Updated Lecture about Zika virus .
Currently I am working in Arar Central Hospital, Arar city
In Saudi Arabia
Please do not hesitate to contact us if you require any further information.
Alsultany@hotmail.com
Zika virus disease is a mosquito-borne viral infection that primarily occurs in tropical and subtropical areas of the world.
It is related to other pathogenic vector borne flaviviruses including dengue, West-Nile and Japanese encephalitis viruses but produces a comparatively mild disease in humans
Genre: Flavivirus
Vector: Aedes mosquitoes (which usually bite during the morning and late afternoon/evening hours)
Reservoir: mosquitoes (gut, blood, saliva )
human ( blood, prostate, semen and testes )
Three years ago, the Zika virus was nowhere to be found in the Western Hemisphere. But in 2015, Brazil suddenly found itself in the throes of an unprecedented Zika outbreak — with more than a million people infected by the mosquito-transmitted disease
Zika virus disease is a mosquito-borne viral infection that primarily occurs in tropical and subtropical areas of the world.
It is related to other pathogenic vector borne flaviviruses including dengue, West-Nile and Japanese encephalitis viruses but produces a comparatively mild disease in humans
Genre: Flavivirus
Vector: Aedes mosquitoes (which usually bite during the morning and late afternoon/evening hours)
Reservoir: mosquitoes (gut, blood, saliva )
human ( blood, prostate, semen and testes )
Three years ago, the Zika virus was nowhere to be found in the Western Hemisphere. But in 2015, Brazil suddenly found itself in the throes of an unprecedented Zika outbreak — with more than a million people infected by the mosquito-transmitted disease
Advisor Live: Zika virus disease – What you need to knowPremier Inc.
Presented as part of Premier’s AdvisorLive® series and co-sponsored by the Society for Healthcare Epidemiology of America (SHEA) and the Association for Professionals in Infection Control and Epidemiology (APIC)
This webinar covers:
* Updates and late breaking information on Zika virus outbreak, lab diagnosis and travel,
* Issues for reproductive age and pregnant women, including evaluation, management, counseling, and congenital findings, and
* Implications and risks for healthcare personnel.
EXPERT PRESENTERS:
* Joanne Cono, MD, ScM, Director, Office of Science Quality, Office of the Director, Centers for Disease Control and Prevention (CDC)
* Jeanne S. Sheffield, MD, Director of Maternal-Fetal Medicine and Professor, Johns Hopkins Medicine
* Moderator: Gina Pugliese, RN, MS, Vice President, Premier Safety Institute
This presentation summarizes what we know as of 10/27/16 about the connection between Zika virus and microcephaly, and what advice physicians could provide for their patients who are currently pregnant, or planning a pregnancy
Advisor Live: Zika virus disease – What you need to knowPremier Inc.
Presented as part of Premier’s AdvisorLive® series and co-sponsored by the Society for Healthcare Epidemiology of America (SHEA) and the Association for Professionals in Infection Control and Epidemiology (APIC)
This webinar covers:
* Updates and late breaking information on Zika virus outbreak, lab diagnosis and travel,
* Issues for reproductive age and pregnant women, including evaluation, management, counseling, and congenital findings, and
* Implications and risks for healthcare personnel.
EXPERT PRESENTERS:
* Joanne Cono, MD, ScM, Director, Office of Science Quality, Office of the Director, Centers for Disease Control and Prevention (CDC)
* Jeanne S. Sheffield, MD, Director of Maternal-Fetal Medicine and Professor, Johns Hopkins Medicine
* Moderator: Gina Pugliese, RN, MS, Vice President, Premier Safety Institute
This presentation summarizes what we know as of 10/27/16 about the connection between Zika virus and microcephaly, and what advice physicians could provide for their patients who are currently pregnant, or planning a pregnancy
Neurological and Autoimmune Complications of Zika Virus infection - Slideset ...WAidid
The slideset by Professor Safadi analyses the case control study providing evidence for Zika virus infection causing Guillain-Barré syndrome.
In addition to Zika Virus association with Guillain-Barré syndrome, the slides show new data from endemic areas suggesting that ZIKV may be linked to other neurological outcomes.
Zika virus in human placenta, developing brainSinjini Sarkar
This presentation contains a brief discussion on the Zika virus infection in human brain and placenta with its worldwide prevalence. It also sheds light on the drugs that might be useful for inhibiting the virus and future research areas.
