena Italy, Texas, and among pigs in the Philippines. Despite its
status as a Level–4 organism, it is non–pathogenic to humans although hazardous in monkeys. * The Ivory Coast Ebolavirus also referred to as Tai
Ebolavirus, was first discovered among chimpanzees from the Tai

Misconceptions About Ebola Virus Disease
MISCONCEPTIONS ABOUT EBOLA VIRUS DISEASE IN W. AFRICA
Whilst the virus was devastating and the United Nations and several countries stepped in to help, there were lots of misconceptions about Ebola – how
it spreads, the symptoms, risks and prevention, and what it would mean if it became a global pandemic. Misconceptions were on some of the following;
Ebola is an airborne virus, if you contract Ebola, you'll die, anyone with the virus is contagious, Someone infected in North America will lead to a
worldwide epidemic, being around someone infected is high risk, Ebola can be found in fruit, Antibiotics can cure Ebola, Ebola victims die by
bleeding out of their orifices, The disease is for the government to make money, and the virus was ... Show more content on Helpwriting.net ...
".... I also heard that a doctor died of Ebola, what I asked myself is, this doctor protected himself before attending to the Ebola patient so if Ebola is
not in the air how can the doctor just get close to the patient and contract the disease which affected him and he did. So I asked and I was told that it is
through the air the doctor got it" (FGD, Women, Rural, GAR).
"...and maybe if an infected person sneezes or coughs and the droplets come out and I happen to be close by and through the air I breathe in I can also
get it. That is the reason why health worker gets infected" (FGD, Female, Nurse, AR).
"I am trained, but during our training, we were told that one could not get Ebola through the air but I don 't believe that because some of the experts in
the use of PPE still got the condition. So I think they could have only been infected through the air" (FGD, Female, Nurse, GAR).
" For the mosquitoes, it is more serious because, they will suck the blood of the infected person, take some of the blood, and when they bite you to
suck your blood, then it will leave some of the organisms in your blood. It is just like how the mosquito gives people malaria by biting people with
malaria in their blood and put malaria in another person 's blood to get the condition" (FGD, Female, Rural NR).
"I agree with what number 5 has said, If

Viral Hemorrhagic Fever and Ebola Virus Species
What is Ebola hemorrhagic fever? Ebola hemorrhagic fever (Ebola HF) is a severe, often–fatal disease in humans and nonhuman primates (monkeys,
gorillas, and chimpanzees) that has appeared sporadically since its initial recognition in 1976. The disease is caused by infection with Ebola virus,
named after a river in the Democratic Republic of the Congo (formerly Zaire) in Africa, where it was first recognized. The virus is one of two
members of a family of RNA viruses called the Filoviridae. There are five identified subtypes of Ebola virus. Four of the five have caused disease in
humans: Ebola–Zaire, Ebola–Sudan, Ebola–Ivory Coast and Ebola–Bundibugyo. The fifth, Ebola–Reston, has caused disease in nonhuman primates,
but not in humans. ... Show more content on Helpwriting.net ...
Persons tested later in the course of the disease or after recovery can be tested for IgM and IgG antibodies; the disease can also be diagnosed
retrospectively in deceased patients by using immunohistochemistry testing, virus isolation, or PCR.
How is Ebola hemorrhagic fever treated?
There is no standard treatment for Ebola HF. Patients receive supportive therapy. This consists of balancing the patient's fluids and electrolytes,
maintaining their oxygen status and blood pressure, and treating them for any complicating infections.
How is Ebola hemorrhagic fever prevented?
The prevention of Ebola HF in Africa presents many challenges. Because the identity and location of the natural reservoir of Ebola virus are unknown,
there are few established primary prevention measures.
If cases of the disease do appear, current social and economic conditions often favor the spread of an epidemic within health–care facilities. Therefore,
health–care providers must be able to recognize a case of Ebola HF should one appear. They must also have the capability to perform diagnostic tests
and be ready to employ practical viral hemorrhagic fever isolation precautions, or barrier nursing techniques. These techniques include the wearing of
protective clothing, such as masks, gloves, gowns, and goggles; the use of infection–control measures, including complete equipment sterilization; and
the isolation of Ebola HF patients from contact with unprotected