This is the first time in history that ZIKV has been associated with the development of adverse birth outcomes and has been linked to perinatal transmission. Little is known regarding the natural history, epidemiological transmission patterns, and major risk factors associated with ZIKV. Data on the outcomes of pregnancies in ZIKV infected women as well as specific trimesters when pregnant women are at highest risk for developing an adverse birth outcome remains sparse. This presentation discusses the epidemiological background and history of Zika Virus, preventative methods, and risk factors. In addition, the presentation discusses a research proposal to evaluate potential risk factors associated with the development of adverse birth outcomes in pregnant women with a laboratory confirmed diagnosis of ZIKV versus those Zika Virus infected pregnant women that did not develop adverse birth outcomes in three low-income regions of Northeastern Brazil.
Zika Virus: Medical Countermeasure Development Challenges by Robert W. MaloneJan-Cedric Hansen
Reports of high rates of primary microcephaly and Guillain–Barré syndrome associated with Zika virus infection in French Polynesia and Brazil have raised concerns that the virus circulating in these regions is a rapidly developing neuropathic, teratogenic, emerging infec- tious public health threat. There are no licensed medical countermeasures (vaccines, thera- pies or preventive drugs) available for Zika virus infection and disease. The Pan American Health Organization (PAHO) predicts that Zika virus will continue to spread and eventually reach all countries and territories in the Americas with endemic Aedes mosquitoes. This paper reviews the status of the Zika virus outbreak, including medical countermeasure options, with a focus on how the epidemiology, insect vectors, neuropathology, virology and immunology inform options and strategies available for medical countermeasure develop- ment and deployment.
Zika and Dengue: Creating Partnerships to Interrupt Transmission (Honein)Rotary International
Zika, a mosquito-borne virus, can be passed from a pregnant
woman to her fetus, potentially causing microcephaly and
other devastating defects. Environmental factors may
contribute to the spread of the viruses that cause Zika,
dengue, and other tropical diseases, as a changing climate
may allow their mosquito carriers to flourish. Though
no vaccines exist for Zika or dengue, Rotary clubs can
implement service projects to provide education, clean up
mosquito habitats, promote prevention, and implement
an exciting new method to interrupt mosquitoes’ ability to
transmit these viruses.
Shaping the Caribbean's response to Zika, UWI’s Zika Task Force (www.uwi.edu/zika) is gathering and providing expert advice to develop a strategic, scientific approach toward tackling the Zika virus.
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Lung Cancer: Artificial Intelligence, Synergetics, Complex System Analysis, S...Oleg Kshivets
RESULTS: Overall life span (LS) was 2252.1±1742.5 days and cumulative 5-year survival (5YS) reached 73.2%, 10 years – 64.8%, 20 years – 42.5%. 513 LCP lived more than 5 years (LS=3124.6±1525.6 days), 148 LCP – more than 10 years (LS=5054.4±1504.1 days).199 LCP died because of LC (LS=562.7±374.5 days). 5YS of LCP after bi/lobectomies was significantly superior in comparison with LCP after pneumonectomies (78.1% vs.63.7%, P=0.00001 by log-rank test). AT significantly improved 5YS (66.3% vs. 34.8%) (P=0.00000 by log-rank test) only for LCP with N1-2. Cox modeling displayed that 5YS of LCP significantly depended on: phase transition (PT) early-invasive LC in terms of synergetics, PT N0—N12, cell ratio factors (ratio between cancer cells- CC and blood cells subpopulations), G1-3, histology, glucose, AT, blood cell circuit, prothrombin index, heparin tolerance, recalcification time (P=0.000-0.038). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and PT early-invasive LC (rank=1), PT N0—N12 (rank=2), thrombocytes/CC (3), erythrocytes/CC (4), eosinophils/CC (5), healthy cells/CC (6), lymphocytes/CC (7), segmented neutrophils/CC (8), stick neutrophils/CC (9), monocytes/CC (10); leucocytes/CC (11). Correct prediction of 5YS was 100% by neural networks computing (area under ROC curve=1.0; error=0.0).
CONCLUSIONS: 5YS of LCP after radical procedures significantly depended on: 1) PT early-invasive cancer; 2) PT N0--N12; 3) cell ratio factors; 4) blood cell circuit; 5) biochemical factors; 6) hemostasis system; 7) AT; 8) LC characteristics; 9) LC cell dynamics; 10) surgery type: lobectomy/pneumonectomy; 11) anthropometric data. Optimal diagnosis and treatment strategies for LC are: 1) screening and early detection of LC; 2) availability of experienced thoracic surgeons because of complexity of radical procedures; 3) aggressive en block surgery and adequate lymph node dissection for completeness; 4) precise prediction; 5) adjuvant chemoimmunoradiotherapy for LCP with unfavorable prognosis.