Ebola (EBO) virus has made its presence around April and May in 1995 (7). The virus, at first, was medically diagnosed as epidemic dysentery but
was suspected by other medical providers to something else (7). The specimens of the patients were then sent to the Centers for Disease Control and
Prevention (CDC) in which was diagnosed as Ebola viral hemorrhagic fever, to conform their suspicion (7). This was the first large outbreak of the
virus and has since then been a topic of study because of its high mortality.
Diagnosis of EBO virus is accomplished in a variety of ways. The biosafety hazards accompanying the handling and testing of EBO virus makes
only a few specialized laboratories capable of testing it through serologic assays, virus isolation, polymerase chain reaction (PCR), and antigen
detection (4,7). Specific testing can be done by viral particles in the blood or measuring the antibody response to the virus (4). The virus is detected in
the blood after the onset of symptoms (5). If a patient is suspected of EBO virus and the ... Show more content on Helpwriting.net ...
RT–PCR is used for confirmation of acute infections (5). The RT–PCR is a one step process with the use of SYBR green I dye and the primer set
"Filo–A (5'–ATCGGAATTTTTCTTTCTCATT
–3') and Filo–B (5'–ATGTGGTGGGTTATAATAATCACTGACATG
–3')," which is used to amplify the
L genes of EBO virus (6). Other PCR methods include TaqMan probe–based that uses a probe that is labeled at the 5' end with the reporter dye
6–carboxyfluorescein and a quencher tag at the 3' end (6). These primer sets are used to identify the virus but there are more primer sets available for
identification of the target gene of specific strains in question for the virus (see Table 2. "Primers used for RT–PCR amplification..."

Viruses Plague And History Book Review
Viruses, Plagues, and History, written by Michael Oldstone, is an insightful and highly educational book that details the history of, that's right, viruses
and plagues. Through typically dry, yet engaging prose, Oldstone recounts what seems like all of it while simultaneously bringing to light the
contributions of those brave scientists who asked themselves, "why." He focuses his attention on some of the most notable viruses such as smallpox,
yellow fever, measles, polio, and later he focuses on more contemporary battles against disease. Oldstone begins by explaining the study of viruses,
virology, and its importance in understanding diseases. In informing the reader of what the study of viruses is, he establishes what variolation and
immunization are and the role they play in keeping the public safe from what can be very serious ailments. After explaining the study itself, Oldstone...
After explaining the danger and lack of means to prevent the spread of these severe ailments, Oldstone proceeds to go in depth about the
aforementioned ailments. He begins with Lassa fever by describing the name, and then describing a case in which the fever presented on several
different patients, effectively killing them in a very "The Last Stand" way. Oldstone repeats this in separate chapters about Ebola and Hantavirus, HIV,
and Mad Cow disease, highlighting the complexity of the maladies of modern day and the effect they have on their

Course Project Paper: Ebola
Ebola virus disease (EVD), formerly known as the Ebola hemorrhagic fever, is a highly infectious, deadly disease. Ebolavirus is from the virus family
of Filoviridae, which also includes Cuevavirus and Marburgvirus. Five species of Ebolavirus have been identified: Zaire, Bundibugyo, Sudan, Reston,
and Tai Forest.
The Ebola virus was first discovered in 1976 near the Ebola River, in what is now the Democratic Republic of Congo, and is now currently found in
many African countries. The first EVD outbreaks occurred in small, remote villages in CentralAfrica near rainforests, but the recent 2014 outbreak
began in West Africa, involving more urban areas than before. The most severely affected countries include Guinea, Liberia, and Sierra Leone, largely
due to the fact that they lack strong health and sanitation systems. The Zaire, Bundibugyo, and Sudan species, previously mentioned, have been
associated with the outbreaks in Africa. The recent 2014 outbreak belongs to the Zaire species.
In 2014, the largest Ebola epidemic in history affected multiple countries in West Africa. There were also two imported cases, including one death, and
two locally acquired cases in healthcare providers reported in the United States. The epidemic was ... Show more content on Helpwriting.net ...
Within a few days after symptoms begin, the diagnostic tests that confirm Ebola virus infection are the following: antigen–capture enzyme–linked
immunosorbent assay (ELISA) testing, IgM ELISA, polymerase chain reaction (PCR), electron microscopy and virus isolation by cell culture. Later in
the disease course, IgM and IgG antibody testing can be done. Retrospectively, immunohistochemistry testing, PCR, and virus isolation can be done in
deceased patients. During laboratory test, samples are extreme biohazard risk and should be conducted under maximum containment

The Ebola Virus Essay
In the year 1976, Ebola climbed out of its unknown hiding place, and caused the death of 340 people. Fear gripped the victims' faces, and uncertainty
tortured their minds. The people of Zaire waited outside clinics, churches and in their homes for a treatment of the horrible disease, but there was no
cure. They were forced to watch people die, hoping that they would be saved from the violent death of the Ebola virus. From the year of 1976 to the
present date of 1996, researchers have searched for origin and cure of the virus. Scientist have carried out numerous studies and investigations, but no
one has been able to find the right explanations.
Prevention of a world wide outbreak lies within the education of what the virus is capable of ... Show more content on Helpwriting.net ...
Ebola can spread by the reuse of hypodermic needles, which occurs frequently in underdeveloped countries like Zaire and Sudan, but it is unlikely to
become infected by close contact with persons infected who show no symptoms. The Ebola virus spreads through the blood and is replicated in organs,
including the liver, lymphatic organs, and kidneys. The central lesions appear to be those affecting the vascular endothelium and the platelets.
The resulting symptoms are bleeding, especially in the nose, abdomen, and pericardium. Capillary leakage appears to lead to loss of intravascular
volume, bleeding, shock and the acute respiratory disorder seen in fatal cases. Patients basically die of intractable shock. Those with severe illness
often have fevers and are delirious, combative and difficult to control.Some victims of the Ebola virus, one out of ten people infected, survive the
virus's deadly operations. Due to its self–limiting nature, the Ebola virus is known to sometimes die out within a person before killing the host
organism. Just like the history of wars and other social epidemics, the Ebola outbreaks need to be remembered and learned from.
The first two Ebola outbreaks were in 1976, in the countries of Zaire and western Sudan. These were large outbreaks, resulting in more than 550 cases
and 340 deaths. In 1979, Ebola mysteriously appeared in

A Short History Of Disease Chapter Summary
As the second part of this reflection paper, I selected a book 'A Short History of Disease' by Sean Martin. He is a writer and filmmaker also known
for his other famous books like The Knights Templar, Alchemy and alchemists, the Gnostics. His films include Lanterna Magicka: Bill Douglas &
the secret history of cinema. The most alluring thing which conceives me to cull this book is a history of the disease, as a medical professional, it's
always tantalizing to know from where all these begins and this book reaches up to my expectations as it started from the first ever recorded disease
in the history of mankind. He isn't lying when he say this a history of the disease. He starts from the earliest bacteria to evolve on the earth, long
before there was anything around to infect. This book is divided into seven chapters, each chapter describes the history of diseases in a particular era.
Chapter One: Prehistory, Chapter Two: Antiquity, Chapter Three: The Dark and Middle Ages, Chapter Four: The New World, Chapter
... Show more
content on Helpwriting.net ...
Smallpox believed to be brought by a Portuguese explorer in 1506 who also bring tuberculosis. This disease brings to America by African slaves
which kill more than half of the population of Indians, from there this disease spread to Mexico, Colombia, Cuba, Peru, Puerto Rico, Venezuela,
and Yucatan. In the 17th century, this disease spread to North America killing large numbers of people. Great pox which is known as syphilis
nowadays is another disease after smallpox which dominates this era. This disease is supposed to be traveled with a crew of Columbus who
introduce this disease in Europe. This disease traveled to India with Vasco de Gama who also introduce the world with a new type of skin disease
which is known as scurvy. Another disease which shows its glimpse is epilepsy. Arabs consider it as 'divine disease' and Babylonian consider it was
caused by 'touch of