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...VarunMahajani
Disruption of blood supply to lung alveoli due to blockage of one or more pulmonary blood vessels is called as Pulmonary thromboembolism. In this presentation we will discuss its causes, types and its management in depth.
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
Ethanol (CH3CH2OH), or beverage alcohol, is a two-carbon alcohol
that is rapidly distributed in the body and brain. Ethanol alters many
neurochemical systems and has rewarding and addictive properties. It
is the oldest recreational drug and likely contributes to more morbidity,
mortality, and public health costs than all illicit drugs combined. The
5th edition of the Diagnostic and Statistical Manual of Mental Disorders
(DSM-5) integrates alcohol abuse and alcohol dependence into a single
disorder called alcohol use disorder (AUD), with mild, moderate,
and severe subclassifications (American Psychiatric Association, 2013).
In the DSM-5, all types of substance abuse and dependence have been
combined into a single substance use disorder (SUD) on a continuum
from mild to severe. A diagnosis of AUD requires that at least two of
the 11 DSM-5 behaviors be present within a 12-month period (mild
AUD: 2–3 criteria; moderate AUD: 4–5 criteria; severe AUD: 6–11 criteria).
The four main behavioral effects of AUD are impaired control over
drinking, negative social consequences, risky use, and altered physiological
effects (tolerance, withdrawal). This chapter presents an overview
of the prevalence and harmful consequences of AUD in the U.S.,
the systemic nature of the disease, neurocircuitry and stages of AUD,
comorbidities, fetal alcohol spectrum disorders, genetic risk factors, and
pharmacotherapies for AUD.
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
Couples presenting to the infertility clinic- Do they really have infertility...Sujoy Dasgupta
Dr Sujoy Dasgupta presented the study on "Couples presenting to the infertility clinic- Do they really have infertility? – The unexplored stories of non-consummation" in the 13th Congress of the Asia Pacific Initiative on Reproduction (ASPIRE 2024) at Manila on 24 May, 2024.
Couples presenting to the infertility clinic- Do they really have infertility...
Zika virus disease 2016 Updated Version!
1. Virology Section
Laboratory & B.B.
Arar Central Hospital
Northern Borders
Saudi Arabia
Fadi Alanazi
A Laboratory Specialist
BScin BiomedicalScience(UK)
AUDin Laboratory Sciences
2. • Enveloped, spherical, about 50 nm in diameter .
• The surface proteins are arranged in an icosahedral-like symmetry
• The virus is inactivated by ether, sodium dexoxycholate and chloroform.
VIRION
4. Nucleotide (top) and amino acid (bottom) , the potential glycosylation sites of the MR 766
(Uganda, 1947) and the IbH 30656 (Nigeria, 1968) strains. Deletions are indicated by
dashes. The ‘‘N’’ at position 467 of the P6-740 strain (Malaysia, 1966) represents an equally
weighted double population of the nucleotides ‘‘C’’ and ‘‘T’’. This translates to an ‘‘X’’ at
position 165 of the amino acid alignment.
(Haddow et al., 2012)
5. The primer pairs targeting the E gene were
ZIK-ES1 (TGGGGAAAYGGDTGTGGACTYTTTGG)/
ZIK-ER1 (CCYCCRACTGATCCRAARTCCCA) and
ZIK-ES2 (GGGAGYYTGGTGACATGYGCYAAGTT)/
ZIK-ER2 (CCRATGGTGCTRCCACTCCTRTGCCA).
The primer pairs for NS3 amplification were
ZIK-NS3FS (GGRGTCTTCCACACYATGTGGCACGTYACA)/
ZIK-NS3FR (TTCCTGCCTATRCGYCCYCTCCTCTGRGCAGC) and
ZIK-X1 (AGAGTGATAGGACTCTATGG)/
ZIK-X2 (GTTGGCRCCCATCTCTGARATGTCAGT).
RT-PCR with specific primers derived from published ZIKV sequences.
Adenine= thymine, cytosine = guanine
(Grard et al., 2014)
6. REPLICATION
CYTOPLASMIC nislammam, NUCLEAR nistcesni
1. Attachement (Viral E protein to the host receptors (
2. Fusion of RNA genome into cytoplasm
The +ssRNA is translated into polyproteins
Replication takes place at the surface of endoplasmic reticulum in cytoplasmic
viral factories .