Write An Essay On Ebola Virus
Name:TaLissa Battieste_
Causative Agent: Ebola Hemorrhagic Fever
Disease: Ebola Virus
Classification of the causative agent:
The Ebola virus is a member if the family filoviridae and the order mononegavirales and is the causative agent of the Ebola Hemorrhagic Fever. These
are enveloped viruses that have mini–genomes consisting of a single RNA molecule of negative or anti–MRNA sense. There are five different Ebola
virus genomes (BDBV, EBOV, RESTV, SUDV and TAFV) that differ in sequence and the number and location of gene overlaps.
History:
Most cases of the Ebola virus are located on the African continent. It was first identified in a province of Sudan and in a nearby region of Zaiire in
1976 after significant epidemics in Yambuku and Nzara, both in Africa.... Show more content on Helpwriting.net ...
Different strains of Ebola may have slight changes in their structure, indicating that virulence is mutagenic. The virus contains a nucleocapsid which
gives it some virulence as well.
Mode of transmission:
Ebola is transmitted in humans through the direct contact of blood or bodily fluids of a person infected with the virus. Examples of these fluids include
diarrhea, sweat, vomit, semen, urine, and breast milk. The virus can enter through breaks in the skin or mucous membranes including the nose, mouth
and eyes. Ebola is not an airborne disease that is transmitted through sneezing and coughing however large droplets from a person who is sick could be
infectious.
Incubation Period of the Disease:
The time interval from infection with the virus to the onset of symptoms, better known as the incubation period is 2–21 days. The average period is
8–10 days. Humans are not infections until they develop symptoms. Ebola is an acute viral infection with a rapid onset, brief period of symptoms and
resolution within days.

Signs and

WhatВґs The Ebola Virus?
Ebola is defined as a virus that causes severe bleeding, organ failure, and can lead to death (Mayo Clinic). Ebola was first discovered in 1976 near the
Ebola River in the Democratic Republic of the Congo (CDC). It was previously known as Ebola Hemorrhagic Fever and is a very rare and deadly
disease caused by infection with a strain of the Ebola virus (CDC). The Ebola virus has a 50% to 90% fatality rate (Visual Science Company). In
2014, there were only 6 cases in the U.S (Mayo Clinic). It is most common in African countries and appears sporadically. The disease can occur in
humans and nonhuman mammals, such as monkeys, bats, and apes (CDC). There are five different identified species of the Ebola virus and all
belong to the genus Ebolavirus. Four of the species are known to cause disease in humans: Ebolavirus zaire; Ebolavirus sudan; Ebolavirus taД« forest;
and Ebolavirus bundibugyo. The fifth virus, Ebolavirus reston, has only infected ... Show more content on Helpwriting.net ...
Early symptoms are headache, fever, muscle pain, weakness, fatigue, diarrhea, and abdominal pain (CDC). As the illness progresses, Ebola can cause
multiple organ failures, severe bleeding, seizures, coma, jaundice (yellowing of the skin), delirium (intoxicated state of mind),and shock (Mayo
Clinic). Ebola can lead to death for a high percentage of people who are infected. One reason that the virus is so deadly is because it interferes with the
immune system's ability to mount a defense (CDC). Scientists can't wrap their heads around the fact that some people recover and others don't. For
those who survive, recovery is slow. It may take months to regain weight and strength, and the virus remains in the body for weeks (CDC). People may
experience hair loss, sensory changes, liver inflammation (hepatitis), weakness, fatigue, headaches, eye inflammation, and testicular inflammation
(Mayo

Essay on The Marburg Hemorrhagic Fever Description
According to the World Health Organization (WHO), the Marburg Virus, or the Marburg hemorrhagic fever (MHF), is a very deadly virus. It has a
fatality rate anywhere from 24% all the way up to 88% if an outbreak occurs. The Marburg virus takes its name from Marburg, Germany; which is the
place where it was initially detected in the year of our Lord 1967. There were other outbreaks of this virus in Frankfurt, Germany and also in Belgrade,
Serbia. The main carrier of this virus is believed to be the rousettus aegypti, or fruit bat. Once a human has come into contact with this virus it is easily
spread among other humans. Most notably through through bodily fluids exchanged through sexual intercourse or when coming into contact with the...
The areas where bleeding can start are the intravenous areas. This can be very problematic as a patient will continue to bleed when being given fluids
through an IV. You can bleed from the nose, and the gums around your teeth. In females bleeding can also occur from the vagina. During this extreme
phase of the virus, the patient will continue to have a high fever. This can result in the patient becoming confused, easily frustrated and quick to anger.
Once this high fever has set in, males can suffer from a symptom called orchitis; which the inflammation of one or both of the testicles. Death usually
happens around the eighth or ninth day after the first of the symptoms, usually due to severe blood loss and shock.
Often times the Marburg Virus can be misdiagnosed with as other illnesses such as: malaria, typhoid fever, shigellosis, cholera, leptospirosis, plague,
rickettsiosis, relapsing fever, meningitis, hepatitis and other viral haemorrhagic fevers. The Marburg virus can only be diagnosed definitively by a
laboratory using the the following tests: enzyme–linked immunosorbent assay (ELISA), antigen detection tests serum neutralization test,
reverse–transcriptase polymerase chain reaction (RT–PCR) assay, and a virus isolation by cell culture. Because of the severity of this virus tests are
sent to laboratories that have only the highest of biological agent protection. There is currently no treatment or vaccine for the Marburg

The current Ebola virus breakout that is pervading West Africa and that recently surfaced in the United States represents one of the largest viral
pandemics known to date. Within three months, the breakout set the record as the widest sweeping and most fatal of any known Ebola pandemic
("Ebola Outbreak Sets Sobering Record" 1432). To date, there is no known cure or vaccination that has been proven to treat the virus. Furthermore, the
current regions of WestAfrica facing the brunt of the outbreak are ill–equipped to face such a widespread and immersing plague. Despite the extensive
response from the global network, which has ranged anywhere from increases in aid workers and medical supplies to heightened research and testing,
the Ebola outbreak ... Show more content on Helpwriting.net ...
Teams from the Centers for Disease Control and Prevention (CDC), in coordination with a response by the Global Outbreak Alert and Response
Network, also traveled to the affected regions following the initial discovery to contribute to the cause (Dixon and Schafer, 548). Director–general of
the World Health Organization, Dr. Margaret Chan, has largely led the coordination of the global response to the outbreak in Africa. On March 30, a
little over a week following the initial detection of the virus in Guinea, the organization dispatched an estimated 3.5 tons of infection management
supplies and resources to Conakry for distribution to other health facilities in the area. The WHO also deployed over 50 staff members to support the
affected regions ("Public Health Round–Up" 313). The organization further helped by launching a regional control center in Conakry ("Ebola Control
Centre" 549). Under the direction of the WHO, Ebola cases were initially analyzed, tested, and confirmed by the Institut Pasteur located in both France
and Senegal, in addition to the Bernhard Nocht Institute of Tropical Medicine in Germany. When the Ebola virus continued to inflict countless
casualties, testing trials were further performed by teams of Pasteur Institute

A Brief Note On Lujo Hemorrhagic Fever
Lujo Hemorrhagic Fever is caused by a bi–segmented negative RNA virus that is one of the several viruses known to cause viral hemorrhagic fever.
The Lujo virus is part of the Arenaviridae family, that consist of several viruses categorized into two primary groups. The Lujo virus is categorized in
the "Old World" group, which signifies that thevirus in question was discovered in the Eastern Hemisphere, specifically in Africa. The majority of
the arenaviruses that are categorized in the "Old World" group do not cause severe illness, with the exception of a few including the Lassa and Lujo
virus. As of 2012, the Lujo virus is classified as a select agent as it is distinguished to possess the potential to severely threaten the US public's health
and safety when the mortality rate and modes of transmission is taken into consideration.
Lujo Hemorrhagic Fever at the time being has been reported in five patients, in the time span ranging from September to October in 2008. The cases
originated in Southern Africa, in the cities of Lusaka and Johannesburg. The cities are the basis for the naming of the virus; the first two letters of both
cities were utilized to name the virus. The first patient, a 36–year–old female in Lusaka was reported to be infected with the Lujo virus prior to
September 2nd. Symptoms manifested on said day, and the patient was admitted to a clinic on the sixth day of the illness; Patient one expired on
illness day 10. No source of infection was determined,

The Social Inequalities And The Biosocial Ecology

Recommended

Recommended

More Related Content

More from Michelle Wilson

More from Michelle Wilson (20)

Recently uploaded

Recently uploaded (20)

The Social Inequalities And The Biosocial Ecology