A dsRNA genome is synthesized from the genomic ssRNA .)+(
The dsRNA genome is transcribed/replicated thereby providing
viral mRNAs/new ssRNA)+( genomes.
3. Virus assembly occurs at the endoplasmic reticulum
Then transported to the Golgi apparatus.
4. Release of new virions by exocytosis.
9. Some studies have demonstrated that ZIKV is endemic to Africa and Southeast Asia
(Grard et al., 2014)
Before 2007, few cases of human infection with ZIKV had been reported.
In 2007, an epidemic of ZIKV infection in humans occurred in Yap, Federated States
of Micronesia, in the Pacific region. A seroprevalence survey determined that ≤70%
.of the population had been infected
During 2007–2013, the few cases of infection with ZIKV reported were in travelers
returning from Africa or Southeast Asia
10. In May 2015, the WHO confirmed the first local transmission of Zika virus in the
Americas in Brazil then spread rapidly to other countries in the Americas.
In January 29, 2016, local transmission has been detected in at least 22 countries or
territories, including the Commonwealth of Puerto Rico and the U.S. Virgin Islands.
Zika virus can infect pregnant women in all three trimesters
Meaney-Delman et al, 2016
11.
12.
13. Sign and Symptoms
In humans, ZIKV infection is characterized by:
- Mild fever (37.8°C–38.5°C);
- Joint pain( notably of small joints of hands and feet)
- Muscle pain
- Headache
- Conjunctivitis
- Rash
- CBC Test
(mild leukopenia and thrombocytopenia associated with
activated lymphocytes)
ZIKV infection
Believed to be asymptomatic or mildly symptomatic
in most cases. Thus, Zika can be misdiagnosed during
the acute (viremic) phase because of nonspecific influenza like
signs and symptoms. Hemorrhagic signs have not been
reported in ZIKV-infected patients
(Gourinat et al, 2016)
14. Transient infection in Monkeys, Human, maybe rodents .
Life-long infection in Mosquitoes from the Aedes suneg.
Keratinocytes and dendritic cells at site of inoculation
then spread to lymph nodes and bloodstream.
ASSOCIATED DISEASES:
Adult-> nialliuG-erraBemordnys (Suspected)
Pregnant women- >nrobweNylahpecorcim(detcepsus(
NATURAL HOSTS
TROPISM
15.
16.
17. - Intellectual disability (decreased ability to learn and function in daily life)
- Problems with movement and balance
- Feeding problems, such as difficulty swallowing
- Hearing loss
- Vision problems
Microcephaly has been linked with the following problems:
18. Zika is primarily transmitted through the bite of infected Aedes mosquitoes
It can also be transmitted from a pregnant mother to her baby during pregnancy or around
the time of birth
Sexual transmission was reported in two case reports.
There is a potential risk of ZIKV transfusion-derived transmission
TRANSMISSION
There is no evidence that women can transmit Zika virus to their sex partners.
20. Guidelines for Breastfeeding for
Mothers with Zika Virus Infection
Zika virus RNA has been identified in breast milk, but attempts to culture the virus have
been unsuccessful
No cases of Zika virus infection associated with breastfeeding have been reported.
CDC encourages mothers with Zika virus infection to breastfeed their infants.
CDC/Morbidity and Mortality Weekly Report (MMWR)Last Update Feb 2016
21. What is the treatment for Zika?
There is no vaccine or specific medicine to treat Zika virus infections.
Treat the symptoms:
• Get plenty of rest.
• Drink fluids to prevent dehydration.
• Take medicine such as acetaminophen to reduce fever and pain.
• Do not take aspirin or other non-steroidal anti-inflammatory drugs.
NB: If you are taking medicine for another medical condition, talk to your Doctor
before taking additional medication.
22. What can people do to prevent becoming infected with Zika?
• protect yourself and your family from mosquito bites
• Stay in places with air conditioning or that use window and door screens to
keep mosquitoes outside.
• If you are also using sunscreen, apply sunscreen before applying insect repellent
• If you have a baby or child:
Dress your child in clothing that covers arms and legs, or
Cover crib, pushchair, and baby carrier with mosquito netting.
23. Are you immune for life once infected?
Once a person has been infected, he or she is likely to be protected from future infections.
24. Can a previous Zika infection cause a woman who later gets
pregnant to have a baby with microcephaly?
Currently, there is no evidence to suggest that Zika virus, after it is cleared from the blood,
poses a risk of birth defects for future pregnancies.
Zika virus usually remains in the blood of an infected person for about a week.
25. • Detection of virus RNA in Samples by using reverse transcription PCR (RT-PCR).
• Nucleic Acid Amplification Test.
• Serological tests, including immunofluorescence assays and ELISA may indicate the
presence of anti-Zika virus IgM and IgG antibodies, few laboratories have this ability.
(Gourinat et al, 2016)
ZIKV infection diagnosis relies on serology–which is challenging due to
cross-reactions with other flaviviruses.
Biological confirmation of ZIKV infections
26. Some facts about sample detection
The suitability of urine samples for diagnosis of ZIKV infection by showing that
ZIKV RNA is detectable in urine at a higher load and with a longer duration than
in serum by real-time RT-PCR.
At the time the rash was observed, viremia was probably decreasing, which
makes detection of virus in serum samples extremely challenging.
Urine samples were positive for ZIKV >10 days after onset of disease, which
was a notably longer period than for serum samples
(Gourinat et al, 2016)
27. The virus is present in semen longer than in blood. How long? At least 2
weeks after symptoms of infection began.
The use of saliva sample increased the rate of molecular detection of ZIKV at
the acute phase of the disease but did not enlarge the window of detection of
ZIKV RNA. Saliva was of particular interest when blood was difficult to collect
(children and neonates especially).
(Musso et al, 2015)
Some facts about sample detection
28. • Saliva or urine samples collected during the first 3 to 5 days after
symptom onset.
• Serum collected in the first 1 to 3 days.
Some facts about sample Collection
(WHO/ Western Pacific Region, 2016)
29. What should be done?
• Alert healthcare providers and the public about Zika.
• Post travel notices and other travel-related guidance.
• Provide regional laboratories with diagnostic tests such as Damma regional lab.
• Detect and report cases, which will help prevent further spread.
30. References
1. Besnard M, Lastere S, Teissier A, Cao-Lormeau V, Musso D. Evidence of perinatal
transmission of Zika virus, French Polynesia, December 2013 and February 2014. Euro
Surveill 2014;19:20751.
2. Haddow AD, Schuh AJ, Yasuda CY, Kasper MR, Heang V, Rekol Huy, et al. Genetic
characterization of Zika virus strains: geographic expansion of the Asian lineage. PLoS
Negl Trop Dis. 2012;6:e1477. http://dx.doi.org/10.1371/ journal.pntd.0001477
3. Grard G, Caron M, Mombo IM, Nkoghe D, Mboui Ondo S, Jiolle D, et al. (2014) Zika
Virus in Gabon (Central Africa) – 2007: A New Threat from Aedes albopictus? PLoS Negl
Trop Dis 8(2): e2681. doi:10.1371/journal.pntd.0002681
4. Gourinat AC, O’Connor O, Calvez E, Goarant C, Dupont-Rouzeyrol M 2015.
Detection of Zika virus in urine. Emerg Infect Dis 21: 84-86
5. Musso D , Roche C, Robin E, Teissier A, Cao-Lormeau VM (2015). Detection of Zika
virus in saliva. Pub|Med, (68:53-5).
6. ViralZone:www.expasy.org/viralzone, SIB Swiss Institute of Bioinformatics
Editor's Notes
The virion RNA is infectious and serves as both the genome and the viral messenger RNA. The whole genome is translated in a polyprotein 3,419 aa long, which is processed co- and post-translationally by host and viral proteases.
Guillain–Barré syndrome (GBS) is a rapid-onset muscle weakness as a result of damage to the peripheral nervous system. Many experience changes in sensation or develop pain, followed by muscle weakness beginning in the feet and hands. The symptoms develop over half a day to two weeks. During the acute phase, the disorder can be life-threatening with about a quarter developing weakness of the breathing muscles and requiring mechanical ventilation.
Amniocentesis is a diagnostic procedure performed by inserting a hollow needle through the abdominal wall into the uterus and withdrawing a small amount of fluid from the sac surrounding the fetus.
Can a previous Zika infection cause a woman who later gets pregnant to have a baby with microcephaly?
Currently, there is no evidence to suggest that Zika virus, after it is cleared from the blood, poses a risk of birth defects for future pregnancies. Zika virus usually remains in the blood of an infected person for about a week
